ID: 961372752

View in Genome Browser
Species Human (GRCh38)
Location 3:126441348-126441370
Sequence TAGAAATGGGGTGGCTGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961372741_961372752 25 Left 961372741 3:126441300-126441322 CCACCTTCAGCATAGAAAGGCTG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372738_961372752 29 Left 961372738 3:126441296-126441318 CCCACCACCTTCAGCATAGAAAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372739_961372752 28 Left 961372739 3:126441297-126441319 CCACCACCTTCAGCATAGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372737_961372752 30 Left 961372737 3:126441295-126441317 CCCCACCACCTTCAGCATAGAAA 0: 1
1: 0
2: 0
3: 21
4: 230
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372742_961372752 22 Left 961372742 3:126441303-126441325 CCTTCAGCATAGAAAGGCTGCTA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353
961372744_961372752 -6 Left 961372744 3:126441331-126441353 CCACAAGCAGGCCGCCCTAGAAA 0: 1
1: 0
2: 0
3: 0
4: 51
Right 961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG 0: 1
1: 0
2: 1
3: 44
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961372752 Original CRISPR TAGAAATGGGGTGGCTGAGA CGG Intronic
900279850 1:1859683-1859705 GAGAAGTGGGGTGGGGGAGAGGG + Intronic
901769938 1:11524909-11524931 CAGAGATGGGGTGGCAGGGATGG - Intronic
901988371 1:13092952-13092974 AAAAAATGGTGGGGCTGAGATGG - Intergenic
901993441 1:13133815-13133837 AAAAAATGGTGGGGCTGAGATGG + Intergenic
902599377 1:17530765-17530787 TAGCATTGGGGAGGCTGAGGTGG + Intergenic
902918467 1:19652642-19652664 TAGAGGTGGGCTGGCTGAGTGGG - Intronic
903066683 1:20703582-20703604 AAGTAATGGGGTGGGTGGGAAGG + Intronic
903091621 1:20924644-20924666 TTGAACTGGGGAGGCTGAGTTGG - Intronic
904025068 1:27497388-27497410 GGGAAATGGGGTGGGTGGGAGGG + Intergenic
905313365 1:37065858-37065880 TAGATGTGGGGTGGGTGTGAGGG - Intergenic
905461522 1:38125892-38125914 TAGAGGTGAGGAGGCTGAGAGGG + Intergenic
906153270 1:43600100-43600122 TAGCACTGGGCAGGCTGAGAGGG - Intronic
906661198 1:47583506-47583528 CAGAACAGGGGTGGCTGAGATGG - Intergenic
906864956 1:49408015-49408037 TCTAAATGGGGTGTCTGAGCTGG - Intronic
907171935 1:52475779-52475801 TAATAATGGGATGGCTGAGAAGG + Intronic
907360445 1:53909550-53909572 TAGAACTGGAGAGGCAGAGATGG + Intronic
907427921 1:54392751-54392773 CAGGAATGGGGTGGCAGAAAGGG + Intronic
907560877 1:55386190-55386212 TTGAAACGGGGAGGCTGAGATGG + Intergenic
908387314 1:63654641-63654663 TAAAAATAGGGAGGCTGAGGTGG + Intronic
908911361 1:69074853-69074875 TAGAAATGGGAAGGAGGAGAGGG - Intergenic
910335482 1:86124869-86124891 TTGAAATGGAGTATCTGAGAGGG - Exonic
910886860 1:91973020-91973042 TTTATATGGGGTGGTTGAGAAGG + Intronic
911452429 1:98080717-98080739 AGGAAATGGGGTGGATAAGAGGG - Intergenic
911705463 1:101007011-101007033 TAGAAATTTGGTGACTGAAATGG - Intronic
912857699 1:113186029-113186051 TAGAAATGGGCTGGGTGTGATGG + Intergenic
913082477 1:115401430-115401452 TAAAAATGGGGTTGCTGATAAGG - Intergenic
913233944 1:116764449-116764471 GAGAAGTGGGATGGCTGGGAGGG - Intronic
915217244 1:154348569-154348591 CAGAGATGGGGTGGCTGGAAAGG + Intronic
915269788 1:154745897-154745919 TGGAGATGGCGTGGCAGAGATGG + Intronic
916006279 1:160664147-160664169 TAGCAATGAGGTGGGAGAGAAGG + Intergenic
916930012 1:169567154-169567176 TAGAAAGAGGGTGAGTGAGAGGG + Intronic
917289127 1:173454206-173454228 GAGAAATGGGGTGTCTGGCAGGG - Intergenic
918138629 1:181700939-181700961 CAGAAATGGGATGGTGGAGATGG - Intronic
918181290 1:182087606-182087628 TGCAGCTGGGGTGGCTGAGAGGG - Intergenic
918446450 1:184621922-184621944 AAGAAATGGGGTGGTTGAGTGGG + Exonic
