ID: 961372748

View in Genome Browser
Species Human (GRCh38)
Location 3:126441339-126441361
Sequence AGGCCGCCCTAGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372736_961372748 22 Left 961372736 3:126441294-126441316 CCCCCACCACCTTCAGCATAGAA 0: 1
1: 0
2: 4
3: 29
4: 339
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372738_961372748 20 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372742_961372748 13 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372737_961372748 21 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372739_961372748 19 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76
961372741_961372748 16 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372748 Original CRISPR AGGCCGCCCTAGAAATGGGG TGG Intronic
903850909 1:26305499-26305521 AGGCTGCCTTGGAAAAGGGGTGG - Intronic
904029950 1:27527775-27527797 GTGCTGCCCTGGAAATGGGGTGG - Intergenic
912411397 1:109483201-109483223 AGCCAGCCCCAGAACTGGGGTGG - Intergenic
917650445 1:177071549-177071571 AGGCCTCTGTAGGAATGGGGTGG - Intronic
919241731 1:194923965-194923987 AGGTCACCCTATAAATGGGCTGG - Intergenic
921769341 1:219017093-219017115 AGGAAGACCTAGTAATGGGGAGG + Intergenic
922749078 1:228062386-228062408 AGGCAGCCCCAGGAGTGGGGTGG + Intergenic
922867901 1:228876119-228876141 AGGCCACCCTAGGAATGGTGAGG + Intergenic
923159639 1:231305177-231305199 AGGCCTCCCTAAATATGGGTAGG - Intergenic
1070796617 10:79220472-79220494 AGGCCTCCCTGGAAGTGGGCTGG - Intronic
1070959367 10:80488064-80488086 AGGCCACCCTAGAGGTGAGGAGG - Intronic
1073193194 10:101666935-101666957 GCCCAGCCCTAGAAATGGGGTGG - Intronic
1073542910 10:104327304-104327326 AAGACTCCCTTGAAATGGGGAGG - Intronic
1076480374 10:130781378-130781400 AGGCGGCTCTGGAAATAGGGAGG - Intergenic
1078318008 11:10307836-10307858 AAGCCGCCCTAGCAATGCGTGGG + Intergenic
1078390350 11:10931345-10931367 AGGCCGCCCTAGGAGGGAGGGGG + Intergenic
1091304994 11:134531136-134531158 ATGCCGCCTTGGAAAGGGGGAGG + Intergenic
1101351016 12:103930136-103930158 AGGCCGCCCAGGCAAAGGGGCGG + Intronic
1104426481 12:128682335-128682357 AGGCCACATTAGAAATGGAGAGG - Intronic
1110158872 13:72351902-72351924 AGGCAGCCATAGAAATGAAGGGG + Intergenic
1112299099 13:98213989-98214011 TGGCAGCCCTAGAGATGGGGAGG + Intronic
1126099752 15:45112002-45112024 AGGCCGCCCTGGCCGTGGGGAGG - Intronic
1126110827 15:45173810-45173832 AGGACAGCCTAGAAATGAGGAGG + Intronic
1132556190 16:573763-573785 GGGCCGGCCTGGAAATGGGAGGG + Intronic
1133237396 16:4393661-4393683 AAAACGTCCTAGAAATGGGGAGG + Intronic
1133969010 16:10553690-10553712 AGGCAGCCCAAGGAATGAGGTGG - Intronic
1135187540 16:20328230-20328252 AGGCTGCCCTAGAGATTGGAAGG + Intergenic
1136408974 16:30065601-30065623 AGGCCGCGCTAGGAAGGGGCGGG - Intronic
1139528252 16:67529291-67529313 AGGCTGGGCTGGAAATGGGGAGG + Intronic
1139658626 16:68404861-68404883 TGGCAGCAGTAGAAATGGGGCGG + Intronic
1143305320 17:5941918-5941940 ACGGAGCCCAAGAAATGGGGAGG - Intronic
1144341020 17:14310354-14310376 GGGCAGCACTAGAAATGGGTGGG - Intronic
1144588388 17:16502933-16502955 TGGGCACCCTAGAAAAGGGGTGG - Intergenic
1147579264 17:41619202-41619224 AGGCTGCGCTAGACCTGGGGTGG - Intergenic
1148821250 17:50360901-50360923 AGGGGACCCTAGAAGTGGGGTGG + Exonic
1151597777 17:75088492-75088514 AGGCAGCCCCAGAGGTGGGGTGG - Intronic
