ID: 961378112

View in Genome Browser
Species Human (GRCh38)
Location 3:126480448-126480470
Sequence GGCTTGGTATGGAGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961378104_961378112 4 Left 961378104 3:126480421-126480443 CCAGGGAAGTAGCTTGCTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 152
Right 961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961378112 Original CRISPR GGCTTGGTATGGAGCCCAGA GGG Intergenic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
901679469 1:10904782-10904804 GGCTGGGCATGGTGCCCCGATGG - Intergenic
902252776 1:15166223-15166245 GGCTTGTTATGCATCCCACAGGG + Intronic
903630572 1:24766451-24766473 GTCTTGCTATGTTGCCCAGACGG + Intronic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905432492 1:37934721-37934743 GGTGTGGTGTGGACCCCAGAAGG + Intronic
906130049 1:43450564-43450586 GGCTTGCCCTGGGGCCCAGAAGG - Exonic
908794270 1:67815970-67815992 GCCCTGGCATGGGGCCCAGAGGG - Intronic
909739178 1:79006875-79006897 GGCAGGGAATGGAGCCCAGGAGG - Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
913571110 1:120120735-120120757 GGCTTGGAATGGATCCTGGAAGG + Intergenic
914291920 1:146281713-146281735 GGCTTGGAATGGATCCTGGAAGG + Intergenic
914552964 1:148732496-148732518 GGCTTGGAATGGATCCTGGAAGG + Intergenic
914865731 1:151426986-151427008 GGCTTGGGCTTGAACCCAGAAGG - Intronic
916190263 1:162171258-162171280 GGCTTGCTCTGGATCCCACAGGG + Intronic
921213483 1:212918869-212918891 GGCTTGGGAAGAAGCCCAGCTGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
923521148 1:234735789-234735811 GCCTTGGTATGGAAGGCAGAAGG - Intergenic
924051358 1:240082472-240082494 GGCTGGGAATGCAGCCCAGTAGG + Intronic
924522206 1:244815150-244815172 GGCTGGGGATGCAGCCCAGTAGG - Intergenic
1065694826 10:28370166-28370188 GCCTTGGTTTGTTGCCCAGAAGG - Intergenic
1066977185 10:42379687-42379709 CCCTTGGAATGTAGCCCAGAAGG + Intergenic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1070770772 10:79081119-79081141 CACATCGTATGGAGCCCAGAAGG + Intronic
1071394926 10:85213494-85213516 GGCTTGGTATGGACCCTGGGAGG - Intergenic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072449186 10:95525959-95525981 GGCTTAATATGGAGCAAAGAGGG + Intronic
1075588198 10:123672417-123672439 GGCCTGCCATGGAGCCCAAAGGG - Intronic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077141987 11:1028808-1028830 GGGTGGGGAGGGAGCCCAGACGG - Intronic
1077318668 11:1930271-1930293 GGCTTGGTGTGGTCCCCCGAAGG - Intronic
1077343607 11:2036712-2036734 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1078539614 11:12202610-12202632 GTCTTTTTCTGGAGCCCAGACGG - Intronic
1079652068 11:22942388-22942410 GGCCTGGAAAGCAGCCCAGAGGG - Intergenic
1080980256 11:37394635-37394657 CCCTTGCTATGCAGCCCAGATGG + Intergenic
1081586326 11:44386523-44386545 GGATGGAGATGGAGCCCAGAGGG - Intergenic
1083258484 11:61510486-61510508 AGATTGGTATGGGGCACAGAAGG + Exonic
1083856720 11:65396658-65396680 GGCTGGGTAAGGAGCCCACAAGG - Intronic
1084239048 11:67806079-67806101 GGCTTGGGGTGGGGCCGAGACGG + Intergenic
1085779517 11:79395613-79395635 GGCTTTCTATGGCTCCCAGAAGG + Intronic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1088317076 11:108518714-108518736 GGCTGGGAATGCAGCCCAGTAGG - Intronic
1088581344 11:111319840-111319862 GGCTGGGAATGCAGCCCAGTAGG - Intergenic
