ID: 961373593

View in Genome Browser
Species Human (GRCh38)
Location 3:126448035-126448057
Sequence CTTTCTGGATGAGAAAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1895
Summary {0: 1, 1: 3, 2: 31, 3: 254, 4: 1606}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961373593_961373600 7 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373600 3:126448065-126448087 CACGAGGACCTACACCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 180
961373593_961373604 27 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373604 3:126448085-126448107 AGGATTGTTGCGAGGACTAATGG 0: 1
1: 1
2: 4
3: 65
4: 291
961373593_961373605 28 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373605 3:126448086-126448108 GGATTGTTGCGAGGACTAATGGG 0: 1
1: 0
2: 0
3: 21
4: 138
961373593_961373598 -9 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373598 3:126448049-126448071 TCCAGAAAGGTGGGGACACGAGG 0: 1
1: 0
2: 3
3: 21
4: 193
961373593_961373606 29 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373606 3:126448087-126448109 GATTGTTGCGAGGACTAATGGGG 0: 1
1: 0
2: 1
3: 8
4: 74
961373593_961373602 19 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961373593 Original CRISPR CTTTCTGGATGAGAAAGCTG AGG (reversed) Intronic