ID: 961377233

View in Genome Browser
Species Human (GRCh38)
Location 3:126475345-126475367
Sequence GCCTCCGGCCCCAGCACGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 367}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961377233_961377239 -7 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377239 3:126475361-126475383 CGGAGGCCTGGGGCGCGCGGCGG 0: 1
1: 0
2: 3
3: 56
4: 372
961377233_961377240 -6 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377240 3:126475362-126475384 GGAGGCCTGGGGCGCGCGGCGGG 0: 1
1: 0
2: 4
3: 54
4: 534
961377233_961377248 20 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377248 3:126475388-126475410 CGGCGGCGCCCGCGGTTGCGGGG 0: 1
1: 0
2: 2
3: 37
4: 361
961377233_961377243 0 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377243 3:126475368-126475390 CTGGGGCGCGCGGCGGGGAGCGG 0: 1
1: 0
2: 4
3: 89
4: 835
961377233_961377247 19 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377247 3:126475387-126475409 GCGGCGGCGCCCGCGGTTGCGGG 0: 1
1: 0
2: 3
3: 57
4: 592
961377233_961377252 28 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377252 3:126475396-126475418 CCCGCGGTTGCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 21
4: 248
961377233_961377246 18 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377246 3:126475386-126475408 AGCGGCGGCGCCCGCGGTTGCGG 0: 1
1: 0
2: 2
3: 30
4: 416
961377233_961377244 3 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377244 3:126475371-126475393 GGGCGCGCGGCGGGGAGCGGCGG 0: 1
1: 0
2: 19
3: 212
4: 1461
961377233_961377249 24 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 293
961377233_961377245 12 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377245 3:126475380-126475402 GCGGGGAGCGGCGGCGCCCGCGG 0: 1
1: 0
2: 11
3: 106
4: 742
961377233_961377250 25 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377250 3:126475393-126475415 GCGCCCGCGGTTGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
961377233_961377241 -5 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377241 3:126475363-126475385 GAGGCCTGGGGCGCGCGGCGGGG 0: 1
1: 0
2: 3
3: 41
4: 530
961377233_961377237 -10 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377237 3:126475358-126475380 GGCCGGAGGCCTGGGGCGCGCGG 0: 1
1: 0
2: 1
3: 62
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961377233 Original CRISPR GCCTCCGGCCCCAGCACGCC CGG (reversed) Exonic