1090763244 11:129855257-129855279 GGCTTGTGATGGAGGCAAGACGG - Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1202826593 11_KI270721v1_random:91901-91923 GGCTTCCTTTGGAGCCCAGATGG + Intergenic
1098230872 12:68370714-68370736 GGGGTGGAAAGGAGCCCAGAGGG - Intergenic
1100464737 12:94834957-94834979 GGCATGCTTTGGAGCCCAGCTGG + Intergenic
1102466695 12:113134623-113134645 TGCTTGGCATAGTGCCCAGAAGG - Intronic
1103699699 12:122842712-122842734 GGCCTGATGTGGAGTCCAGATGG - Intronic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1107540916 13:41388335-41388357 GGCTGGGAATGCAGCCCAGCAGG + Intergenic
1110124253 13:71922385-71922407 GGTTTTGGATGGAGCCTAGAAGG + Intergenic
1112977205 13:105335219-105335241 GGCCAGGTTTGGAGCACAGATGG - Intergenic
1115464610 14:33701205-33701227 GGGTTGTTATGGAACTCAGATGG - Intronic
1116857844 14:49969337-49969359 GTCTTGCTATGATGCCCAGATGG + Intergenic
1116935857 14:50739438-50739460 TGCTGGTTATGGAGCCCTGATGG + Exonic
1118466106 14:66032598-66032620 GGTTTGGGGTGGAGCCAAGATGG - Intergenic
1119193316 14:72699323-72699345 GCCTTGCTATGTTGCCCAGATGG - Intronic
1121587203 14:95070540-95070562 GGCTGGGAATGTTGCCCAGAAGG - Intergenic
1123041712 14:105492915-105492937 GGCTGGGCAGGGAGCCCAGTGGG + Intronic
1124071089 15:26393685-26393707 GGCTTACTCTGGAGCCTAGAAGG + Intergenic
1128945620 15:71818322-71818344 GACTTGGAGTGGAACCCAGATGG - Intergenic
1130396212 15:83504377-83504399 GGGTGGGTATGAAGACCAGAAGG - Intronic
1130694250 15:86114310-86114332 GCCTTGGCAAGGAGTCCAGAAGG + Intergenic
1131585093 15:93684435-93684457 GCCTGGGTATGGAGCAGAGAGGG - Intergenic
1135725137 16:24848412-24848434 GTCTTGCTATGTTGCCCAGACGG - Intronic
1136317039 16:29460528-29460550 TGTTTGTTCTGGAGCCCAGATGG + Intronic
1136319058 16:29470773-29470795 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1136431614 16:30199870-30199892 TGTTTGTTCTGGAGCCCAGATGG + Exonic
1136433629 16:30210117-30210139 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1136907792 16:34118465-34118487 GCTTTGGTAGGGAGCCAAGATGG + Intergenic
1137563207 16:49516145-49516167 GGCATGGAATGGAGGCCAGAGGG - Intronic
1139263916 16:65622193-65622215 GGCATGGTAGGGAGAGCAGAGGG + Intergenic
1139289135 16:65841318-65841340 GGCTTATTCTGGAGACCAGAGGG - Intergenic
1139826519 16:69761703-69761725 GGCTTTTTATGGAGCCAAGCAGG + Intergenic
1139851494 16:69953349-69953371 GGCTTGGGGTGCAGCCCCGAGGG + Intronic
1139880470 16:70176261-70176283 GGCTTGGGGTGCAGCCCCGAGGG + Intronic
1140372040 16:74419256-74419278 GGCTTGGGGTGCAGCCCCGAGGG - Intronic
1143658926 17:8312973-8312995 GGCCTGGCCTGGAGCTCAGATGG + Exonic
1143700806 17:8658747-8658769 TGGTTGGGATGGACCCCAGAGGG - Intergenic
1144131691 17:12252788-12252810 GGCTTTGTCTGGATCCCAGGAGG - Intergenic
1144653575 17:17021603-17021625 AGCTTCAGATGGAGCCCAGAGGG - Intergenic
1145258723 17:21342260-21342282 GGCAGGGCCTGGAGCCCAGAGGG - Intergenic
1145259511 17:21346524-21346546 GGGCAGGTAGGGAGCCCAGAGGG - Intergenic
1145317106 17:21741424-21741446 GGGCAGGTAGGGAGCCCAGAGGG + Intergenic
1145317906 17:21745744-21745766 GGCAGGGCCTGGAGCCCAGAGGG + Intergenic
1147324767 17:39664964-39664986 GCCCTGGTACAGAGCCCAGAGGG + Exonic
1147606710 17:41777756-41777778 GCTTTGGGAAGGAGCCCAGAAGG - Intronic
