ID: 961377249

View in Genome Browser
Species Human (GRCh38)
Location 3:126475392-126475414
Sequence GGCGCCCGCGGTTGCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961377233_961377249 24 Left 961377233 3:126475345-126475367 CCGGGCGTGCTGGGGCCGGAGGC 0: 1
1: 0
2: 7
3: 35
4: 367
Right 961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 293
961377238_961377249 9 Left 961377238 3:126475360-126475382 CCGGAGGCCTGGGGCGCGCGGCG 0: 1
1: 0
2: 2
3: 32
4: 216
Right 961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 293
961377242_961377249 2 Left 961377242 3:126475367-126475389 CCTGGGGCGCGCGGCGGGGAGCG 0: 1
1: 0
2: 5
3: 68
4: 413
Right 961377249 3:126475392-126475414 GGCGCCCGCGGTTGCGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961377249 Original CRISPR GGCGCCCGCGGTTGCGGGGC CGG Exonic