ID: 961372745

View in Genome Browser
Species Human (GRCh38)
Location 3:126441334-126441356
Sequence CAAGCAGGCCGCCCTAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372737_961372745 16 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372742_961372745 8 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372741_961372745 11 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372736_961372745 17 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372739_961372745 14 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66
961372738_961372745 15 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372745 Original CRISPR CAAGCAGGCCGCCCTAGAAA TGG Intronic
900270154 1:1782920-1782942 CAGGCAGGCCGCCCCAGGGAGGG + Intergenic
900605510 1:3521881-3521903 CAAGCAGGGTGGCCTAGAAATGG + Intronic
903139712 1:21332180-21332202 GAAGCAGGCCTCTCCAGAAAGGG - Intronic
905524096 1:38623592-38623614 CATGCAGGCTGCCCAAGGAAGGG - Intergenic
912413489 1:109493351-109493373 CAAGGAGGCCTCCCTGGGAAAGG - Intergenic
913286745 1:117233537-117233559 CATGCAGGTTGTCCTAGAAAGGG - Intergenic
917085267 1:171298657-171298679 AAAGCAGGTCGCCCAAGAGAGGG + Intergenic
923934781 1:238748274-238748296 GAAGCAGGCTGCCCTACAAGTGG + Intergenic
1064112749 10:12552690-12552712 CAAGCAGGCCTTCCTGCAAAGGG - Intronic
1067055430 10:43047052-43047074 CAAGCAGGGCGCATTAGACAAGG - Intergenic
1072294334 10:93994428-93994450 CATGCAGGCCGCCCTCGCAGGGG + Intronic
1073152339 10:101320710-101320732 GATGCAGGCTGCCCCAGAAAAGG + Intergenic
1077407835 11:2390643-2390665 CAGGGAGGCGGCCCTGGAAAGGG + Intronic
1077618050 11:3693250-3693272 CATGCTGAGCGCCCTAGAAATGG + Exonic
1083142266 11:60731983-60732005 CAAGCATGTCGCCTTAGGAAGGG + Intronic
1084710254 11:70839724-70839746 CTGCCAGGCCGCCCTGGAAAAGG + Intronic
1090192158 11:124779713-124779735 CAAGCTGGCCACACTGGAAATGG + Intronic
1102249973 12:111380151-111380173 CAAGGAGGCCTTCCTAGAAGAGG - Intergenic
1103305700 12:119962382-119962404 GATGCAGGCTGCCCTAGGAAGGG + Intergenic
1104926354 12:132316012-132316034 CAGGCAGGCAGCCCCCGAAACGG + Intronic
1106353474 13:28956780-28956802 GAAGAAGGCTGCCCTAGAGATGG + Intronic
1106353488 13:28956840-28956862 GAAGAAGGCTGCCCTAGAGATGG + Intronic
1108021860 13:46135864-46135886 CAAGCAAGCCTCCCTAGTACGGG + Intronic
1110076074 13:71244810-71244832 AAAGCAGGACACCCTGGAAATGG + Intergenic
1122591165 14:102852414-102852436 CAAGCAGGCCGCACTGGAGTCGG - Intronic
1127503375 15:59575427-59575449 CATGCAGGCAGGCCTAGGAAAGG - Intergenic
1132891892 16:2208693-2208715 CAAGCAGGCGGCCCCAGCAGAGG - Intronic
1139914396 16:70419134-70419156 CAGGCTGGCCACCCTGGAAAAGG + Intronic
1149632353 17:58136992-58137014 AAAGGAGGCAGCCATAGAAAGGG - Intergenic
1150137794 17:62705034-62705056 CAAACAGGTCTCCCAAGAAAGGG - Intronic
1151663779 17:75534021-75534043 CAGGTAGGAGGCCCTAGAAAGGG + Intronic