924795892 1:247291884-247291906 TTGAAATGGGGTCGGGGAGAAGG - Intergenic
1064085502 10:12343124-12343146 TAAAAATGGGCTGGGTGAGGTGG + Intergenic
1064504696 10:16015797-16015819 TGGAGGTGGGGTGGCTGGGAGGG + Intergenic
1064716872 10:18185700-18185722 TAGAAATAGGGTGTGTGAGTGGG + Intronic
1066508421 10:36068139-36068161 TGGAAATGGAGTACCTGAGAGGG + Intergenic
1066588663 10:36967671-36967693 TAGATATGGTGTGTCTGAGGAGG + Intergenic
1068596470 10:58907509-58907531 TAGCTATTGGGAGGCTGAGACGG + Intergenic
1068690673 10:59910453-59910475 TAGAAATAGAGTGGCTGGGCCGG - Intergenic
1068727629 10:60320835-60320857 TGCAAATGGGGTGGTGGAGAAGG - Intronic
1069138106 10:64790150-64790172 TAGAACTGGGGCGGGGGAGAGGG + Intergenic
1069246180 10:66209959-66209981 AAGAAATGTAGTGGCTAAGAAGG + Intronic
1069861779 10:71475970-71475992 AAGCAAGGGGGTGGCTGAGATGG + Intronic
1070102765 10:73403676-73403698 TAGAAATGGCATTGCTGAGAAGG + Intronic
1070191502 10:74115791-74115813 TAGAAATAAGGATGCTGAGAAGG + Intronic
1072006470 10:91254606-91254628 GAGGAATGAGATGGCTGAGAAGG - Intronic
1072307517 10:94121760-94121782 CAGAAATGGGATAGCAGAGATGG - Intronic
1073025828 10:100486738-100486760 GAGACATGTGGTGGCTGCGAGGG + Exonic
1077115891 11:884503-884525 AAGAGCTGGGGTTGCTGAGATGG + Intronic
1077873369 11:6281988-6282010 TAGAAATGAGGTGGGTGATTGGG + Intergenic
1078522894 11:12077578-12077600 TGGAAATGGGGAGGAAGAGAAGG - Intergenic
1078596443 11:12691036-12691058 GAGGAATGGGTTGGGTGAGATGG - Intronic
1078696460 11:13637101-13637123 TGGAAATTGGGGTGCTGAGAAGG + Intergenic
1079036594 11:17025651-17025673 TAGAAAAGGGCTGCCTGAGCCGG + Intergenic
1079312576 11:19379364-19379386 GAGCAAGGGGGTGGTTGAGAAGG + Intronic
1081231669 11:40592239-40592261 TGGAAATGGTGTTGCAGAGAAGG + Intronic
1081270550 11:41077535-41077557 TGGAGCTGGAGTGGCTGAGATGG + Intronic
1081779267 11:45698870-45698892 TAGAGATGGGGTGACTGGGCTGG - Intergenic
1081958331 11:47113355-47113377 TAGTAATGGGATGGCTGGGATGG + Intronic
1086055269 11:82639526-82639548 TACAAATGGGGTGGCAAAGTCGG - Intergenic
1087079618 11:94157242-94157264 TAGTAATGGGATGGCTGGGATGG + Intronic
1087641324 11:100757593-100757615 TAAAAATGGGGTGGCTCTAAGGG + Intronic
1088589920 11:111394660-111394682 TAGAAATGAGGAGGCTGTGGAGG - Intronic
1089173125 11:116529239-116529261 TGGAGATGGGGTGGGTGAGTGGG - Intergenic
1089270805 11:117300203-117300225 TAGTATTGGGGTGGGTGAGAGGG - Intronic
1089571787 11:119416152-119416174 CAGAAATGGGGGTGCAGAGAGGG + Intergenic
1090057432 11:123435316-123435338 TAGAAGTTAAGTGGCTGAGAGGG + Intronic
1091132403 11:133157576-133157598 AGGAGATGGGGTGGCAGAGAGGG - Intronic
1091387500 12:104040-104062 TAAGGATGGGGTGGTTGAGAAGG - Intronic
1091976477 12:4830080-4830102 TAGAAAAGATGTGGCTGAGAAGG - Intronic
1094339091 12:29390221-29390243 TAGAAATGGAGTTGTTAAGACGG + Intergenic
1095998298 12:48107844-48107866 TTGAGGTGGGGTGGATGAGAAGG - Intronic
1096467665 12:51856256-51856278 TGGGGATGGGGTGGCTGAGCAGG - Intergenic
1096975919 12:55699217-55699239 GAGAAAGGTGATGGCTGAGAAGG + Intronic
1097275110 12:57807755-57807777 CAGAGATGGGGGTGCTGAGAGGG + Intronic
1101243712 12:102864209-102864231 TAGAGAGGGCATGGCTGAGAAGG + Intronic
1101323836 12:103697368-103697390 AAGAAATGGGTTGGGTTAGAGGG - Intronic
1102071900 12:110027156-110027178 TAGAACTGGTGGGGCTGGGATGG - Intronic
1102384820 12:112499827-112499849 TAGCTATCGGGAGGCTGAGATGG + Intronic
1102600137 12:114023369-114023391 TAGAAATTTGGTGGCTGATATGG + Intergenic
1102646124 12:114405159-114405181 TAGAAATGGGGCCGAGGAGAAGG + Intronic
1102666683 12:114580162-114580184 TAAAAATTGGGAGGCTGAGGTGG + Intergenic
1102795701 12:115687322-115687344 GAGAAAGGGGGTGGGTGAGGGGG + Intergenic
