ID: 961378469

View in Genome Browser
Species Human (GRCh38)
Location 3:126482294-126482316
Sequence GTGAGGATCGCCAGGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961378465_961378469 -9 Left 961378465 3:126482280-126482302 CCATGGCTGGGCAGGTGAGGATC 0: 1
1: 0
2: 1
3: 25
4: 228
Right 961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961378469 Original CRISPR GTGAGGATCGCCAGGGAGGA AGG Exonic
900126410 1:1070758-1070780 GTGAGGCTCCCCAGGGAGATGGG - Intergenic
900755657 1:4432869-4432891 GTGGTGATCCCCAGGGATGAAGG - Intergenic
901128067 1:6943214-6943236 GTGAGGACGGTCAGGGAGGAGGG - Intronic
901523981 1:9807785-9807807 GTCAGGAAGCCCAGGGAGGAGGG - Intronic
901744533 1:11363712-11363734 GTGAGGAGGGCCAGGGAAGGAGG + Intergenic
902408600 1:16199906-16199928 GTGAGGAACAGCAGGGAGGCTGG - Intronic
902648021 1:17817550-17817572 GTGAGAATGGCCAGGGAGGAGGG - Intronic
902964649 1:19990908-19990930 GTGAGTACTGCCAGGGAAGAAGG - Intergenic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
905150973 1:35927399-35927421 GTGAGGATAAACATGGAGGATGG - Exonic
905225964 1:36479410-36479432 GTGAGTATGGCCAAGGATGAGGG - Intronic
905920573 1:41716202-41716224 GTGAGGCTCGATAGGGAGGCTGG + Intronic
905939197 1:41849461-41849483 GTGAGCATCTGCATGGAGGAGGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907852220 1:58266504-58266526 GTGAGGCTCAGCAGGGAGAAAGG - Intronic
908272876 1:62437401-62437423 GTAAGGAGGGCCTGGGAGGAGGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908929744 1:69304235-69304257 GTGAGCATTGCCAGGGAAGAAGG - Intergenic
910617754 1:89218149-89218171 ATGAGGATTGCCAGGGAAGAAGG + Intergenic
912437014 1:109668856-109668878 GGGAGGGTCCCCAGGAAGGAGGG + Intronic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
913105058 1:115606605-115606627 ATGATGATCTCCAGGGAGCAGGG + Intergenic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915916978 1:159946064-159946086 GGGTGGATCCCCTGGGAGGAGGG - Intergenic
915973756 1:160371564-160371586 GTCAGAATTGCAAGGGAGGAAGG + Exonic
916682129 1:167114412-167114434 GTGAGGCTACCCAGGGAGAAGGG - Intronic
916823958 1:168426739-168426761 TTGAGAATCACCTGGGAGGAGGG + Intergenic
918361557 1:183764194-183764216 ATGAGCATTGCCAGGGAAGAAGG + Intronic
918362711 1:183775141-183775163 GTGAGTATTGCCAAGGAAGAAGG - Intronic
921796058 1:219346120-219346142 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
921828408 1:219700088-219700110 GTGAGGACAGACAGGGAGTAAGG + Intronic
923051669 1:230394681-230394703 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
923051700 1:230394794-230394816 GTGAGGAGAGGAAGGGAGGAAGG - Intronic
924080614 1:240393915-240393937 ATGAGTATTGCCAGGGAAGAAGG + Intronic
1063289347 10:4727627-4727649 ATGAGTATTGCCAGGGAAGAGGG + Intergenic
1063759166 10:9052770-9052792 GTGAGTATTGCCAGGCAAGAAGG + Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1064262221 10:13795087-13795109 GTGAACATCACCAGGGAGGTGGG + Intronic
1064515763 10:16146358-16146380 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1064662261 10:17617612-17617634 GTGCGCATCGCCAGGGCGCAAGG - Intergenic
1065487458 10:26248955-26248977 GAGAGGATCTCCAGTCAGGAAGG + Intronic
1065497757 10:26347563-26347585 ATGAGGACTGCCTGGGAGGAGGG - Intergenic
1066256886 10:33688296-33688318 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1066279249 10:33898994-33899016 ATGAGGACTGCCAGGGAAGAAGG - Intergenic