1154004640 18:10516561-10516583 CCAGCAGGCCGGGCTAGAGAAGG + Intergenic
1165271590 19:34712215-34712237 AAAGCAGGTCGCCCAAGAGAGGG - Intergenic
933812573 2:86042260-86042282 CAAGCAGGGTGCCCTAGGACAGG - Intronic
934746777 2:96764448-96764470 ACAGCAGGCCGCCCTGGAGATGG + Intronic
935360565 2:102243296-102243318 CAAGCAGGCCTCCCTAGGGGTGG + Intergenic
940874061 2:158883171-158883193 CAAGCAGGAGGCCCCAGACAAGG + Intergenic
943441474 2:187932633-187932655 AAAGCAGGCCGCCCTGCAAGTGG - Intergenic
945767309 2:213996897-213996919 CAGGCAGGCAAACCTAGAAAGGG - Intronic
947709996 2:232307996-232308018 CAAGCAGGCCTGCTTAGAAACGG - Intronic
948279478 2:236735839-236735861 CAACCGGGCTGCCCTAGCAAAGG - Intergenic
948350478 2:237336103-237336125 CAAGATGGCAGCCCTAGCAAGGG + Intronic
1170711384 20:18794263-18794285 CAAGCAGCCTGCCCCAGAAGTGG - Intergenic
1173737386 20:45372055-45372077 GGAGGAGGCCACCCTAGAAATGG - Intronic
1181884106 22:26005580-26005602 CAAGAGGGCCACCCTTGAAAAGG - Intronic
953029948 3:39172754-39172776 CAAGGAAGCAGCCCTAGGAAAGG + Intergenic
959555666 3:107714303-107714325 CAAGAAGGCCTCCCTGGAAAAGG - Intronic
961372745 3:126441334-126441356 CAAGCAGGCCGCCCTAGAAATGG + Intronic
978860106 4:113438735-113438757 TATGCGGGCTGCCCTAGAAAGGG + Intergenic
986736665 5:10673534-10673556 CACGCAGGCAGCCTGAGAAAGGG - Intergenic
987771039 5:22305603-22305625 AATGCAGGCCGCCCTAGGGAAGG + Intronic
990133821 5:52620693-52620715 CAACCAGGGCGCTCCAGAAAAGG + Intergenic
994250346 5:97528858-97528880 CATGCATGCCACCCTAGAATAGG - Intergenic
1001444566 5:171773421-171773443 AAAGCAAGCAGCCCTAGACAGGG - Intergenic
1003753413 6:9088425-9088447 AAAGCAGTCTGCCCAAGAAATGG + Intergenic
1004721132 6:18268199-18268221 CATGCAGGCAGCCCCAGGAAGGG + Intergenic
1006824417 6:36923841-36923863 CAAGCAGGCCCACCTGGTAAAGG - Intronic
1007874136 6:45076815-45076837 CTAGCAGGGCCCCCTAGAAATGG + Intronic
1008523461 6:52384367-52384389 CAGGCAGGCAGACCTAGCAAAGG + Intronic
1010731397 6:79395288-79395310 CTAGTAGGCCTCACTAGAAATGG - Intergenic
1019486274 7:1290843-1290865 GGAGCAGGCAGCCCTGGAAATGG - Intergenic
1023357881 7:39385824-39385846 GATGTAGGCCACCCTAGAAAGGG - Intronic
1025824274 7:64997985-64998007 CAAGCAGGCCGCCTTCGACCTGG - Intronic
1037791930 8:21952050-21952072 AAAGCAGGCCATCCTAGGAAAGG - Intronic
1041538485 8:58955706-58955728 CAAACAGGCAGCCGTGGAAAAGG + Intronic
1042347871 8:67746386-67746408 TAATCAGGCTCCCCTAGAAAGGG + Intergenic
1042470047 8:69176761-69176783 CAAGCAGGCTTCACTGGAAAGGG + Intergenic
1048951216 8:139498472-139498494 CAAGCAGGCCCCCTTAGAATTGG + Intergenic
1051380935 9:16457817-16457839 CAAGCAGGCCTCCCTAAAGAGGG + Intronic
1052044487 9:23778509-23778531 CCAGCAGGTTGCCCTATAAATGG + Intronic
1054760059 9:68996653-68996675 CAAAGAAGCCGCCTTAGAAACGG - Intronic
1186461424 X:9751310-9751332 CAATCAGGCGGCCCCAGCAATGG + Intronic
1186680888 X:11872644-11872666 CAAGCAGGCTGCTCTCCAAAGGG + Intergenic