1102915956 12:116752311-116752333 TAGAAAGGGTGGGGCTGATAGGG - Intronic
1104288221 12:127444841-127444863 TAGTCCTGGGGAGGCTGAGATGG - Intergenic
1105544233 13:21340117-21340139 TAGAAACGGGGACGCTGAGGAGG - Intergenic
1106292792 13:28380802-28380824 TATAAATGAGGTGGGTCAGAAGG + Intronic
1107151567 13:37117462-37117484 TTGAAATGGGGTGGGGGAGGGGG + Intergenic
1109770658 13:66967791-66967813 AAGATTTGGGGTGGCTTAGATGG + Intronic
1110782507 13:79481937-79481959 CATAAATGGGGTGGGTGAGTAGG + Intronic
1110871745 13:80460461-80460483 TGGAAAGTGGGTGGCTGAGCTGG - Intergenic
1111541020 13:89667353-89667375 TAGAACTATGGGGGCTGAGAGGG + Intergenic
1111774395 13:92640964-92640986 TAGTAATGGGGTGGCGGGGGAGG + Intronic
1112537537 13:100274919-100274941 TAGGACTGGGGTGGGTGAGTGGG + Intronic
1112550872 13:100419182-100419204 TAGAAATTGGCTGGGTGTGATGG + Intronic
1112864640 13:103878552-103878574 CATAAATGTGGTGGGTGAGAAGG + Intergenic
1113436015 13:110291573-110291595 TTGACATGGGGTGGGTGATAAGG - Intronic
1114267398 14:21081035-21081057 TGGAAATGGGGGGGCACAGAAGG - Intronic
1114898485 14:27025758-27025780 TAGTGATGGGGTGGCAGAGGGGG - Intergenic
1115398880 14:32937480-32937502 TATACATGGGCTGGCAGAGAAGG - Intronic
1115724776 14:36201250-36201272 TACAAATGTGGTGGCAGAAAGGG + Intergenic
1115916576 14:38321568-38321590 TAGAACTGGAGCGGCTGGGATGG + Intergenic
1116228769 14:42188305-42188327 TAGAAATGGGTTGGGAGTGATGG + Intergenic
1118922548 14:70162965-70162987 GAGAAGTGGTATGGCTGAGATGG - Intronic
1120837867 14:89057334-89057356 TTTAAATGGGGTGGTTGAGAAGG - Intergenic
1121148177 14:91604815-91604837 TAGCAATGGTGTGACTCAGAAGG - Intronic
1121634650 14:95445744-95445766 TACACATGAGGAGGCTGAGATGG + Intronic
1122857950 14:104568930-104568952 GAGAAATGGGGTGGATGAGCTGG - Intronic
1126788166 15:52196095-52196117 TAGAAATGGGCTGGGCGAGGTGG - Intronic
1132322442 15:100935884-100935906 TAGACATGCGGTGGATGAGAAGG - Intronic
1133088802 16:3387344-3387366 TAGAGATGGGCTGGCTGAGGAGG - Intronic
1133487530 16:6234555-6234577 GAGAAATGGGGTGGATGTGTGGG + Intronic
1133823489 16:9257500-9257522 TAAATATGGGGTGGAGGAGAGGG - Intergenic
1134075111 16:11285375-11285397 CAGAAGTGGGGTGGCTGGCAGGG - Intronic
1135565400 16:23507843-23507865 TAGAACTGGGGAGGCTGATGTGG + Intronic
1136130384 16:28216792-28216814 TAGAAATAGGCAGGCAGAGATGG - Intergenic
1136171775 16:28494386-28494408 TAGAACTGGGGAGGGGGAGAGGG - Intronic
1138788088 16:59869798-59869820 TAAAAATTGGGTGGCTGTGGTGG + Intergenic
1139034514 16:62927354-62927376 TAGAAATCTGAAGGCTGAGAAGG - Intergenic
1139727810 16:68915905-68915927 TAGAAATGGAAAGGCTGAGAAGG - Intronic
1140002156 16:71037012-71037034 TAGAAATAGGGTGGGAGGGAGGG + Intronic
1140881924 16:79206219-79206241 CAGACATGGCCTGGCTGAGAAGG + Intronic
1141231171 16:82169230-82169252 AAGAAATGGGGTTGCAGAGTAGG - Intronic
1141669551 16:85484747-85484769 CAGAGGTGGAGTGGCTGAGAGGG - Intergenic
1142303963 16:89275273-89275295 TAGGAGTGGGGAGGCTGAGTCGG - Intronic
1142750182 17:1982817-1982839 GAGGAATGGGGTGGCTGAGCAGG + Intronic
1144028119 17:11296459-11296481 TAGAAAGGGAGTAACTGAGATGG + Intronic
1146300820 17:31687762-31687784 TAGGAATGGGGTGGCACAGCAGG - Intergenic
1146843894 17:36171803-36171825 CAGAGATGGGGTGAATGAGAGGG - Intronic
1146856200 17:36259738-36259760 CAGAGATGGGGTGAATGAGAGGG - Intronic
1146864419 17:36328637-36328659 CAGAGATGGGGTGAATGAGAGGG + Intronic
1146872107 17:36383649-36383671 CAGAGATGGGGTGAATGAGAGGG - Intronic
1146879469 17:36434734-36434756 CAGAGATGGGGTGAATGAGAGGG - Intronic
1146883394 17:36455877-36455899 CAGAGATGGGGTGAATGAGAGGG - Intergenic
1147022006 17:37542396-37542418 AAGAATTGAGGTGGCTGAGGGGG + Exonic