1066573608 10:36801280-36801302 GTGAGAGTCTCCAGGGTGGAAGG + Intergenic
1067438308 10:46294190-46294212 GTGAGGATTCCCAGGGTGCAGGG + Intronic
1067542013 10:47161752-47161774 CTGAGGACCCCCAGGTAGGATGG - Intergenic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1069951450 10:72021338-72021360 ATGAGGATTGCCGGGGAAGAAGG + Intergenic
1069981462 10:72255543-72255565 GTGAGCAGTGCCAGGGAGGGAGG - Intergenic
1070250341 10:74767593-74767615 GTGAGCTTGGCCAGGGAGCAGGG + Intergenic
1071126052 10:82336152-82336174 GAAGGGTTCGCCAGGGAGGATGG + Intronic
1072555304 10:96510166-96510188 GTGAGGATAGGCAGGCAGGCAGG + Intronic
1072622579 10:97089748-97089770 GTGGGGTTCACCGGGGAGGATGG + Intronic
1072784446 10:98270107-98270129 GTGAACATAGCCAGGCAGGAGGG - Intergenic
1075162022 10:120032731-120032753 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1076308176 10:129479825-129479847 GTGAGGACCCCCAGCAAGGAGGG - Intronic
1076554097 10:131311177-131311199 GCGAGGACCGCCGGGGAGGAGGG + Intronic
1076629021 10:131841714-131841736 GTGAGTGGGGCCAGGGAGGAAGG - Intergenic
1076705120 10:132297248-132297270 CTGGGGATGGCCACGGAGGAGGG - Intronic
1076790552 10:132774873-132774895 GGGAGGAGAGGCAGGGAGGAGGG + Intronic
1076790600 10:132775007-132775029 GAGAGGAGGGGCAGGGAGGAGGG + Intronic
1076790606 10:132775020-132775042 GGGAGGAGGGGCAGGGAGGAGGG + Intronic
1076790643 10:132775107-132775129 GGGAGGAGGGGCAGGGAGGAGGG + Intronic
1077608348 11:3627329-3627351 CTGAGGATTCCCAGGGAGGCAGG - Intergenic
1078657186 11:13252671-13252693 GTGAGAATGGGAAGGGAGGATGG + Intergenic
1079280141 11:19079854-19079876 GTGAGGCTGGCAAAGGAGGAAGG - Intergenic
1080793979 11:35546440-35546462 GTGAGCAGCCCCAGGGAGGATGG - Intergenic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083326309 11:61874729-61874751 GTGAGCAGGGACAGGGAGGAGGG - Intronic
1083751778 11:64764984-64765006 GGCAGGATCGCCAGGACGGATGG + Exonic
1084271015 11:68029261-68029283 GTAAGTATTGCCAGGGAAGAAGG - Exonic
1084309783 11:68310297-68310319 GGGAGGATCACCAGGCATGATGG + Intergenic
1084431005 11:69111216-69111238 GTGAGGACCACCAGGAAGGAAGG + Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1089401400 11:118166584-118166606 GTGAGGGTCCCCAGAGAGAAGGG - Exonic
1089662151 11:119992746-119992768 ATGCTGAGCGCCAGGGAGGAGGG - Intergenic
1090097056 11:123752651-123752673 CTGAGCATTGCCAGGGAAGAAGG - Intergenic
1090394951 11:126412754-126412776 GTCAGGTTCTCCAAGGAGGAGGG + Intronic
1090619532 11:128548987-128549009 GGGAGGATTGCAGGGGAGGAAGG + Intronic
1093643544 12:21555807-21555829 ATGAGTATTGCCAGGGAAGAAGG - Intronic
1094415948 12:30215117-30215139 GTGAGGATTGTCAGGGACTATGG + Intergenic
1094582886 12:31750630-31750652 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1095858222 12:46885463-46885485 GTGAGGAACTACAGGGAGCAAGG - Intergenic
1096111075 12:49029508-49029530 GTGAGGGTGGCCAGGGCTGATGG + Intronic
1096792628 12:54054397-54054419 GTGGGGAGCGCTAGGGAAGAAGG - Intronic
1097029929 12:56082807-56082829 GTGAGGATTGCCATGGTGAAAGG + Intronic
1101863618 12:108503065-108503087 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1102492373 12:113297066-113297088 GTGAGCAGAGCCAGGGAGGGTGG - Exonic
1102863084 12:116353294-116353316 GAGAGGGTGGCCAGGGAGAAGGG - Intergenic
1102919031 12:116778081-116778103 GGGAGGAAAGGCAGGGAGGAAGG - Intronic