1149272477 17:54995251-54995273 ACCTTGGTGTGGAGCCCAAATGG - Intronic
1150023060 17:61640262-61640284 GGCTTGGAGGGGAGGCCAGAAGG + Intergenic
1151022564 17:70634557-70634579 GTCTTGCTATGTTGCCCAGATGG - Intergenic
1151443280 17:74147554-74147576 GGCATGGCATAGAGCCCTGAGGG + Intergenic
1152748869 17:82053361-82053383 AGCCTGGTACGGAGCCCAGTGGG + Exonic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1153679148 18:7483969-7483991 GGCTGGGTAAGCAGCCCTGAAGG + Intergenic
1155492802 18:26416826-26416848 GGCTTAGCATGGAGGCCAGGAGG + Intergenic
1156084250 18:33379950-33379972 GGCTGGGTGTGGAGCAGAGAGGG + Intronic
1156084395 18:33381254-33381276 AGCTGGGTATGGAGCAGAGAGGG + Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1162620881 19:11843145-11843167 GTCTTGCTCTGTAGCCCAGATGG + Intergenic
1162788763 19:13052349-13052371 GGCTGGGGGTAGAGCCCAGATGG + Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165896476 19:39144545-39144567 GGTTTGTTCTGGAGGCCAGAAGG + Intronic
1166383896 19:42369887-42369909 GCCTGGGTTTGGATCCCAGAGGG + Intronic
1167380760 19:49136741-49136763 GGGGTGGTATGGAGCCCGCAGGG - Exonic
926633568 2:15158633-15158655 GGCTGGGTCTGCAGCCCTGAGGG - Intergenic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
929457995 2:42079691-42079713 GTCTTGCTATGTTGCCCAGACGG - Intergenic
930403267 2:50919233-50919255 GAGTTGTTATGGAGCACAGAAGG + Intronic
933058901 2:77710344-77710366 GGCTTCATATAGAGCACAGATGG - Intergenic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933770134 2:85738414-85738436 GGATTGGGATCCAGCCCAGAGGG + Intergenic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934621518 2:95812315-95812337 GGCTTTGAATGGAGCCTTGAAGG - Intergenic
936100535 2:109574241-109574263 GTCTTGGTATGTTGCCCAGTTGG - Intronic
936875980 2:117190067-117190089 TGCTTTGGTTGGAGCCCAGATGG + Intergenic
937202059 2:120210090-120210112 GGCTTGGTGTGGAGAGAAGAAGG + Intergenic
937235421 2:120429099-120429121 GGCTTAGCATGGGGCCCAGAAGG + Intergenic
937954817 2:127416245-127416267 GGCTTGGCAGGCTGCCCAGAGGG - Intergenic
938280638 2:130061380-130061402 GGCTTGGACTGGAGCCCCAAAGG + Intergenic
938281262 2:130065174-130065196 GGCTTGGACTGGAGCCCCAAAGG + Intergenic
938306398 2:130259177-130259199 GGCTTTGTGTGGAGCCAAGATGG + Intergenic
938332124 2:130455286-130455308 GGCTTGGACTGGAGCCCCAAAGG + Intergenic
938357684 2:130665382-130665404 GGCTTGGACTGGAGCCCCAAAGG - Intergenic
938358191 2:130668401-130668423 GGCTTGGACTGGAGCCCCAAAGG - Intergenic
938434442 2:131274156-131274178 GGCTTGGACTGGAGCCCCAAAGG - Intronic
938434763 2:131276146-131276168 GGCTTGGACTGGAGCCCCAAAGG - Intronic
941002505 2:160216765-160216787 AGCTTGGTATGGAGCTGAGCAGG - Intronic
941540080 2:166771574-166771596 TCCACGGTATGGAGCCCAGAGGG - Intergenic
942320688 2:174733070-174733092 GGCAGGGCATGGAACCCAGAGGG - Intergenic
944353486 2:198758020-198758042 GAAATGGTATGGAGCCCAGATGG - Intergenic
945644899 2:212479005-212479027 GGCTTGGCATAGTGCCCAGTGGG - Intronic
946353123 2:219168612-219168634 GGCGTGGGATGGTGCCCAGTGGG - Intronic
946368174 2:219263613-219263635 GGAGTGATATGGGGCCCAGAGGG - Intronic
1168835845 20:876817-876839 AGGTTGGTATGGATCCCATAAGG + Intronic
1170174948 20:13458709-13458731 GTCCTGGGATGGAGCCCAGCTGG - Intronic
1170626351 20:18033143-18033165 GTCTTTGTTTGGAGCCCAAAGGG - Intronic
