ID: 961372747

View in Genome Browser
Species Human (GRCh38)
Location 3:126441336-126441358
Sequence AGCAGGCCGCCCTAGAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372742_961372747 10 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372737_961372747 18 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372738_961372747 17 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372736_961372747 19 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372741_961372747 13 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72
961372739_961372747 16 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG 0: 1
1: 0
2: 1
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372747 Original CRISPR AGCAGGCCGCCCTAGAAATG GGG Intronic
900605512 1:3521883-3521905 AGCAGGGTGGCCTAGAAATGGGG + Intronic
906673182 1:47675250-47675272 AGGAGGCAGCACTAGAAAGGTGG + Intergenic
915722761 1:157996105-157996127 AGCAGGAAGCCATAGAATTGAGG + Intronic
918796000 1:188897570-188897592 AGCAGGCCGCCCTAGCCAGCAGG - Intergenic
921506626 1:215979060-215979082 AGGAGGCCTCCCTAGCCATGTGG - Intronic
923008986 1:230073412-230073434 AGCAGGGAACCCTAGAAAGGTGG - Intronic
1066291926 10:34022343-34022365 AGCCCGCCGCCCTAGAAGGGAGG + Intergenic
1066704246 10:38160212-38160234 ACCAGGGCTCCCTAGAAATAGGG - Intergenic
1066986374 10:42471664-42471686 ACCAGGGCTCCCTAGAAATAGGG + Intergenic
1072432036 10:95381060-95381082 AGCAGACCACCCTGGAAAAGCGG - Intronic
1073080142 10:100854463-100854485 AGCTGTCCACCCAAGAAATGGGG + Intergenic
1073152341 10:101320712-101320734 TGCAGGCTGCCCCAGAAAAGGGG + Intergenic
1075862543 10:125689454-125689476 TTCAGGCAGCCCGAGAAATGTGG + Intergenic
1076480375 10:130781381-130781403 AGCAGGCGGCTCTGGAAATAGGG - Intergenic
1081553192 11:44132909-44132931 ATCAGCCCACTCTAGAAATGTGG - Intronic
1088603942 11:111511560-111511582 AGCAGCCTCCCCTAGAAATATGG - Intronic
1088728524 11:112660162-112660184 AGCAGGCCACCATAGACCTGGGG - Intergenic
1092726898 12:11495904-11495926 AGCAGGCAGGAGTAGAAATGTGG - Intronic
1100478223 12:94953509-94953531 AGCAGGTCCCCCTATAAATATGG + Intronic
1101574546 12:105985359-105985381 AGCAGCACTCCCTACAAATGAGG + Intergenic
1101702336 12:107186090-107186112 AGCAGGCAGCCCCAGAAAGAAGG + Intergenic
1102608753 12:114092157-114092179 AGCAGGCCCCCCCTGAAATCTGG + Intergenic
1112124195 13:96446831-96446853 AGCAGTTCGCCCTCGAAATGTGG + Intronic
1113985290 13:114310057-114310079 AGCAGGCTGCCCAAGAACTATGG - Intergenic
1115782811 14:36788525-36788547 ACCAGGCCGCCCTTTAATTGTGG + Intronic
1116369052 14:44106881-44106903 AGTAGGCCCCCTTAGTAATGGGG + Intergenic
1133969012 16:10553693-10553715 ACCAGGCAGCCCAAGGAATGAGG - Intronic
1138421511 16:56902309-56902331 ACCTGGCACCCCTAGAAATGGGG + Intronic
1145029353 17:19492894-19492916 AGCAAGCTGCCCAAGGAATGTGG - Intergenic
1147766353 17:42839001-42839023 AGCAGCCCTACCTAGAAATCTGG - Exonic
1161822154 19:6536311-6536333 ATCAGGTCTCCCCAGAAATGTGG + Intergenic
1165212144 19:34244361-34244383 AGCAGGCTGGCCCAGACATGAGG - Intergenic
1166618756 19:44275954-44275976 AGCAGCCCACCCTAGTAATCTGG - Intronic
1166952501 19:46438917-46438939 AGCAGGCCGCGCAAGAGAGGAGG + Intergenic
