ID: 961374469

View in Genome Browser
Species Human (GRCh38)
Location 3:126454617-126454639
Sequence TGTCACAGTGAAGTGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961374469_961374471 -9 Left 961374469 3:126454617-126454639 CCTCATTACACTTCACTGTGACA 0: 1
1: 0
2: 0
3: 17
4: 143
Right 961374471 3:126454631-126454653 ACTGTGACACAGGATACCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961374469 Original CRISPR TGTCACAGTGAAGTGTAATG AGG (reversed) Intronic
905113370 1:35614926-35614948 TTTCACAGTGAAGTGCATTTAGG + Intronic
906914423 1:49993539-49993561 TGTCACAGGGATGTCTATTGTGG - Intronic
909326493 1:74357492-74357514 TGGCACATTGAAGTGTGATTTGG + Intronic
909638333 1:77843320-77843342 TATCACCATGAAGGGTAATGTGG + Exonic
910234172 1:85017972-85017994 TCTCACAGCGAAGTGTTTTGGGG - Intronic
911658067 1:100467013-100467035 TGTGACAGTGAAATTTCATGGGG + Intronic
922740313 1:228010693-228010715 TGTCCCAGCGAAGTGCAGTGTGG + Intronic
1066975188 10:42361788-42361810 TGCCTCAGTAATGTGTAATGAGG - Intergenic
1072736556 10:97883141-97883163 TGTCAGGGCAAAGTGTAATGAGG + Intronic
1073631089 10:105149822-105149844 TGACACAGTGATATGGAATGAGG + Intronic
1074437951 10:113450492-113450514 TGTCAAACTGAAAAGTAATGGGG - Intergenic
1076002819 10:126925842-126925864 TGTCACAGTAGGGTGTGATGTGG + Intronic
1076530897 10:131143494-131143516 TGTCCCAGTGAAGTGACAGGTGG + Intronic
1078184126 11:9037242-9037264 TGTGATAGTGAAGTGTTCTGGGG - Intronic
1079185048 11:18229147-18229169 TGCAAGAGTGAAGAGTAATGTGG + Intronic
1079263859 11:18911141-18911163 TGTAACAGGGATGTATAATGTGG + Intergenic
1081755841 11:45543874-45543896 TGCCACAGGGAACTGTTATGTGG + Intergenic
1081835304 11:46148863-46148885 TGTCTCAGTGATGGGTGATGGGG + Intergenic
1086577710 11:88359652-88359674 TAGCACATAGAAGTGTAATGTGG + Intergenic
1087279073 11:96190330-96190352 TGTCCCAGGGAAGGTTAATGAGG + Intronic
1093649992 12:21632099-21632121 TGACACAGTGAAGTGTTTTTAGG - Intergenic
1094299955 12:28952263-28952285 GGTGACAATGAAGTGTGATGGGG - Intergenic
1097728004 12:63096475-63096497 TGTCAGAGTCAAGTGGCATGTGG + Intergenic
1098226855 12:68332829-68332851 TGTGACAATAAACTGTAATGCGG - Intergenic
1100144873 12:91665417-91665439 TGTCACAGGGAATTGCAGTGAGG + Intergenic
1101617166 12:106349634-106349656 AGTTACAATAAAGTGTAATGAGG + Intergenic
1101757387 12:107631585-107631607 TATGACAATGAAGTGTAATGTGG - Intronic
1101926310 12:108974468-108974490 TGTCACAGAGAATTATAATAGGG + Intronic
1102162689 12:110782366-110782388 TGAGACAGTCAAGTGTAAGGGGG - Intergenic
1104762259 12:131304554-131304576 TCTCACAGTGAAGGAAAATGGGG - Intergenic
1104817517 12:131656242-131656264 TCTCACAGTGAAGGAAAATGGGG + Intergenic
1106289719 13:28349394-28349416 AGTGACAGTGAGGTTTAATGCGG + Intronic
1106686328 13:32064052-32064074 TGTTGCAGTTAAGTGTAGTGGGG + Intronic
1106753963 13:32802621-32802643 TGTCACAGGGAAGAGGCATGAGG - Intergenic
1112402878 13:99090818-99090840 TGTCACAGGGAAGTGTGAAAGGG + Intergenic