1147067277 17:37929225-37929247 CAGAGATGGGGTGAATGAGAGGG + Intronic
1147074993 17:37984273-37984295 CAGAGATGGGGTGAATGAGAGGG - Intronic
1147078810 17:38008786-38008808 CAGAGATGGGGTGAATGAGAGGG + Intronic
1147086518 17:38063819-38063841 CAGAGATGGGGTGAATGAGAGGG - Intronic
1147094747 17:38132721-38132743 CAGAGATGGGGTGAATGAGAGGG + Intergenic
1147102461 17:38187782-38187804 CAGAGATGGGGTGAATGAGAGGG - Intergenic
1147793532 17:43027454-43027476 CAGGAAAGGGGTGGCTGGGAGGG - Intronic
1148439672 17:47705256-47705278 TAGCAATGGAGTTGCTGGGATGG - Intronic
1148742388 17:49900187-49900209 TAGAGATGGGATAACTGAGATGG + Intergenic
1148944064 17:51243086-51243108 TAGAAATGGGATTGCTGTGTAGG + Intronic
1149847036 17:60014258-60014280 CAGAGATGGGGTGAATGAGAGGG - Intergenic
1150085392 17:62270865-62270887 CAGAGATGGGGTGAATGAGAGGG - Intergenic
1150893072 17:69177196-69177218 TAGAAATGGGGAAGTTGAAAAGG - Intronic
1151009745 17:70481044-70481066 TAGAAATGGGCTTCCTCAGAAGG + Intergenic
1151386047 17:73756041-73756063 GGGACCTGGGGTGGCTGAGATGG + Intergenic
1155207691 18:23575336-23575358 TGGAAGAGGGGTGGGTGAGAAGG + Intronic
1156928027 18:42606568-42606590 TATGGATGGGGTGGCTCAGATGG + Intergenic
1157493687 18:48140650-48140672 TAGGCAGGGGGAGGCTGAGAGGG + Intronic
1157841506 18:50963531-50963553 GAGAAGTGGGGTGGCAGAAAAGG + Intergenic
1158474824 18:57770597-57770619 TAGAAATGGGATAGAGGAGAAGG + Intronic
1158490445 18:57905519-57905541 TAGAAATTGGGAGGCCGAGGTGG - Intergenic
1158684487 18:59600749-59600771 AAGAGAGGGAGTGGCTGAGAAGG - Intronic
1158876497 18:61739152-61739174 GAGAAATAGAGAGGCTGAGAAGG - Intergenic
1159591606 18:70341254-70341276 TAGCAATGGAGTGACAGAGAAGG + Intronic
1160279198 18:77471335-77471357 TACAAATGGGGTGGTGGAGAAGG - Intergenic
1161465136 19:4425499-4425521 TAAAATTAGGGAGGCTGAGATGG - Intronic
1161587038 19:5111192-5111214 CAGAAATGCGGTGAGTGAGAGGG - Intronic
1161883837 19:6977507-6977529 TAGAAATGGAGTGGCCAAAATGG + Intergenic
1162016593 19:7849671-7849693 GAGAAATCGGGAGGCTGACAGGG + Intronic
1163350304 19:16772720-16772742 TAGTATTTGGGAGGCTGAGATGG + Intronic
1163791346 19:19308141-19308163 AACTAATGGGGGGGCTGAGATGG - Intronic
1164243316 19:23409142-23409164 GGGAAGTGGGGTGTCTGAGACGG + Intergenic
1164619660 19:29687115-29687137 TAGATATGGAGAGGCTGAGTGGG + Intergenic
1165005987 19:32807151-32807173 GAGAAATAGGGTGGCTGAGCAGG + Intronic
1165100302 19:33435091-33435113 GCCAAATGAGGTGGCTGAGACGG + Intronic
1165948140 19:39457772-39457794 TGGGAAGAGGGTGGCTGAGAGGG + Intronic
1166010466 19:39937266-39937288 CAGAAATGGGGTGGTTGTGGTGG + Intergenic
1166712531 19:44946406-44946428 TAGAGTTAGGGTGGCTGAGGTGG + Intronic
1167059693 19:47136322-47136344 TAGAGATGGGGTTGCTGTGTTGG + Intronic
1167234638 19:48306577-48306599 TGGAAATGAGGTGGAGGAGATGG + Intronic
925416743 2:3675528-3675550 TGGAAATGGGGTGGGAGAGAGGG + Intronic
926891227 2:17640480-17640502 TATAACTGTGGTGGCAGAGATGG + Intronic
927079390 2:19612698-19612720 TAGAGATGGGGTGGCCGGGCTGG + Intergenic
927624743 2:24703146-24703168 TAGTAATGAGTTGACTGAGATGG + Intronic
932225019 2:70032763-70032785 CAGCAATGGTGTGGCTGAGGAGG + Intergenic
932703685 2:74007404-74007426 CAGAAATGGGCTAGCTGGGAAGG + Intronic
934563120 2:95323405-95323427 CAGAACTGCGGTGGCAGAGAGGG + Intronic
935103554 2:100019271-100019293 TTGAAATGGGGTTTCTGAAAAGG + Intronic
935824391 2:106930114-106930136 TAAAAACAGGGTGGGTGAGATGG + Intergenic
937342325 2:121099140-121099162 TATAAATGGTGTGTCTTAGACGG - Intergenic
937403805 2:121609620-121609642 GAGAAACTGGGTGGCTGGGAGGG - Intronic
937439635 2:121905178-121905200 TAGAAATGAAGTGTCTGTGAAGG + Intergenic