1166952696 19:46440331-46440353 AGCAGGCCGCGCAAGAGAGGAGG + Intergenic
925180094 2:1811871-1811893 AGCAGGACGCCCTGCAAATCCGG + Intronic
927874619 2:26647259-26647281 AGGAGGCCCCCATAGAAATCAGG - Intergenic
927912655 2:26912304-26912326 GAGAGGCCGCCCTGGAAATGTGG - Intronic
931875834 2:66511024-66511046 AGCAGCCAGGCTTAGAAATGAGG - Intronic
940789708 2:158019194-158019216 AGGAGGCCTTCCTAGAACTGGGG + Intronic
1170886052 20:20340623-20340645 AACAGGCAGCACTGGAAATGAGG + Intronic
1171150560 20:22823316-22823338 AGCAGGCCTGCCAACAAATGTGG - Intergenic
1172335014 20:34108440-34108462 AGCAGACCTCCCCAAAAATGAGG + Intronic
1173251158 20:41364872-41364894 AGAAGGCGGCCCCAGAAAAGAGG - Intronic
1175236834 20:57519729-57519751 AGTGGGGCGCCCAAGAAATGTGG + Intronic
1175338527 20:58212549-58212571 AGCAAGTGGCCCAAGAAATGTGG - Intergenic
1179494841 21:41765049-41765071 ACCAGGCCACCCAAGAAATAAGG + Intronic
1179826490 21:43968930-43968952 AGTGGGTCGCCCCAGAAATGAGG - Intronic
1180197082 21:46203416-46203438 AGCAAGCCGCCATGGAAATGTGG + Intronic
949981976 3:9507853-9507875 AGCAGGCCACTGTAGAGATGGGG + Intronic
953872734 3:46641520-46641542 AGGAGGCTGCCCTAGGAATATGG + Intergenic
956583300 3:70837681-70837703 AGCAGGCAGCCTTAGTTATGGGG - Intergenic
958145871 3:89623775-89623797 AGTAGGCCGCCCCAGCCATGTGG - Intergenic
961372747 3:126441336-126441358 AGCAGGCCGCCCTAGAAATGGGG + Intronic
962948877 3:140199681-140199703 AGCTGGCCTTCCCAGAAATGAGG + Intronic
987392270 5:17387255-17387277 TGCAGGCCTCACTGGAAATGAGG + Intergenic
988961071 5:36372342-36372364 AGCAGGACCCTCTTGAAATGGGG + Intergenic
995231714 5:109772220-109772242 CACACGCCGCCATAGAAATGGGG - Intronic
996785634 5:127233830-127233852 AGCAGGTGGCCCTAGTAATAGGG + Intergenic
998150854 5:139756623-139756645 AGCAGAGCGCCCTAGGAATAGGG + Intergenic
1000908163 5:166988776-166988798 ACACGGCTGCCCTAGAAATGTGG + Intergenic
1001444564 5:171773419-171773441 AGCAAGCAGCCCTAGACAGGGGG - Intergenic
1002135337 5:177104162-177104184 AGGAGGCTGCCCAAGAATTGAGG - Intergenic
1002332084 5:178450161-178450183 AGCAAGCAGCCCTAGGTATGTGG + Intronic
1005099059 6:22149761-22149783 AGCACTTCGCTCTAGAAATGGGG - Intergenic
1011858634 6:91726844-91726866 AGCAGGTAGGCCTAGAATTGTGG - Intergenic
1019486272 7:1290841-1290863 AGCAGGCAGCCCTGGAAATGGGG - Intergenic
1022003534 7:26247098-26247120 GGCAGGCCATCCTAGAACTGTGG - Intergenic
1026545251 7:71316653-71316675 AGCAGGCCTCCCTAGGTATGCGG - Intronic
1029153728 7:98500078-98500100 ATCAGGCCTCCCTAGCCATGTGG - Intergenic
1033890799 7:146010927-146010949 GGCAGGCAGCTCTAGAAGTGGGG - Intergenic
1034873190 7:154701668-154701690 AGGTGGCAGCCATAGAAATGAGG - Intronic
1050251905 9:3753468-3753490 AGTAGGCAGCCCCAAAAATGGGG - Intergenic
1052044489 9:23778511-23778533 AGCAGGTTGCCCTATAAATGGGG + Intronic
1055815117 9:80195747-80195769 GTGAGGCCACCCTAGAAATGTGG + Intergenic
1059110194 9:111550412-111550434 AGCAAGCTGACCCAGAAATGTGG + Intronic
1060259761 9:122063829-122063851 AGCTGGTCACCCTAGCAATGGGG + Intronic
1060358938 9:122936569-122936591 AGCAAGCCGCACCAGGAATGTGG - Intergenic
1199229471 X:145419404-145419426 AAAAGGCAGCCCAAGAAATGAGG - Intergenic