1172968846 20:38858846-38858868 GGGTTCAGATGGAGCCCAGAGGG + Intronic
1181277575 22:21696259-21696281 GGCTTGAGATGAAGCCCAGGTGG - Intronic
1183032072 22:35113848-35113870 GGCTTGGGAGGAAGCACAGAAGG - Intergenic
1183672372 22:39280475-39280497 GACTCTGGATGGAGCCCAGATGG - Intergenic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1185397355 22:50599976-50599998 GGCTTGGGATGGAGCCCTGTGGG - Intronic
950458229 3:13105287-13105309 GGCCTGGTCAGGAGACCAGATGG - Intergenic
952492880 3:33888577-33888599 GGCTTGCTAAGGAGCTTAGATGG + Intergenic
952869189 3:37882930-37882952 TGCTTGGTTTGGAGCCAAGTTGG + Intronic
953534877 3:43769871-43769893 TGCTTGGAATGGAGCCAGGACGG - Intergenic
954198833 3:49012372-49012394 TGCTTGGTGTGGAGCCATGAAGG + Exonic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959754087 3:109875639-109875661 GCCTGGGCATGGAGCACAGAGGG - Intergenic
960108373 3:113821658-113821680 GTCTTGTTATGGTGCCCAGGAGG + Intergenic
960196537 3:114775611-114775633 GGCTCCGTGTGCAGCCCAGAGGG - Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
965810448 3:172586407-172586429 AGCTTTGTATGGAGCTCAGGAGG + Intergenic
966034911 3:175399764-175399786 GTCTGGGAATGCAGCCCAGAAGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966893212 3:184423234-184423256 ATCTAGGTAGGGAGCCCAGAAGG + Intronic
967960739 3:194921967-194921989 GTCTTGGAATGCAGCCCAGTAGG - Intergenic
968084097 3:195866978-195867000 GGCTGGGTCTGCGGCCCAGAGGG - Exonic
968465773 4:749905-749927 GGCTTGGGCAGGAGCCCAGGAGG - Intronic
970067527 4:12116073-12116095 GGCTGGGTGTGGAGCAGAGAGGG + Intergenic
972123898 4:35740147-35740169 GCCCTGATATGGAGCCCAGAAGG + Intergenic
973141963 4:46780719-46780741 GTCTTTTTATGGAGCACAGAAGG - Intronic
973386245 4:49516080-49516102 GGCTTGGTGTGGAGCCCTCACGG - Intergenic
974547622 4:63333598-63333620 GGTTGGGTGTGGAGCCAAGATGG + Intergenic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
984472771 4:180197529-180197551 GACTTGGTATGGAAACCAGCAGG + Intergenic
988936447 5:36087808-36087830 GGCTTGTTCTGGATCTCAGAGGG + Intergenic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
994589386 5:101754675-101754697 GGCTTGTGAAGGAGCCCTGAAGG + Intergenic
995388685 5:111615622-111615644 GCCTCGGTATGGAGCAAAGAGGG + Intergenic
997529031 5:134570883-134570905 GACTTGGTGTGGAGCTCAAAAGG - Intronic
997594090 5:135094838-135094860 GGCTTGGCAGGGAGACCACATGG - Intronic
997792673 5:136775524-136775546 GACTTGGTATGGGGACAAGATGG - Intergenic
998076500 5:139240895-139240917 GGCTTTGTCTGGAGCCAACATGG - Intronic
998860724 5:146441060-146441082 GGCTGGGTATGGAAAACAGATGG + Intergenic
1001205966 5:169763471-169763493 GGCTTGGCATCAAGGCCAGATGG + Intronic
1001379519 5:171294446-171294468 GGCTTGGGAGGTAGCCCAGGTGG - Intronic
1001545880 5:172570283-172570305 TGCTTTGAATCGAGCCCAGATGG - Intergenic
1003091217 6:3105195-3105217 GACTTGGTTTGGAGCAGAGAAGG - Intronic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1006729416 6:36225206-36225228 GACTTGGAATGGTGCCCAAAAGG - Intronic
1007059566 6:38925362-38925384 GTCTTGCTCTGTAGCCCAGACGG + Intronic
1007816638 6:44529663-44529685 GACTTGGTCTGTAGCCCAAAAGG - Intergenic
1010005000 6:70986149-70986171 GCCCTGGTATGGATACCAGAAGG - Intergenic
1011323974 6:86129163-86129185 GGGTTGGTTTGGAGCCAGGAGGG + Intergenic
