ID: 961372743

View in Genome Browser
Species Human (GRCh38)
Location 3:126441319-126441341
Sequence GCTGCTAGTGCGCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372736_961372743 2 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372742_961372743 -7 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372739_961372743 -1 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372737_961372743 1 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372738_961372743 0 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34
961372741_961372743 -4 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372743 Original CRISPR GCTGCTAGTGCGCCACAAGC AGG Intronic
906057858 1:42930288-42930310 GCTGCTACTCTGCCACAAGAGGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
1064228286 10:13506501-13506523 CCTGCTAGGGCACCACATGCAGG + Intronic
1073057221 10:100710384-100710406 GCGGCTAGGGCGCCCCAGGCCGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG + Exonic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG + Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130455994 15:84108918-84108940 TCTGCTAGTAAGCCACAAGGTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1141903125 16:87005900-87005922 GCTGAAGGTGCCCCACAAGCTGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
936981054 2:118265729-118265751 GCTGCTGATGCACAACAAGCAGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1180076042 21:45463372-45463394 GCTGCTATTGTGCCAAGAGCTGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
972582681 4:40408822-40408844 GCTACTAGGGCGCCTGAAGCAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
984164334 4:176289265-176289287 GGTGCTAGTGTGACACAAGAGGG - Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1041117245 8:54551834-54551856 GATGCTCATGCGCCACAAGATGG + Intergenic
1055848035 9:80591290-80591312 GCTGCTAATGAAGCACAAGCAGG - Intergenic
1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG + Intronic
1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG + Intergenic
1199676050 X:150190122-150190144 GCTGCTAGTGGGACACTAGGAGG + Intergenic