ID: 961373602

View in Genome Browser
Species Human (GRCh38)
Location 3:126448077-126448099
Sequence CACCTCACAGGATTGTTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1321
Summary {0: 1, 1: 0, 2: 32, 3: 241, 4: 1047}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961373599_961373602 4 Left 961373599 3:126448050-126448072 CCAGAAAGGTGGGGACACGAGGA 0: 1
1: 0
2: 1
3: 12
4: 178
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047
961373593_961373602 19 Left 961373593 3:126448035-126448057 CCTCAGCTTTCTCATCCAGAAAG 0: 1
1: 3
2: 31
3: 254
4: 1606
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047
961373592_961373602 23 Left 961373592 3:126448031-126448053 CCTGCCTCAGCTTTCTCATCCAG 0: 1
1: 1
2: 4
3: 73
4: 540
Right 961373602 3:126448077-126448099 CACCTCACAGGATTGTTGCGAGG 0: 1
1: 0
2: 32
3: 241
4: 1047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961373602 Original CRISPR CACCTCACAGGATTGTTGCG AGG Intronic