ID: 961373599

View in Genome Browser
Species Human (GRCh38)
Location 3:126448050-126448072
Sequence TCCTCGTGTCCCCACCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961373599_961373602 4 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047
961373599_961373600 -8 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373600 3:126448065-126448087 CACGAGGACCTACACCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 180
961373599_961373604 12 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373604 3:126448085-126448107 AGGATTGTTGCGAGGACTAATGG 0: 1
1: 1
2: 4
3: 65
4: 291
961373599_961373605 13 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373605 3:126448086-126448108 GGATTGTTGCGAGGACTAATGGG 0: 1
1: 0
2: 0
3: 21
4: 138
961373599_961373606 14 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373606 3:126448087-126448109 GATTGTTGCGAGGACTAATGGGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961373599 Original CRISPR TCCTCGTGTCCCCACCTTTC TGG (reversed) Intronic