ID: 961378217

View in Genome Browser
Species Human (GRCh38)
Location 3:126481160-126481182
Sequence TAAAATGGACAGATCCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961378217_961378221 -8 Left 961378217 3:126481160-126481182 CCCCGCTGGATCTGTCCATTTTA 0: 1
1: 0
2: 1
3: 8
4: 122
Right 961378221 3:126481175-126481197 CCATTTTATTAGAAAAACGACGG 0: 1
1: 0
2: 0
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961378217 Original CRISPR TAAAATGGACAGATCCAGCG GGG (reversed) Intergenic
900587839 1:3441960-3441982 TAAAATGGCCAGAGCGAGGGTGG + Intergenic
901792527 1:11661855-11661877 TGAGATGGACAGACCCAGGGTGG + Exonic
905409424 1:37758003-37758025 TTAAAGGGAGAGATCCAGGGTGG - Intronic
906416852 1:45626628-45626650 TAAAATGGTCAGGTCCAGCCAGG - Intergenic
909213808 1:72859575-72859597 TAAAATGGACAGAGAAAGCTTGG + Intergenic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
911591599 1:99754167-99754189 AGAAATGGACAGATCCAGGCTGG + Intronic
912052663 1:105549419-105549441 TAAAATGGACACATTTAGTGTGG - Intergenic
920290585 1:204920411-204920433 AAAAAAGGACAGATCCTGCAAGG - Intronic
1065155576 10:22866818-22866840 TAAAATGAACAAATCTAGCCAGG - Intergenic
1066052660 10:31649562-31649584 TAAAAAAGACAGAGCCAGCTGGG + Intergenic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1069751211 10:70746350-70746372 AAAAATGGACATGTCCAGAGAGG + Intronic
1083231403 11:61322912-61322934 TAAAATGGAGAGATTCTGAGAGG + Intronic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1086461412 11:87009255-87009277 AAAACTGGACAGAACCAGAGTGG - Intergenic
1087501056 11:98954454-98954476 TAAAATGGAGAGATTCAACAAGG + Intergenic
1088045961 11:105451808-105451830 AAAAATGAACAGATCCTGAGAGG - Intergenic
1089473150 11:118736954-118736976 TAAAAATGCCAGATCCAGCTGGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093478084 12:19576937-19576959 TAAAATGGACAGTCCCAGTTTGG + Intronic
1095261233 12:40102199-40102221 TAAAATGAACACCTCCAGGGTGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1110759335 13:79213605-79213627 TAACATGGATAAATCCAGCCAGG - Intergenic
1111519689 13:89384515-89384537 CAAGGTGGACAGATCCAGTGAGG + Intergenic
1112798327 13:103082251-103082273 TAAAAGGCACAGATCCAGAAAGG + Intergenic
1117705965 14:58468344-58468366 TAAAAATAACAGAGCCAGCGGGG - Intronic
1118836681 14:69483282-69483304 TAAAATGGGGAGATCTAGCATGG + Intergenic
1121647676 14:95531187-95531209 TAAAATGAACAGGGCCAGTGCGG + Intergenic
1121679797 14:95783977-95783999 TTAAAAGCACAGATCCAGCCAGG - Intergenic
1128764200 15:70241188-70241210 CAAAATGGACAGTTCCAGCCAGG + Intergenic
1131290713 15:91104551-91104573 CAAAATGTACAGATACAGGGAGG + Intronic
1135852883 16:25980572-25980594 TAGAATGGACAGAACCAGCCAGG + Intronic
1140548555 16:75837039-75837061 GAAAAAGGACATATCCAGCAAGG - Intergenic
1140619355 16:76709494-76709516 TGAAAATGACAGATCCAGCCAGG + Intergenic
1140794056 16:78419074-78419096 TAAAATGAACAGGTTCAGCCAGG + Intronic
1141157429 16:81607019-81607041 CACAATCGACAGACCCAGCGGGG - Intronic