937694003 2:124787651-124787673 TAGAAATGGGGAGGATGTGAGGG - Intronic
937862052 2:126718958-126718980 TAGAGATGGGGTGACCGAGATGG + Intergenic
938223076 2:129588124-129588146 CAGAGATGGTGTGGCTGGGAGGG + Intergenic
941606296 2:167601242-167601264 TAGAGATGGGGTGGCCAGGATGG + Intergenic
941673360 2:168318564-168318586 TAGAAATGTGGTTGGAGAGAAGG - Intergenic
941704263 2:168641173-168641195 GTGAAATGGGGCGGCTGGGAAGG - Intronic
942279274 2:174343982-174344004 CCGAAATGGGGAGGCCGAGAAGG - Intergenic
943341356 2:186685727-186685749 CAGAAGTGGGGAGGGTGAGAGGG - Intergenic
945208867 2:207361337-207361359 TAGAATTTGGGAGGCTGAGGTGG - Intergenic
945649646 2:212541128-212541150 TAGCTATTGGGAGGCTGAGATGG + Intergenic
945997122 2:216447175-216447197 GAGAAATGGGTGGGCTGGGAGGG - Intronic
946028401 2:216686502-216686524 TAGCAATGGGGAGTCTGAGAAGG + Intronic
946219988 2:218217636-218217658 GAGAAATGGGGTGCCTGGCAGGG + Intronic
947129420 2:226905790-226905812 TAGGAATGGGAAGGCTGGGAGGG + Intronic
947182331 2:227422311-227422333 TAGATACCAGGTGGCTGAGAAGG + Intergenic
947420505 2:229938151-229938173 TAGAGATGGGGTTGTAGAGATGG + Intronic
947420647 2:229938955-229938977 TAGAGATGGGGTTGTGGAGATGG + Intronic
947709031 2:232299765-232299787 TAGACATGAGCTAGCTGAGAGGG - Intronic
947744063 2:232498551-232498573 TAGAAAAGGGGAGGATGACAAGG - Intergenic
948055050 2:235004919-235004941 TAGGCATGGGGTGGAGGAGAAGG - Intronic
948106448 2:235417955-235417977 TAGAAATGGGGTCTTTGGGAGGG + Intergenic
1170575872 20:17660977-17660999 TAGAAATGTGATTGCTGAGTTGG + Intronic
1170944896 20:20882206-20882228 TAGAGAAGGGGTGGTTCAGAAGG + Intergenic
1171773910 20:29348560-29348582 TCGAACTGTGGTGGCTGAGCTGG + Intergenic
1171815916 20:29786113-29786135 TCGAACTGTGGTGGCTGAGCTGG + Intergenic
1171902450 20:30869926-30869948 TCGAAATGTGGTGGCTGAGCTGG - Intergenic
1171948790 20:31402463-31402485 TAGAAATGATCTGGCAGAGAAGG + Intergenic
1173590286 20:44219754-44219776 TAGAAAAGGTGAGGCTGAGAGGG - Intergenic
1173596039 20:44258872-44258894 TAGAAACTGGGTGAATGAGATGG - Intronic
1174457466 20:50659838-50659860 TGGAGATAGGGTGTCTGAGAAGG - Intronic
1174947571 20:55005235-55005257 TAGATATGGGGATGATGAGAAGG - Intergenic
1175117200 20:56690963-56690985 GAGGAATGGGGTTGCTGAGAAGG + Intergenic
1175147810 20:56910108-56910130 TACAAATGAGGGGGCAGAGAGGG - Intergenic
1179178674 21:39027007-39027029 TAGCTGTGGGGTTGCTGAGAGGG + Intergenic
1180319369 22:11306677-11306699 TCGAACTGTGGTGGCTGAGCTGG + Intergenic
1180335835 22:11575896-11575918 TCGAAATGTGGTGGCTGAGCTGG - Intergenic
1180907704 22:19426447-19426469 TAGAATTGTGATGGCAGAGAAGG - Intronic
1182828561 22:33285936-33285958 TAGAGAGGGGGTGGTTGGGATGG + Intronic
1183564188 22:38601421-38601443 CAGAAATGAGGTGGCTCACAGGG + Intronic
1184723615 22:46330231-46330253 TAGAACTTGGGAGGCTGAGGTGG + Exonic
949297572 3:2543633-2543655 AAGAAATGAGGTAGCAGAGATGG - Intronic
949737885 3:7195366-7195388 TTGAATTGGGGTGCCTGATAAGG - Intronic
950029274 3:9841425-9841447 TAGTGCTCGGGTGGCTGAGATGG - Intronic
950628614 3:14266802-14266824 TAGAGATGGAGAGGCTGTGAGGG - Intergenic
950902305 3:16508946-16508968 TTGAAATGCGGTGAGTGAGACGG + Intronic
951953566 3:28228812-28228834 TTGACATGGTGTGGCTAAGAAGG + Intergenic
952876685 3:37951078-37951100 TAGAAATGGGCTGGGTGCAATGG + Intronic
952955075 3:38551789-38551811 AAGGAATGAGGGGGCTGAGAAGG - Intronic
953866692 3:46589644-46589666 TAGAGACGGGGTTGGTGAGATGG - Intronic
954118466 3:48480511-48480533 AAGAAATGGGGGGGCCGAGGAGG + Intronic
954998450 3:54903572-54903594 CAGAAATGGGATTGCTGAGTAGG + Intronic
955675473 3:61443625-61443647 TAGAATTGGGGAGGCTGAGTGGG - Intergenic