1012647225 6:101700839-101700861 GGACTGGTATAGAGCCCAGGGGG + Intronic
1016737257 6:147492782-147492804 GCCTTGGGTGGGAGCCCAGATGG - Intergenic
1018748589 6:166781786-166781808 GGCATGGTTTAGAGTCCAGAAGG + Intronic
1018766574 6:166938316-166938338 GGCTCGGTGTGGCGCTCAGAAGG + Intronic
1019470084 7:1214840-1214862 GGCTTGGGATGAAGCCCATCAGG + Intergenic
1019684548 7:2373802-2373824 GGCATGGGATGGAGCCCATGCGG - Intronic
1022261580 7:28710591-28710613 GTCTTGCTATGGTGCCCAGGTGG - Intronic
1022813649 7:33893469-33893491 GGGTAGGTATGGAGGCTAGAAGG - Intergenic
1023554218 7:41403447-41403469 GGGTTGGTTTGCAGGCCAGAGGG - Intergenic
1023811721 7:43917091-43917113 GGCTTGGGATTGAGCTCAGCAGG + Intronic
1023872068 7:44268671-44268693 GCCTTGGCATGGAGCTCTGAGGG + Intronic
1023959409 7:44914016-44914038 GGTTTGGCCTGGAGCCCTGAGGG + Intergenic
1024984148 7:55181242-55181264 GGCTTCGCATGGTGGCCAGAAGG - Intronic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1025844806 7:65186594-65186616 GTCTTGTTATGTTGCCCAGAGGG + Intergenic
1030276204 7:107724302-107724324 GGCTGGAGATGGATCCCAGACGG - Intergenic
1030600726 7:111588870-111588892 GTCTTGCTATGTTGCCCAGATGG - Intergenic
1032977507 7:137242396-137242418 GGCTTGGTATGGACAGCAGGAGG + Intronic
1033644058 7:143287658-143287680 GGGTTGGTATGAAGGCCAGAAGG + Exonic
1034671182 7:152859821-152859843 GACTTGGTCTGGAGCCTAGTGGG - Intergenic
1035186119 7:157126974-157126996 GTCTTGCTATGTAGCCCAGACGG + Intergenic
1039981146 8:42410893-42410915 GGCTGGGAAGGGAGCTCAGAAGG + Intergenic
1040403344 8:47075510-47075532 GTCTTGGGGTGGAGCCAAGATGG + Intergenic
1042117753 8:65450632-65450654 GGCTGGAAATAGAGCCCAGAGGG - Intergenic
1043213115 8:77550655-77550677 GTCTAGGTATGGAGCAGAGAGGG + Intergenic
1045622761 8:104001678-104001700 GGATTGGGATGGAGGTCAGAGGG - Intronic
1047718329 8:127616251-127616273 GACTTGGGATGGAAGCCAGAGGG + Intergenic
1047871649 8:129089548-129089570 GGATTGGTATGGAATCAAGAGGG + Intergenic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1050479979 9:6079296-6079318 GTCTTGTTATGGTGGCCAGAGGG + Intergenic
1050529405 9:6575246-6575268 CGCTGGGGATGGAGCCCATATGG - Intronic
1052411781 9:28130655-28130677 GTCATGGTATGGAAGCCAGAGGG + Intronic
1052831827 9:33221883-33221905 GGCCTAGTATGGAGCCCACTAGG + Intronic
1056813492 9:89782519-89782541 TGCTTGGGAGGCAGCCCAGAGGG - Intergenic
1058048673 9:100384501-100384523 GTCTGGGAATGGAGCCCAGTAGG - Intergenic
1058628187 9:106957907-106957929 GGGTTGGTAGGGAGCAGAGAAGG + Intronic
1060799587 9:126535162-126535184 GGCTGGTGAAGGAGCCCAGATGG + Intergenic
1061209842 9:129184746-129184768 GGCTTGGGGTGGGGCCTAGAGGG + Intergenic
1062543908 9:137053433-137053455 GACTGGGTATTCAGCCCAGATGG - Intronic
1062666184 9:137673986-137674008 GTCTTGGAATAGAGCCCAGGAGG + Intronic
1187272590 X:17792483-17792505 AGCTTGGGATGGAGCCAATATGG + Intergenic
1195197776 X:102516466-102516488 GGCTCGGCATCGAGCGCAGAAGG + Intronic
1196185702 X:112742843-112742865 GCCTTGGTATGGACACCAAAGGG + Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197755085 X:129987741-129987763 GGCTTGGACTGGAGGCCACATGG + Intronic
1199080573 X:143572211-143572233 GTCTTGCTCTGTAGCCCAGACGG + Intergenic
1199272343 X:145898843-145898865 GGCTTGGTGTGGATCTCTGACGG - Intergenic