1103509079 12:121461801-121461823 GTGAGGATGTCCAGGGGGAATGG + Intronic
1104481677 12:129113281-129113303 TTGAGTATTGCCAGGGAAGAAGG - Intronic
1104611062 12:130228200-130228222 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1106822700 13:33483787-33483809 GTGAGTATTGCCAGGGAAGAGGG - Intergenic
1107303362 13:38991305-38991327 GTGAGGCTGGAAAGGGAGGAAGG - Intergenic
1107367653 13:39701533-39701555 GAGAGGATGGCCAGAGAGGCAGG + Intronic
1107879330 13:44819144-44819166 GTGATGCTGGCTAGGGAGGAAGG + Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1111201449 13:84943133-84943155 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1111723554 13:91976402-91976424 ATGAGTATTGCCAGGGAAGAAGG + Intronic
1112594313 13:100793966-100793988 GTGAGCTTCTCCAGGGAGGTAGG - Intergenic
1112792458 13:103017521-103017543 CTGAGGAAAGCCAGGTAGGAAGG + Intergenic
1112951921 13:105008741-105008763 GTGAGGACGGCCATGGAGCAGGG - Intergenic
1115285967 14:31712764-31712786 ATGAGTATTGCCAGGGAAGAAGG + Intronic
1116671323 14:47846296-47846318 GAGAGGAGCCCCTGGGAGGAGGG + Intergenic
1118226647 14:63906904-63906926 GTGAGGATAGACTGAGAGGATGG - Intronic
1118509177 14:66451421-66451443 GAGAGCAGAGCCAGGGAGGAAGG - Intergenic
1119765224 14:77183543-77183565 GTGAGCATAGCCAGGGAGTGGGG + Intronic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1121500281 14:94430408-94430430 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
1121685210 14:95830647-95830669 GTGAGGCTCGCCATGGAGACAGG + Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1122722064 14:103727711-103727733 GGGAGGATTGGCAGTGAGGAGGG - Intronic
1124119342 15:26875701-26875723 GGGAGCGTCGTCAGGGAGGAAGG + Intronic
1125364946 15:38903594-38903616 GTGAGGAATGCCTGGGAGGAGGG - Intergenic
1125609124 15:40958942-40958964 GTGAGGAGAGCCAGGGTGGAAGG + Intergenic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126619018 15:50617883-50617905 GAGTGGATCGCCAGAGAGAAGGG - Intronic
1126678788 15:51184471-51184493 GTGAGGACAGCCAGAGAGCATGG - Intergenic
1128231240 15:66036921-66036943 GGGAGGATCCCCAGGGAAGCAGG - Intronic
1128733290 15:70035062-70035084 ATGAGGAAGGCCATGGAGGAGGG - Intergenic
1130270812 15:82445906-82445928 GTGAGGCTTGCGTGGGAGGAGGG + Intergenic
1130463152 15:84173229-84173251 GTGAGGCTTGCGTGGGAGGAGGG + Intronic
1130489522 15:84421559-84421581 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1130501113 15:84500321-84500343 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131566847 15:93493631-93493653 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1132092414 15:98957107-98957129 CTGATGATCTCCAGGAAGGAAGG - Exonic
1132614336 16:832755-832777 CTGAGGATCCACAGGGTGGACGG - Intergenic
1133271474 16:4612809-4612831 GTGGGGGCCGCCAGGGAGGCTGG - Intronic
1133597185 16:7304130-7304152 GCGGGGAGAGCCAGGGAGGAGGG + Intronic
1134433673 16:14235438-14235460 TTGAGGATCGGCAGGGAAGGAGG - Intronic
1134560076 16:15201378-15201400 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1134887621 16:17807871-17807893 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1134920615 16:18112988-18113010 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1135947176 16:26875415-26875437 GTGAGCATTGCCAAGGAAGAAGG - Intergenic
1136350131 16:29701376-29701398 ATGAGTATCGCCAGGAAAGAAGG - Intergenic
1136866939 16:33766672-33766694 GAGAGGGCCGCCAGGGAGGCAGG - Intergenic