959011322 3:101079779-101079801 TAGAAATGTGCTGGCTTGGAGGG + Intergenic
961372752 3:126441348-126441370 TAGAAATGGGGTGGCTGAGACGG + Intronic
961506101 3:127371466-127371488 GAGAAATGGGGGGACTGAGGGGG - Intergenic
964946648 3:162233341-162233363 TAGACATTAGGTGGCTGGGAAGG - Intergenic
965890599 3:173508918-173508940 TACAAATGGGCTGGTTGAGCTGG - Intronic
966345818 3:178978523-178978545 TAGAGAAGGGGTGGTTCAGAAGG + Intergenic
966846360 3:184133947-184133969 TAGAAATGGGGGAGGGGAGAAGG - Intergenic
969701157 4:8768593-8768615 TGGAGTTGGGGTGGCTGCGAGGG - Intergenic
970824658 4:20255269-20255291 GAGAAATGGGTTGGATAAGAAGG - Intronic
970970046 4:21971863-21971885 TAGAAATGAGTAGCCTGAGAAGG + Intergenic
971412591 4:26390765-26390787 TTGAAATGGGCTGGGTGTGATGG + Intronic
972093693 4:35321632-35321654 CAGTAATGGGATGGCTGGGAAGG + Intergenic
975308339 4:72874659-72874681 TAAAAATAGGGTGGAAGAGAGGG + Intergenic
975848990 4:78552210-78552232 TAGGACTGGGGAGGCCGAGATGG - Intronic
977183413 4:93905658-93905680 TAGGAATGGAGTCACTGAGAAGG - Intergenic
977453150 4:97224320-97224342 TAGAAATGGGATGGCAGAGAGGG + Intronic
977579696 4:98711613-98711635 TAGAAAAGGGGTGGCAAATAAGG - Intergenic
977935049 4:102792292-102792314 TAGAACTGGGGTGGCGCTGAGGG + Intergenic
978066396 4:104408455-104408477 TAGAAAATGGATGGCAGAGAGGG - Intergenic
978617984 4:110614648-110614670 TAGAAAGGGGGTGGGGGTGAGGG + Intergenic
978752887 4:112272153-112272175 GAGAAATGGGGTAGCTGGAAGGG + Intergenic
978826574 4:113031556-113031578 TAGAAATGGGGTGGGAGGGAGGG - Intronic
981448765 4:144871538-144871560 TTAAAATGGGCTGGCTGAGGTGG + Intergenic
981662139 4:147180278-147180300 TATATATAGGGAGGCTGAGATGG + Intergenic
981751430 4:148095774-148095796 CAGGAATGGGCTGGCTGGGATGG + Intronic
982723802 4:158884554-158884576 TTGAGATGGGGTGGCAGGGAAGG + Intronic
984004355 4:174291089-174291111 TAGACATGGAATGGCTGAAATGG - Intronic
984866815 4:184288045-184288067 CAGGAATGGGGTGGCTGGGCAGG - Intergenic
985220879 4:187703393-187703415 TAAAAATGAGGAGTCTGAGATGG - Intergenic
985750915 5:1674014-1674036 TAGAATTTGGGAGGCTGAAATGG - Intergenic
986216040 5:5720057-5720079 TAAAAATGGGGTCACTGAGGTGG - Intergenic
986283503 5:6343201-6343223 TGGAAATGGGGTGGTGGGGAGGG - Intergenic
986639551 5:9858454-9858476 TAGCACTGGGGAGGGTGAGAAGG - Intergenic
987033041 5:13993345-13993367 GATAAATGGAGTGGCTGGGAGGG + Intergenic
987150059 5:15029276-15029298 TAGAAATGGGGTGGCTAGTGTGG + Intergenic
988037752 5:25850414-25850436 TAGAAATGGGGTTTCTGTGTTGG + Intergenic
988226879 5:28424474-28424496 TAGAAATATGGTTGCTGAAATGG - Intergenic
988732970 5:33991851-33991873 TAAAAATAGGGAGGCTGAGGTGG - Intronic
989105762 5:37861770-37861792 GAGGAATGTGGTGGCTCAGAGGG + Intergenic
989693083 5:44169348-44169370 TTTAAAGGAGGTGGCTGAGATGG + Intergenic
990476977 5:56171051-56171073 TAGAAATGGGGAGGGGGAGATGG - Intronic
991307727 5:65198191-65198213 TAGAGATGGGGTGGGTGAGTGGG - Intronic
993188765 5:84653998-84654020 TAGAATTGGGGTGGTGGTGAAGG + Intergenic
994719379 5:103363579-103363601 TGGAAATGGGGTGGGTGGGGAGG + Intergenic
995111731 5:108436700-108436722 TAGAACTTGGGAGGCTGAGGTGG + Intergenic
997165710 5:131658714-131658736 GAGAAATGGGGTGGCTTTCAGGG + Intronic
999311437 5:150554465-150554487 TAGAGATGAGGTGGCAGGGAGGG + Exonic
999810927 5:155126588-155126610 TACAAATGGGAAGGCTGAAAGGG - Intergenic
1000216109 5:159158190-159158212 GAGAAACGGGGTGGAGGAGAGGG + Intronic
1000289690 5:159858867-159858889 TAGTTATAGGGAGGCTGAGATGG + Intergenic
1001018440 5:168162581-168162603 GAGAAATGGAGAGGATGAGAAGG - Intronic
1002841968 6:914000-914022 AATAAATGGGAGGGCTGAGATGG + Intergenic