1142331457 16:89456757-89456779 CAAAATAGACAGATCCACAGTGG + Intronic
1149184749 17:53984234-53984256 TAAAAATGACAGATCTAGAGGGG + Intergenic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1149778653 17:59378630-59378652 TGAAAGGGAGAGATCCAGCCAGG - Intronic
1153116993 18:1670368-1670390 TAAAATGGACAGATTCATCTTGG + Intergenic
1155500653 18:26483681-26483703 TAACATAGACAAATCCAGGGTGG + Intronic
1159028885 18:63210997-63211019 ACAAATGGACAGATTCAGGGCGG - Intronic
1160885413 19:1344521-1344543 TAAAAAGGCAAGATCCAGCTGGG + Intergenic
1162245511 19:9396659-9396681 ACAAATGGACAGATCCAGCAGGG + Intergenic
1166958031 19:46478842-46478864 CAAATTGGACAGAGCCAGCCAGG - Intergenic
925935835 2:8758466-8758488 GCAAATTGACAGATCCAGTGTGG - Intronic
928396502 2:30946670-30946692 TAGAATGGACTGATACAGCTGGG + Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
932898564 2:75670392-75670414 TAAAATTGACAGTTCCAACAGGG - Intronic
933031593 2:77335195-77335217 TAAAATAGACAGATCGAACCTGG - Intronic
935267030 2:101403489-101403511 TAAAATGGACACATCAGGCTGGG + Intronic
935728606 2:106046014-106046036 TAAAATGGAGAGATCCATGAAGG - Intergenic
936661199 2:114546103-114546125 AAAAATGGACTGATACAGGGGGG - Intronic
936772400 2:115930054-115930076 AGAAATGAACAGATCCAGCAAGG - Intergenic
941594231 2:167455806-167455828 AATAATGGAGAGATCCAGCCAGG - Intergenic
946388207 2:219398957-219398979 TAAACAAGACAAATCCAGCGAGG - Intronic
1171922340 20:31158763-31158785 TAGAATGGAAAGAACCAGAGTGG + Intergenic
1178630259 21:34253409-34253431 TAAAATGGGCAGAAGCAGAGCGG + Intergenic
1178841710 21:36143007-36143029 TAAAATCTACAGATCCGGCCAGG + Intronic
1180987673 22:19914952-19914974 GGAAGGGGACAGATCCAGCGGGG + Intronic
1181856821 22:25787689-25787711 TGAAATGAACAGATGCAACGAGG + Intronic
1182306504 22:29372987-29373009 TAAAATGGGGAGATCAAGCCGGG + Intronic
1182843166 22:33408730-33408752 GAAAATGGAAAAACCCAGCGTGG + Intronic
951988601 3:28649817-28649839 TTAAATGGTCATATCCAGAGTGG + Intergenic
952281637 3:31929039-31929061 TAAAAAGGAAACATCCAGCTAGG + Intronic
954826805 3:53380688-53380710 AAAAATGGACATTTCCAGCTGGG + Intergenic
955433029 3:58870172-58870194 TAACATGAAGATATCCAGCGAGG - Exonic
957020255 3:75118533-75118555 GAAAATGGACTAATCCAGTGGGG - Intergenic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
957973691 3:87416469-87416491 TAAAATTGGCAGATCAAGCAAGG - Intergenic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
964377856 3:156067609-156067631 TAAAATCGTCAGATTCACCGAGG - Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
968039873 3:195579847-195579869 TCAAATGAACAGAAACAGCGTGG + Intronic
971450725 4:26799129-26799151 TAAAATGGACCTTTCCAGCCTGG + Intergenic
972190361 4:36584067-36584089 TAAGATGCACAGAGACAGCGTGG + Intergenic
974785754 4:66618513-66618535 CAAAATGGGCAGATCCAGACTGG + Intergenic
978384802 4:108168394-108168416 TAAAACGGACATCTCCAGCGTGG - Exonic
983060972 4:163160556-163160578 TTAAAGGGATAGATCCAGAGAGG + Intronic
987150336 5:15033200-15033222 TAATATGTACAGATCCAGAATGG - Intergenic