1151655332 17:75493173-75493195 AGGCCTCCCTAGCAATGGGTGGG - Intronic
1162322336 19:9977558-9977580 AGGAGGCCCTAGGAATGGGATGG + Intronic
1163296643 19:16417057-16417079 AGGCCTTCCTAGCACTGGGGAGG + Intronic
1165042835 19:33081155-33081177 AGGCCGCCGTAGCGAGGGGGCGG + Exonic
1165809118 19:38600071-38600093 AGGCCACGCTGGAAATGGTGAGG - Exonic
1166169157 19:41015225-41015247 AGACGGCCCCAGAGATGGGGAGG + Intronic
925777128 2:7346724-7346746 ATGCAACCCTAGAAATAGGGTGG + Intergenic
935942751 2:108258408-108258430 AGGCCATCCTATAAATGGGTAGG - Intronic
937701646 2:124868953-124868975 AGGGCTCCCTAGGAATGGGAAGG + Intronic
938757247 2:134392068-134392090 AAGCTGCCTGAGAAATGGGGAGG + Intronic
1170715394 20:18826681-18826703 AGGCCCCATAAGAAATGGGGTGG + Intronic
1175257874 20:57657815-57657837 AGGCGTCCCCAGAAGTGGGGAGG + Intronic
1179891626 21:44338647-44338669 AGGCGGGCCGGGAAATGGGGGGG + Intronic
1180177491 21:46097821-46097843 AGGTCGTCCGGGAAATGGGGCGG + Intergenic
1180706479 22:17813391-17813413 AGGCCGCCCCACAGATGGGATGG - Intronic
1181872454 22:25910807-25910829 AGGCTGCCCTAGTGATTGGGTGG - Intronic
1184328422 22:43810048-43810070 ATGCCACCATAGATATGGGGGGG + Intronic
950417750 3:12878014-12878036 AGACAGCCCTGGCAATGGGGAGG - Intergenic
950422540 3:12907363-12907385 AGGCAACCCCAGGAATGGGGGGG + Intronic
954686189 3:52371563-52371585 AGGCTACCCGAGAAATGTGGGGG - Intronic
959743577 3:109749690-109749712 AGGACTCCTTAGACATGGGGAGG + Intergenic
961372748 3:126441339-126441361 AGGCCGCCCTAGAAATGGGGTGG + Intronic
963090654 3:141480590-141480612 AGCTGGGCCTAGAAATGGGGAGG + Intergenic
968065080 3:195754008-195754030 AGGCAGGCCTGGAAAGGGGGTGG - Intronic
968972551 4:3803579-3803601 AGGCCGCCCTCGAGCAGGGGAGG - Intergenic
975986761 4:80207433-80207455 GCACCGCCCTAGAAGTGGGGAGG - Intergenic
986728596 5:10618318-10618340 AGGCCGGTCTAGAAATGAAGAGG - Exonic
987392273 5:17387258-17387280 AGGCCTCACTGGAAATGAGGGGG + Intergenic
990476983 5:56171060-56171082 GAGTGGCCCTAGAAATGGGGAGG - Intronic
993437526 5:87916134-87916156 AGGCCAGCCTAGTACTGGGGTGG - Intergenic
995490911 5:112690959-112690981 AGGACGCTTTGGAAATGGGGTGG + Intergenic
995841896 5:116450231-116450253 AGACGGCCCCAGTAATGGGGTGG + Intronic
1004793183 6:19051341-19051363 AGGCCAGTCTAGAAATGGTGTGG + Intergenic
1013361431 6:109396993-109397015 AGGCAGCCCTACAACTGGGAAGG + Intronic
1017870190 6:158480425-158480447 AGCAGGCCCTAGAACTGGGGTGG - Intronic
1026986655 7:74559250-74559272 AGGCTGCCCTTGCCATGGGGGGG - Intronic
1030098059 7:105919195-105919217 AGGCCTCCCTAGGAAGGGGCAGG - Intronic
1034174490 7:149090368-149090390 AGGCCGACCTAGGAGCGGGGCGG - Intronic
1037815481 8:22109543-22109565 GGGCCGCCCTGGAACTGGGGGGG + Intergenic
1047741425 8:127810025-127810047 AGGCAGCCTTATAAATGGGGAGG - Intergenic
1057708033 9:97412032-97412054 AGGCTGCCCTCGAAGCGGGGCGG + Exonic
1060259762 9:122063832-122063854 TGGTCACCCTAGCAATGGGGCGG + Intronic
1062111625 9:134785179-134785201 TGGCTGCCCTAGGCATGGGGTGG + Intronic
1185620599 X:1450917-1450939 AGGACCCCCTAGGAATGGGGAGG - Intronic
1185620677 X:1451128-1451150 AGGACCCCCTAGGAATGGGGAGG - Intronic
1185620691 X:1451163-1451185 AGGACCCCCTAGGGATGGGGAGG - Intronic
1189947142 X:46191029-46191051 AGGCAGCCAGAGAAATGTGGAGG + Intergenic
1190773812 X:53536802-53536824 AGGACAGCCCAGAAATGGGGTGG + Intronic