1003407846 6:5838265-5838287 TAGAAACGGGGACGCTGAGGAGG + Intergenic
1004240678 6:13918293-13918315 TAGAAATGAGGTGTCTCTGATGG + Intergenic
1004765199 6:18718750-18718772 TAGAATTGGAGTGGGGGAGAAGG - Intergenic
1005674579 6:28140914-28140936 TAGAAACGGGGTGGCGGGGCGGG - Intergenic
1005959363 6:30684878-30684900 TGGAGAAGGGGAGGCTGAGAAGG - Exonic
1006633702 6:35447275-35447297 AAAACATGGGGTGGCTGAGAAGG + Intergenic
1007800401 6:44387635-44387657 GAGATATTGGGTGGCTGAAAGGG - Exonic
1007844726 6:44743711-44743733 TAAAAATGGGGTGGGGGAGTAGG + Intergenic
1008636763 6:53418581-53418603 TAGCAATGGTGTGACTCAGAAGG - Intergenic
1009296893 6:61962136-61962158 TAGAAATTGGGCAGCTGAGTGGG + Intronic
1009685236 6:66948909-66948931 AAGAAATGGGGGAGGTGAGAAGG - Intergenic
1011520424 6:88198276-88198298 TAGAAGAGGGTTGGCTGAGCAGG + Intergenic
1012029558 6:94041057-94041079 CAGAAGTGGGGAGGCTGAGAGGG - Intergenic
1012391234 6:98742494-98742516 TAGAAATGAGGTGGGGGAAATGG + Intergenic
1013210761 6:107984631-107984653 CAGAACTCGGGCGGCTGAGATGG + Intergenic
1014233276 6:118928161-118928183 CAGAACTGGGGAGGCTGAGGTGG + Intronic
1014651777 6:124048357-124048379 TAATATTAGGGTGGCTGAGATGG + Intronic
1015107173 6:129550684-129550706 GAGAAATGGGCTGGTGGAGAGGG - Intergenic
1016866547 6:148773210-148773232 AACAATTTGGGTGGCTGAGATGG + Intronic
1017034290 6:150253062-150253084 CAAAAATAGGGTGGCTGAGTAGG - Intergenic
1017563876 6:155663361-155663383 TAGAACTGGAGTGGCAGATATGG + Intergenic
1017785687 6:157755325-157755347 TAGGAAAGAGATGGCTGAGAGGG - Intronic
1018500030 6:164397490-164397512 GAGAAATTGGGAGGCTGAGATGG + Intergenic
1020578543 7:9965224-9965246 TAGAAATGTAATGACTGAGAAGG - Intergenic
1020950272 7:14667190-14667212 GAGGAATGGGAAGGCTGAGAAGG + Intronic
1021275857 7:18649884-18649906 TAGAGATGGGGTGGCTGGCAGGG + Intronic
1021295869 7:18905185-18905207 AAGAAATGGGGAGGCTGGGCCGG - Intronic
1022354167 7:29596290-29596312 CAGAAGTGGGGAGGATGAGAGGG + Intergenic
1024706476 7:51966656-51966678 TAGAAATGGGCTTGGTGAGCAGG + Intergenic
1026145334 7:67741502-67741524 TAGAAATAGTCTGGCTGAGATGG - Intergenic
1026924052 7:74177031-74177053 AAGAATTGAGGTGGCTGAAATGG + Intronic
1027539864 7:79453487-79453509 GAGGAATGGGGAGGATGAGAGGG + Exonic
1027645251 7:80789803-80789825 TAGAAAAGTGGTGAGTGAGAAGG - Intronic
1027950081 7:84804191-84804213 TAGATATGAGGGGGCTGACAAGG + Intergenic
1028226974 7:88264365-88264387 TAAAAATGGGCTGGATGTGAAGG - Intergenic
1029072267 7:97909554-97909576 TAGCACTTGGGAGGCTGAGATGG - Intergenic
1029476824 7:100790009-100790031 TGGAACTGGAGAGGCTGAGACGG + Intronic
1029926645 7:104326353-104326375 GAGATGTGAGGTGGCTGAGAAGG - Intergenic
1031448911 7:121889995-121890017 TAGAAGTTGGGGGGATGAGAAGG - Intronic
1032807457 7:135371141-135371163 TACAAATGAGGAGGCTGAGTAGG + Intronic
1033506722 7:142010369-142010391 CAGAAATCTGGTAGCTGAGAAGG - Intronic
1035587451 8:786687-786709 GAGGGGTGGGGTGGCTGAGAAGG + Intergenic
1035707030 8:1683621-1683643 TAGGAATGGGGAGGAAGAGAGGG + Intronic
1038014947 8:23506776-23506798 CAGAAATGGCAAGGCTGAGAAGG - Intergenic
1039672846 8:39623023-39623045 CAGAAATGGGGAAGGTGAGAGGG - Intronic
1040887691 8:52283287-52283309 TTGAAATGGAGATGCTGAGAAGG + Intronic
1042648437 8:71013034-71013056 TGGAGATGGGGTGTGTGAGATGG + Intergenic
1043424919 8:80139014-80139036 GACTCATGGGGTGGCTGAGACGG - Intronic
1043540784 8:81259965-81259987 TGGAAATGAGGTGGCTGAAAAGG + Intergenic
1043750692 8:83929868-83929890 TGGGAATGGGGTGGCTGTCAGGG - Intergenic
1044182223 8:89210238-89210260 TAGAAATAGGGTGGCTACCAGGG - Intergenic
1044499030 8:92929300-92929322 TAGGTATGGGGTGGCTGACGAGG + Intronic