1137292587 16:47061918-47061940 GTGAGGAAAGCCAGGGAGCCAGG - Intergenic
1139354488 16:66359503-66359525 GTCAGGTTCTCCAGGGAAGAGGG - Intergenic
1139687614 16:68616590-68616612 GGCAGGATGGCCAGGGAGGGTGG + Intergenic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1140711756 16:77685416-77685438 GTGGGGACTGCCAGGAAGGAAGG + Intergenic
1141478934 16:84293429-84293451 GTGAGGGTCCCCAGGGAGGGAGG + Intergenic
1142003971 16:87680310-87680332 GTGACGATGGCCAGGGATGAAGG + Intronic
1203105223 16_KI270728v1_random:1349530-1349552 GAGAGGGCCGCCAGGGAGGCAGG + Intergenic
1203128291 16_KI270728v1_random:1612838-1612860 GAGAGGGCCGCCAGGGAGGCAGG - Intergenic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1146002400 17:29139247-29139269 GTGAGCATCCCCAGGGAAGGGGG - Intronic
1149093169 17:52808682-52808704 GTGAATATTGCCAGGGAAGAAGG + Intergenic
1149864871 17:60145765-60145787 GTGAGGAAAGCCAGGGCAGATGG + Intergenic
1151214887 17:72570723-72570745 GTGAGGTTCTCCATGCAGGACGG - Intergenic
1152341497 17:79728353-79728375 GAGAGGGCCGCCAGGGAGGCAGG - Intergenic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1157116485 18:44867214-44867236 GTGAGGATCACCTGGGTGGCTGG - Intronic
1157496714 18:48161838-48161860 GGGAGGGGCGCCCGGGAGGAGGG - Intronic
1157546112 18:48547614-48547636 GTGAAAATGGCCAGCGAGGAGGG - Intronic
1157833626 18:50879233-50879255 CTGAGCATCGCCAGGGCGGGCGG + Exonic
1158180988 18:54714704-54714726 GTGAGGATCGAAAGGGAAGTGGG - Intergenic
1158624036 18:59056572-59056594 GAGAGGATCGAGAAGGAGGATGG - Intergenic
1159188795 18:65015257-65015279 GTGAGTACTGCCAGGGAAGAAGG - Intergenic
1159512238 18:69410280-69410302 GTGAGGAACGCCCAGGCGGAAGG - Intronic
1161404029 19:4081888-4081910 GGGAGGAGGGGCAGGGAGGAGGG - Intergenic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161832938 19:6623018-6623040 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1162496235 19:11024797-11024819 GTGAGGAGAGCCAGGCAGGTGGG - Intronic
1163582328 19:18146073-18146095 GTGAGGGTGCCCAGGGAGAAGGG - Intronic
1165086468 19:33351526-33351548 CTGAGGATGGGCAGGGAGCAGGG + Intergenic
1165609357 19:37137120-37137142 TTGAGTATTGCCAGGGAGGCAGG - Intronic
1165810311 19:38607967-38607989 GTCAGGGACCCCAGGGAGGATGG - Intronic
1166439932 19:42804490-42804512 ATGAGCATTGCCAGGGAAGAAGG + Intronic
1166468454 19:43056025-43056047 ATGAGCATTGCCAGGGAAGAAGG + Intronic
1167707508 19:51090320-51090342 CTGAGGGTCGCCAGGGCAGAGGG + Intergenic
927476838 2:23420157-23420179 GTGAGGGTCGCTGGGCAGGAGGG - Intronic
929138612 2:38648052-38648074 GTGAGTATTGCCAGGGAAGAAGG + Intergenic
929446333 2:42004153-42004175 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
930315598 2:49793483-49793505 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
931372361 2:61675646-61675668 TTGAGTATTGCCAGGGAAGAAGG - Intergenic
935287423 2:101578099-101578121 GTGAGGAGAGACAGGGAGGAAGG + Intergenic
935332052 2:101984623-101984645 GTGCTGCTCGCCAGGGTGGAGGG - Intergenic
935794531 2:106628576-106628598 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
936145245 2:109976355-109976377 GTGAGGGTCACCTGGGATGATGG - Intergenic
936199440 2:110395123-110395145 GTGAGGGTCACCTGGGATGATGG + Intergenic
937494568 2:122403822-122403844 GTCAGGATGACCAGGGATGATGG + Intergenic
940075379 2:149735706-149735728 ATGAGTATCACCAGGGAAGAAGG + Intergenic
940493036 2:154389697-154389719 ATGAGTATTGCCAGGGAAGAAGG + Intronic
