ID: 961373592

View in Genome Browser
Species Human (GRCh38)
Location 3:126448031-126448053
Sequence CTGGATGAGAAAGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 1, 2: 4, 3: 73, 4: 540}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961373592_961373602 23 Left 961373592 3:126448031-126448053 CCTGCCTCAGCTTTCTCATCCAG 0: 1
1: 1
2: 4
3: 73
4: 540
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047
961373592_961373600 11 Left 961373592 3:126448031-126448053 CCTGCCTCAGCTTTCTCATCCAG 0: 1
1: 1
2: 4
3: 73
4: 540
Right 961373600 3:126448065-126448087 CACGAGGACCTACACCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 180
961373592_961373598 -5 Left 961373592 3:126448031-126448053 CCTGCCTCAGCTTTCTCATCCAG 0: 1
1: 1
2: 4
3: 73
4: 540
Right 961373598 3:126448049-126448071 TCCAGAAAGGTGGGGACACGAGG 0: 1
1: 0
2: 3
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961373592 Original CRISPR CTGGATGAGAAAGCTGAGGC AGG (reversed) Intronic