1112630404 13:101155328-101155350 TGTGACAATGAAATGCAATGTGG - Intronic
1114704983 14:24715509-24715531 GGTCACAGAGATGTGTAATAAGG - Intergenic
1114799372 14:25755630-25755652 TGTCCAAGTGAGGAGTAATGAGG + Intergenic
1115206783 14:30916095-30916117 TGCCACAGTGATGGGTAATATGG - Intronic
1117872760 14:60218212-60218234 TGTCCCAGTGAACTGTCATCTGG + Intergenic
1119524716 14:75313466-75313488 TGTCACAATGACATGCAATGGGG + Intergenic
1121060144 14:90899530-90899552 TGTTACAGTATACTGTAATGAGG + Intronic
1121486206 14:94317357-94317379 TGAGACAGTCAAGTGTAAAGAGG + Intronic
1121803198 14:96792774-96792796 TGACACAGGAAAGGGTAATGAGG - Intergenic
1128971215 15:72108493-72108515 TGTCACAGGGAAGAGAAATGTGG + Intronic
1138802021 16:60044710-60044732 GGTTACAGTGAACTGAAATGTGG + Intergenic
1139005035 16:62559437-62559459 TGTCACAGTGAAAAGTAACAAGG - Intergenic
1139410229 16:66752617-66752639 TATCACAAGGAAGTGGAATGTGG + Intergenic
1139460059 16:67114769-67114791 TGTATTAGTGAAGTGTATTGTGG + Intronic
1142284383 16:89165756-89165778 TGTCACAGTGTTGGGTTATGGGG + Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147038110 17:37696889-37696911 AGGCACAGTGAAGTAAAATGAGG - Intronic
1148975327 17:51522671-51522693 TGTGACAGTTAAATGTAGTGTGG - Intergenic
1149009622 17:51841828-51841850 GGTCACAGTGAAGTGGAGTCAGG - Intronic
1155290601 18:24337648-24337670 TGTCACAATTAAATGCAATGTGG + Intronic
1155752648 18:29446572-29446594 TGTCACAGTGAAGAATTAGGGGG - Intergenic
1159710880 18:71758108-71758130 AGATACTGTGAAGTGTAATGGGG + Intronic
1162952104 19:14077527-14077549 AGTCACAGTGAAGTATGCTGAGG - Intergenic
1164427822 19:28158132-28158154 TGACACAGTGAATGGGAATGTGG - Intergenic
1165120994 19:33558515-33558537 TGTCACACTGATGTTTAGTGAGG - Intergenic
1168536726 19:57176966-57176988 TGTCACCTTGAAGTGGTATGAGG + Intergenic
925589119 2:5492881-5492903 TGCCACAGGGACGTGTGATGGGG - Intergenic
926993114 2:18701702-18701724 GGTGGCAGGGAAGTGTAATGAGG - Intergenic
934136433 2:89000487-89000509 GGTCAGAGTGAAGTCTCATGGGG + Intergenic
935872378 2:107465065-107465087 TGTCACAGTCAAGCTTAGTGTGG + Intergenic
936747587 2:115597165-115597187 CCTCACAGTGAAGTATACTGTGG - Intronic
941349782 2:164417814-164417836 TCTCACAGGGCAATGTAATGAGG + Intergenic
943162658 2:184275111-184275133 TGTGACAGAGAAGTGTCCTGTGG - Intergenic
943405631 2:187480024-187480046 TGTCACAGAGGAGTATCATGGGG - Intronic
944776443 2:202971042-202971064 TGTAACAGAGAAGTGTAATTTGG + Intronic
945435727 2:209815259-209815281 TCTCACCATGAAGTGTAACGAGG + Exonic
1168920756 20:1533700-1533722 GGTCACAGTGCAGTGTAGAGTGG + Intergenic
1170233563 20:14076781-14076803 TGTCAGCGTTAAGTATAATGTGG + Intronic
1171452453 20:25245745-25245767 TGTCACAGGGAAGTGTATGATGG + Intergenic
1175320224 20:58080332-58080354 GGTTACAGTGAACTGCAATGTGG - Intergenic
1175378488 20:58546154-58546176 TGGCACAGAGTGGTGTAATGTGG + Intergenic
1175725261 20:61313630-61313652 GGTCACAGTGCAGTGTTTTGGGG + Intronic