1044655720 8:94546269-94546291 TTGAAATGGAGAGGCTGAGTGGG - Intronic
1044782072 8:95753327-95753349 TACAAATGGAGAGACTGAGATGG - Intergenic
1044855368 8:96469898-96469920 TAGAAAGGTGGTGGATAAGATGG - Intergenic
1045061529 8:98415499-98415521 TAGAGATGGAGTGGTTGGGAAGG - Intronic
1045096669 8:98805186-98805208 CAGAAATGAGATGACTGAGAAGG - Intronic
1045505686 8:102776861-102776883 CAGAAAGGGGGGGGCGGAGAGGG - Intergenic
1047970667 8:130081530-130081552 TGGGAATGGGCTGGCTGAGGAGG + Intronic
1048503042 8:134996055-134996077 AAGAAATGGAGTGGCTGGCATGG + Intergenic
1048576229 8:135692126-135692148 TAGAACTGGAGTGGCTGCCATGG + Intergenic
1049999487 9:1061329-1061351 TAGAAAGGCGGTTGCTGGGAGGG - Intergenic
1052498399 9:29257945-29257967 TATAAATGGGGTGACTGTGGTGG - Intergenic
1052974046 9:34398946-34398968 TAGGAATGGGTTGGCGGAGTGGG + Exonic
1055369023 9:75576997-75577019 GAGAGATGGGGTGGGGGAGAAGG - Intergenic
1056002476 9:82231383-82231405 CAGAAATGGGCTGGCTGGGTGGG - Intergenic
1056123360 9:83511344-83511366 GAGAAGGGGGGAGGCTGAGAAGG + Intronic
1056408232 9:86297662-86297684 TACAAATCGGGAGGCTGAGATGG + Intronic
1056519636 9:87388369-87388391 TAGAAATGGGCTGGGTGCGATGG - Intergenic
1056950401 9:91036686-91036708 TGGAAATGGTGTGAGTGAGATGG - Intergenic
1057877623 9:98770012-98770034 TAGAAGCAGGGTGGCTGATATGG + Intronic
1057986494 9:99720733-99720755 TAGAAATGCAGGGGCTGACAGGG - Intergenic
1058975247 9:110120354-110120376 TAGAAATGGGGTGCATGTCAGGG + Intronic
1059293025 9:113244599-113244621 TAGCAATGTTGGGGCTGAGAAGG - Intronic
1059575475 9:115483776-115483798 TAGAAAGGAGGTAACTGAGAAGG - Intergenic
1059799331 9:117734176-117734198 GCGAAATGGGGTGATTGAGAAGG - Intergenic
1060414869 9:123423160-123423182 TCAAAATGGGGCGGCAGAGACGG + Intronic
1061817967 9:133207624-133207646 TAGAGATGGGGAGGCTGAGGGGG - Intronic
1061942867 9:133892382-133892404 TGGAAATGTGGGGGCTGAGGAGG + Intronic
1062277514 9:135737783-135737805 TAGAAATGGGGGTGCCGGGAGGG - Intronic
1062290698 9:135793187-135793209 TTAAAGTGGGGTGGCTGGGAGGG - Intergenic
1203367605 Un_KI270442v1:272427-272449 TCGAACTGTGGTGGCTGAGCTGG + Intergenic
1185589668 X:1266305-1266327 CAGGAATGGGGAGGCTAAGACGG + Intergenic
1185701895 X:2236895-2236917 AAGAAATGGGGGGGCTGGGTAGG + Intronic
1185932134 X:4215128-4215150 AAGAACTTGGGAGGCTGAGATGG - Intergenic
1186842211 X:13495380-13495402 CAGCAATAGGGTGGCTCAGAAGG + Intergenic
1187017190 X:15341414-15341436 TAGAAATGGGAGGGATGAGAGGG - Intergenic
1187704063 X:21991984-21992006 TGAAAATGGGGTGACTGGGAAGG + Intronic
1190802550 X:53804920-53804942 CAAAAAGGGGGAGGCTGAGAGGG + Intergenic
1191585991 X:62827327-62827349 TAGAGATGGGTTGGCTCAGAGGG - Intergenic
1192566300 X:72166565-72166587 TAAAAATTGGGAGGCTGAGGTGG - Intergenic
1197322023 X:125044298-125044320 TAGAAATGGGCTGGGTGTGGTGG + Intergenic
1197500362 X:127233480-127233502 TAAAAATGGGGAAGATGAGAGGG + Intergenic
1197893273 X:131286400-131286422 TAGGAAGGAGGTGCCTGAGAGGG + Intronic
1198310820 X:135424908-135424930 TAGGGTTGGGGTGGATGAGAGGG - Intergenic
1199157497 X:144567895-144567917 TGGAAATGAGCTGGCAGAGAGGG + Intergenic
1199267115 X:145841169-145841191 TAGAATTGTGTTGGCTGAAAAGG + Intergenic
1199879755 X:151964595-151964617 TGGAAATGTGGGGACTGAGAGGG - Intronic
1200080211 X:153572491-153572513 TAGCAAGGGGGTGGCTAGGAGGG + Intronic
1200153227 X:153961706-153961728 TAGAACTGGGGTAGCAGAGGTGG - Intronic
1201637288 Y:16137990-16138012 CAGCTATGGGGAGGCTGAGATGG + Intergenic
1201754581 Y:17472314-17472336 CACAAATGGGCTGGGTGAGAAGG - Intergenic
1201846971 Y:18433671-18433693 CACAAATGGGCTGGGTGAGAAGG + Intergenic
1202604298 Y:26625901-26625923 TAGAAATGGTGTGACTGTGGGGG + Intergenic