ID: 961372746

View in Genome Browser
Species Human (GRCh38)
Location 3:126441335-126441357
Sequence AAGCAGGCCGCCCTAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372742_961372746 9 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372741_961372746 12 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372736_961372746 18 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372737_961372746 17 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372739_961372746 15 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41
961372738_961372746 16 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG 0: 1
1: 0
2: 0
3: 14
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372746 Original CRISPR AAGCAGGCCGCCCTAGAAAT GGG Intronic
900605511 1:3521882-3521904 AAGCAGGGTGGCCTAGAAATGGG + Intronic
903139711 1:21332179-21332201 AAGCAGGCCTCTCCAGAAAGGGG - Intronic
904864907 1:33570753-33570775 ATGCAGGCTGGCCTAGGAATGGG - Intronic
905941436 1:41866469-41866491 AAGCAGCCTGCCCTAGAAAGTGG - Intronic
907617364 1:55938494-55938516 AAGCACGCCCCACTGGAAATGGG + Intergenic
909912478 1:81277997-81278019 AGGCTGGCTGCCCTGGAAATGGG + Intergenic
919490557 1:198200327-198200349 AAGCAAGCTGGCCAAGAAATTGG - Intronic
921982061 1:221269861-221269883 ATGCAGGAAGCCTTAGAAATGGG + Intergenic
1063308893 10:4934465-4934487 AAGCAGGCTGTCCTAGAAAGAGG - Intronic
1064698406 10:17991166-17991188 AAGCAGGAAGCCCCAGAATTTGG + Exonic
1066704247 10:38160213-38160235 AACCAGGGCTCCCTAGAAATAGG - Intergenic
1066986373 10:42471663-42471685 AACCAGGGCTCCCTAGAAATAGG + Intergenic
1073152340 10:101320711-101320733 ATGCAGGCTGCCCCAGAAAAGGG + Intergenic
1076480376 10:130781382-130781404 AAGCAGGCGGCTCTGGAAATAGG - Intergenic
1084186774 11:67476895-67476917 AAGCAGGCTGCCCGAGCTATCGG + Intergenic
1103423446 12:120809688-120809710 CAGCAGGCAGCCATAGGAATAGG - Intronic
1106353475 13:28956781-28956803 AAGAAGGCTGCCCTAGAGATGGG + Intronic
1106353489 13:28956841-28956863 AAGAAGGCTGCCCTAGAGATGGG + Intronic
1106353499 13:28956901-28956923 AAGAAGGCTGCCCTCGAGATGGG + Intronic
1106353513 13:28956960-28956982 AAGAAGGCTGCCCTAGAGATAGG + Intronic
1118292394 14:64539111-64539133 AAGCAGGCTCCCATATAAATGGG - Intronic
1124017685 15:25891415-25891437 AAGCAGGCATCCCCAGATATTGG - Intergenic
1135187539 16:20328226-20328248 ATGTAGGCTGCCCTAGAGATTGG + Intergenic
1140625931 16:76794305-76794327 AAGCAAGCCGCCCAAGAACCTGG - Intergenic
1149632352 17:58136991-58137013 AAGGAGGCAGCCATAGAAAGGGG - Intergenic
1155703200 18:28775340-28775362 AAGCAGAATACCCTAGAAATGGG - Intergenic
942458450 2:176153061-176153083 AAGCAGGCCGCCCTCGGACTAGG + Exonic
1168987999 20:2067167-2067189 AAGCAAGCTGCCCTGAAAATTGG - Intergenic
1183395860 22:37570437-37570459 AGGCAGGAGGCCCTGGAAATGGG + Intronic
953237804 3:41121385-41121407 AAGAAGGCAGCCCGAGAAAGTGG + Intergenic
956933695 3:74075649-74075671 AAGCAGGCAGGCTTAGAAACAGG + Intergenic
961372746 3:126441335-126441357 AAGCAGGCCGCCCTAGAAATGGG + Intronic
962393265 3:134991979-134992001 AAATAAGCAGCCCTAGAAATGGG - Intronic
964781817 3:160347399-160347421 GAATAGGCAGCCCTAGAAATTGG - Intronic
975091253 4:70406982-70407004 AAGCAGGCAGCCCTAAAAACCGG + Intronic
975797739 4:78026934-78026956 AAGAAGGTTGCCATAGAAATAGG - Intergenic
981605407 4:146535277-146535299 ATGCAGGCAGCCTTAGAAAATGG - Intergenic
987771040 5:22305604-22305626 ATGCAGGCCGCCCTAGGGAAGGG + Intronic
996785633 5:127233829-127233851 AAGCAGGTGGCCCTAGTAATAGG + Intergenic
998150853 5:139756622-139756644 CAGCAGAGCGCCCTAGGAATAGG + Intergenic
1000056273 5:157609264-157609286 AAGGAGGCAGCCATAAAAATGGG - Intergenic
1001444565 5:171773420-171773442 AAGCAAGCAGCCCTAGACAGGGG - Intergenic
1003753414 6:9088426-9088448 AAGCAGTCTGCCCAAGAAATGGG + Intergenic
1004199172 6:13532106-13532128 ATGCAGGCAGCCCTAGAAGGTGG - Intergenic
1007734086 6:43969634-43969656 ATGCAGGCAGCCTTAGATATAGG + Intergenic
1010731396 6:79395287-79395309 TAGTAGGCCTCACTAGAAATGGG - Intergenic
1019486273 7:1290842-1290864 GAGCAGGCAGCCCTGGAAATGGG - Intergenic
1023357880 7:39385823-39385845 ATGTAGGCCACCCTAGAAAGGGG - Intronic
1023574649 7:41613851-41613873 ATGCAGGCAGCTCTAGAATTTGG - Intergenic
1041709510 8:60880575-60880597 AAGCACTCTGCCCTACAAATTGG - Intergenic
1046303113 8:112324247-112324269 AAGCTTGCCAGCCTAGAAATTGG + Intronic
1052044488 9:23778510-23778532 CAGCAGGTTGCCCTATAAATGGG + Intronic
1055124612 9:72704534-72704556 AGGCAGGCAGCTCTAGGAATTGG + Intronic
1186461425 X:9751311-9751333 AATCAGGCGGCCCCAGCAATGGG + Intronic
1189031437 X:37455451-37455473 GAGCAGGCTGCCCCATAAATGGG + Exonic
1197650581 X:129059499-129059521 AAACAGGGCCTCCTAGAAATAGG + Intergenic