1175957455 20:62618647-62618669 TTTCACAGTGAACTGTCATGGGG - Intergenic
1176636534 21:9248909-9248931 TGGCACGGTGAAATGAAATGTGG + Intergenic
1177011276 21:15732825-15732847 TGTCACAATGTAGTATGATGAGG + Intronic
1177968376 21:27758264-27758286 TGTCACACTAAGGTATAATGGGG + Intergenic
1178997397 21:37416043-37416065 TGGCATAGTGAACTTTAATGTGG + Intronic
950961406 3:17111808-17111830 ATTCAAAGAGAAGTGTAATGGGG + Intergenic
953555996 3:43947517-43947539 TTCCACAGTGAAGAGTAATGTGG - Intergenic
955749529 3:62173656-62173678 TGTTAAAGTGAAGTGTAAGTGGG - Intronic
956821673 3:72959573-72959595 TGTCACAGTGAAATGGATTAAGG - Intronic
957415804 3:79902293-79902315 TGTCACTGGAGAGTGTAATGTGG + Intergenic
961374469 3:126454617-126454639 TGTCACAGTGAAGTGTAATGAGG - Intronic
967531041 3:190549291-190549313 TGAGACAGTCAAGTGTAAAGGGG - Intronic
967892114 3:194370906-194370928 TGCCACAGTGAGGAGGAATGTGG - Intergenic
969561385 4:7950446-7950468 CCTCACAGTGATGTGGAATGGGG - Intergenic
970263519 4:14255170-14255192 TTTCACATTGAAATGCAATGAGG - Intergenic
971740515 4:30514567-30514589 TACCACAGTGCAGTGGAATGTGG + Intergenic
973014603 4:45122371-45122393 CATCACAATGAAATGTAATGTGG - Intergenic
976017132 4:80570637-80570659 TCTCATAGTGAAGTGTAAATTGG + Intronic
978006665 4:103625799-103625821 TGTCACAGTGTAAGGTACTGGGG - Intronic
978172056 4:105684056-105684078 TGTCACTGTGCAGCCTAATGAGG - Intronic
978957034 4:114626685-114626707 TGGCAAAGTCAGGTGTAATGTGG + Intronic
981395432 4:144242543-144242565 TTTCACCATGAAGTGTAATGTGG + Intergenic
983539044 4:168889064-168889086 TGTATCAGTGAAGTGACATGAGG + Intronic
984667607 4:182445962-182445984 TTCCACAGAGACGTGTAATGAGG - Intronic
1202751423 4_GL000008v2_random:7338-7360 TGGCACGGTGAAATGAAATGTGG + Intergenic
986027555 5:3865099-3865121 TGTCAAAGTGAAGTTTAATATGG - Intergenic
991970745 5:72139301-72139323 TATCACAGTGCAGTGTACTGGGG + Intronic
993767745 5:91882054-91882076 TCTCACAGTGAAGGGTAAAAAGG + Intergenic
994619199 5:102142830-102142852 TGTCAGAGTGAAGGGTCATTAGG - Intergenic
996748825 5:126868970-126868992 TGTCCCAGTGAAGCGTGGTGGGG + Exonic
996874239 5:128223879-128223901 TGTGAAAGAGAAGTATAATGGGG - Intergenic
997158929 5:131586884-131586906 TGAGACAGTCAAGTGTAAAGGGG + Intronic
1000332822 5:160219408-160219430 TATCACAGTGAAGTTTTATGAGG - Intronic
1000747304 5:165049742-165049764 TATGACAGTTAAATGTAATGTGG - Intergenic
1000811505 5:165868556-165868578 CATCACAGAGAACTGTAATGAGG - Intergenic
1004959237 6:20767510-20767532 TGTCACAGTCAAGTGAAAACTGG + Intronic
1005132195 6:22522199-22522221 TGTGACACTCAAGTGTCATGTGG - Intergenic
1005583912 6:27258080-27258102 GGTCACAGTGAAGAGTAATCAGG - Intergenic
1006098889 6:31673419-31673441 GGACTCAGTGAAGTGAAATGGGG - Exonic
1006290071 6:33128082-33128104 TGTCACCGTGGAGTGGAGTGAGG + Intergenic
1007428664 6:41763639-41763661 TGTCACAGTAATGAGTGATGTGG - Intergenic
1008528009 6:52426998-52427020 TGTCACAGTGAGGTGAATGGTGG - Intronic