992224505 5:74606954-74606976 TAATATGGACAGATACATTGTGG - Intergenic
994956843 5:106544087-106544109 TAAAATGAAAAGAGCCAGCTGGG + Intergenic
998399521 5:141841311-141841333 TAAAATGGAGAATTCCAGTGGGG + Intergenic
999565017 5:152849572-152849594 AGAAATGGACAGATCTAGCAGGG - Intergenic
1003635897 6:7831240-7831262 CAAAATAGGCAGATCCAGAGAGG + Intronic
1004262027 6:14117370-14117392 TAAAATGGGCAGATCCCGCTCGG + Intronic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006612382 6:35302020-35302042 TAAAAGACACAGATCCAGCCAGG - Intronic
1007306255 6:40907731-40907753 CAAAATGGAGAGTTCCAGCAGGG + Intergenic
1013360878 6:109393079-109393101 TAAAGTGCACACATCCAGAGAGG - Intronic
1016327769 6:142922467-142922489 TAAAATAGTAAGATCCAGAGTGG + Intronic
1017991809 6:159495274-159495296 CAAAGGGGACAGATCCAACGTGG - Intergenic
1024103109 7:46053540-46053562 AAAAATGGACAGATCCTAAGAGG - Intergenic
1024890576 7:54196800-54196822 TAAAATTGACAGATGCTGGGAGG + Intergenic
1029462159 7:100701529-100701551 GAAAATGGGCAAATCCAGCCTGG - Intergenic
1030129788 7:106189233-106189255 TAAAAAGGCCAGAGCCAGCCGGG - Intergenic
1030780258 7:113592040-113592062 TAAAAAGGACAGGCCGAGCGTGG - Intergenic
1033210304 7:139455249-139455271 TAAAATGGACAGATCACTTGAGG - Intronic
1034318671 7:150159305-150159327 TAATCTGGACAGAGGCAGCGTGG - Intergenic
1034774085 7:153807907-153807929 TAATCTGGACAGAGGCAGCGTGG + Intergenic
1034870569 7:154679592-154679614 TGAAGTGGACAAATCCAGCGAGG + Intronic
1035785760 8:2259331-2259353 TAAAATGTACAAATCAAGCATGG - Intergenic
1035807047 8:2462385-2462407 TAAAATGTACAAATCAAGCATGG + Intergenic
1039521793 8:38177360-38177382 TAAAAAAGAAAGATCCTGCGCGG + Intronic
1039992142 8:42497524-42497546 TAAAAGGGTCAGGTCCAGCAAGG - Intronic
1042488761 8:69375936-69375958 CAAAGTGGACTGATCCAGTGTGG + Intergenic
1043398384 8:79859889-79859911 AAAAATGGAGATATACAGCGGGG - Intergenic
1043412825 8:80016877-80016899 AGAAAAGGACAGATCCAGCAGGG + Intronic
1045019062 8:98025771-98025793 AAAAATGGACAGATCCAAAATGG - Intronic
1047574544 8:126138202-126138224 CAAAATGCAGAGATCCAGAGTGG - Intergenic
1047950000 8:129924669-129924691 TAAAACTGAAAGATCCAGCTGGG + Intronic
1050058632 9:1681348-1681370 TAAAATGGACAGATCATAGGTGG + Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053267167 9:36723884-36723906 TAAAATGGACAGGTACTGCTAGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055631181 9:78225437-78225459 TTAAATGGACAGATACATCATGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1189625823 X:42895647-42895669 TAAAATTGCCAGTTCCAGCTGGG + Intergenic
1189896984 X:45665771-45665793 TAAAATGAACCTATCCAGCTAGG + Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1196729292 X:118924962-118924984 TAAAAAGGACAGTTTCAGCTAGG - Intergenic
1197149875 X:123208364-123208386 TAAAATGAAAAGATCCTGTGAGG + Intronic
1199489474 X:148382509-148382531 TAGAATGGTCAGATCCATTGGGG + Intergenic
1201771807 Y:17623041-17623063 CCAAATGAACAGATCCAGCATGG + Intergenic
1201829748 Y:18282945-18282967 CCAAATGAACAGATCCAGCATGG - Intergenic