ID: 961377242

View in Genome Browser
Species Human (GRCh38)
Location 3:126475367-126475389
Sequence CGCTCCCCGCCGCGCGCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 413}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961377242_961377252 6 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377252 3:126475396-126475418 CCCGCGGTTGCGGGGCCGGGCGG 0: 1
1: 0
2: 0
3: 21
4: 248
961377242_961377249 2 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 293
961377242_961377255 22 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377255 3:126475412-126475434 CGGGCGGCGCAGACAGCGCGAGG 0: 1
1: 0
2: 1
3: 32
4: 146
961377242_961377248 -2 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377248 3:126475388-126475410 CGGCGGCGCCCGCGGTTGCGGGG 0: 1
1: 0
2: 2
3: 37
4: 361
961377242_961377246 -4 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377246 3:126475386-126475408 AGCGGCGGCGCCCGCGGTTGCGG 0: 1
1: 0
2: 2
3: 30
4: 416
961377242_961377247 -3 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377247 3:126475387-126475409 GCGGCGGCGCCCGCGGTTGCGGG 0: 1
1: 0
2: 3
3: 57
4: 592
961377242_961377250 3 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377250 3:126475393-126475415 GCGCCCGCGGTTGCGGGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
961377242_961377245 -10 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377245 3:126475380-126475402 GCGGGGAGCGGCGGCGCCCGCGG 0: 1
1: 0
2: 11
3: 106
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961377242 Original CRISPR CGCTCCCCGCCGCGCGCCCC AGG (reversed) Exonic