1008660104 6:53658984-53659006 TTTGTCAGTGAAGTCTAATGAGG + Intronic
1011814486 6:91172402-91172424 TGTTACAGTGATGGGTAATTTGG + Intergenic
1015743938 6:136489495-136489517 TGTTACAGAGCATTGTAATGAGG - Intronic
1018814995 6:167323924-167323946 TGTAAAAATGAAGTGAAATGAGG - Intergenic
1020048887 7:5067806-5067828 GGTGACATTGAAGTGTAGTGGGG + Exonic
1023003373 7:35836240-35836262 TATCACAGTTAAGTCTAATTAGG - Intronic
1026418564 7:70209128-70209150 TGTAGCAGTGAAATGTAAAGTGG + Intronic
1028045594 7:86114370-86114392 AGTAACAATGAAGTGCAATGTGG + Intergenic
1028046613 7:86128446-86128468 AGTGACAATGAAATGTAATGTGG - Intergenic
1028206407 7:88022194-88022216 AGTAATAGTTAAGTGTAATGAGG - Intronic
1031326471 7:120405302-120405324 TGTCACTGTGATATCTAATGTGG + Intronic
1033814116 7:145051598-145051620 TGTCACAGTGAAATGCAACATGG - Intergenic
1035456478 7:159012786-159012808 CCACACAGTGAAGTTTAATGAGG + Intergenic
1035969847 8:4235723-4235745 TCTCACATGCAAGTGTAATGAGG + Intronic
1037350131 8:17944300-17944322 TGTCACAGTTAAGGGAAATCAGG - Intronic
1039105065 8:33981289-33981311 CGTCACTGTGAAGTGTGATGGGG + Intergenic
1043500983 8:80855607-80855629 AGTAACAGGGAAGGGTAATGGGG + Intronic
1045417837 8:101984863-101984885 AGTCACAGTGATGTGAACTGAGG - Intronic
1046901674 8:119530215-119530237 TGTCACAGTGAGGCATAATTGGG + Intergenic
1047207222 8:122812305-122812327 TTTCAGAGTGATGTGTTATGTGG + Intronic
1048452154 8:134542809-134542831 TGTCACAGAGAGGTGTGAGGAGG - Intronic
1048485049 8:134839841-134839863 TCTCACAGGGAAGAGTAGTGGGG - Intergenic
1050358846 9:4808773-4808795 TATCACAATCAAGGGTAATGTGG + Intronic
1050724889 9:8637770-8637792 TGTCACAGTGAAATAAAATATGG + Intronic
1051838976 9:21372917-21372939 TGTGACAATGAAATGTAATATGG - Intergenic
1052361888 9:27570986-27571008 TGTCACAGAGAAGTATAATCAGG + Intronic
1055476549 9:76668697-76668719 TGTATCAGTGAAGTGTACAGTGG - Intronic
1061356297 9:130107853-130107875 TCTCACAGCGAAGTGTTATCTGG - Intronic
1062009814 9:134260960-134260982 TGTCTCCGTGGAGTGTGATGAGG - Intergenic
1062340649 9:136092573-136092595 TGTCACCCTGAAGTGGAAGGTGG + Intronic
1203718999 Un_KI270742v1:186203-186225 TGGCACGGTGAAATGAAATGTGG - Intergenic
1185556148 X:1022797-1022819 TGTCACAGTTAAGTGGAAACAGG + Intergenic
1186432159 X:9514064-9514086 TCTCACAGTGAAATGTAGTGGGG - Intronic
1190267488 X:48835850-48835872 TGACTCAGTGGAGTGGAATGGGG + Intergenic
1190464386 X:50711213-50711235 TATCAAAGTGAAGTGCACTGAGG + Intronic
1192497327 X:71624640-71624662 TGTCCCTGTAGAGTGTAATGGGG - Intergenic
1192691858 X:73373176-73373198 TGTCCCAGTGAAGTGCAAAGTGG + Intergenic
1194722699 X:97359171-97359193 TGACACAGGGAAGTTTAATGAGG - Intronic
1195580461 X:106494879-106494901 TGTGACACTGAAGTATAATGTGG - Intergenic
1195683724 X:107567423-107567445 TGTTACAGACAAGTGTGATGTGG + Intronic
1197165963 X:123378025-123378047 TGTAAAAGTGAAGTGAAATAGGG - Intronic
1198682399 X:139196773-139196795 TGTCACATTGAAGACTAGTGTGG + Intronic