943443964 2:187959819-187959841 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
943451887 2:188052851-188052873 GTGAGTATTGCCAGGAAAGAAGG + Intergenic
946349163 2:219137194-219137216 ATGAAAATCTCCAGGGAGGAAGG - Intronic
946851280 2:223909342-223909364 GGGAGGCCAGCCAGGGAGGAGGG - Intronic
947030038 2:225782966-225782988 GGGAAGATAGCAAGGGAGGAAGG - Intergenic
947952034 2:234156404-234156426 ATGAGGATAGTCAGGGAGGCAGG + Intergenic
948107668 2:235428164-235428186 GGCAGGATCAGCAGGGAGGATGG + Intergenic
1170589424 20:17760610-17760632 GTGAGGATGGCCAGGAAGAGAGG + Intergenic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171993217 20:31712776-31712798 GTGTGTGTGGCCAGGGAGGAGGG + Intronic
1172766896 20:37355833-37355855 GTGTGGATAGCCATGGAGGTGGG + Intronic
1173441690 20:43083088-43083110 ATGAGTATTGCCAGGGAAGAGGG - Intronic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174085406 20:48004542-48004564 GTGAGGATGACAAGGGAAGAAGG + Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174133145 20:48359914-48359936 GTGAGGAACAGCAGGGAGGTGGG - Intergenic
1174564148 20:51452627-51452649 ATGAGGTTGGGCAGGGAGGACGG - Intronic
1175269715 20:57725305-57725327 ATGAGGCTGGCCAGGGAGCAGGG - Intergenic
1175531971 20:59680048-59680070 GAGAGGGAAGCCAGGGAGGAGGG - Intronic
1175856243 20:62122444-62122466 GAGAGGAGCGCGGGGGAGGAGGG - Intronic
1177879158 21:26671078-26671100 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179898700 21:44377774-44377796 GTGAGTATGGCCAGGTGGGAGGG + Intronic
1181437192 22:22917851-22917873 GTCAGGAATGCCAGGGAGGAAGG - Intergenic
1181811781 22:25407605-25407627 GGGAGGATCACCAGGCATGATGG - Intergenic
1183095252 22:35548093-35548115 GTGAGGAGGGACAGGGAGGTTGG + Intronic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1184356078 22:43980416-43980438 GTTAGGATGGTCAGGGAGGGTGG + Intronic
1184959338 22:47917807-47917829 GGGAGGAAGGACAGGGAGGAAGG - Intergenic
1185175089 22:49321838-49321860 GGGAGCATCGCCTGGGAGGCCGG + Intergenic
949134822 3:551688-551710 ATGAGTATTGCCAAGGAGGAAGG - Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
951330155 3:21357337-21357359 GTGAGCATGGCCAGGCTGGAGGG - Intergenic
953089689 3:39712662-39712684 GTGAGTATCGCCAGAAAAGAAGG + Intergenic
954850012 3:53592293-53592315 GTGAGGATAGCCAGGGCAGAGGG + Intronic
955499567 3:59570512-59570534 ATGAGGAGCGTGAGGGAGGAGGG - Intergenic
955923756 3:63985682-63985704 GTGAGGAGGGGCAGTGAGGATGG - Intronic
956161783 3:66362512-66362534 GTGAGGAAGGACAGGAAGGAGGG + Intronic
957620980 3:82593447-82593469 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
958893846 3:99808702-99808724 GTGAGCATCCCAAGGGAGCAAGG + Intergenic
959594046 3:108109444-108109466 GTGAGGGATGACAGGGAGGAGGG - Intergenic
960872716 3:122265924-122265946 GTGAGGACAGCCAGAGAAGATGG + Intronic
961315582 3:126033170-126033192 GGGAGGATTTCCAGGCAGGAAGG + Intronic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
961650794 3:128415837-128415859 GTGAGGAACTCCAGGAAGCAGGG - Intergenic
962128274 3:132645792-132645814 GATATGATTGCCAGGGAGGATGG - Intronic
962238245 3:133728063-133728085 TTAAGGATAGCCAGGGAGAAAGG - Intergenic
962353459 3:134673375-134673397 GAGCTGATGGCCAGGGAGGAGGG - Intronic
963179231 3:142336522-142336544 GTGAGGAGGGCATGGGAGGAGGG + Intronic
964751689 3:160059539-160059561 GTGAGCATTGCCAGAGAAGAAGG + Intergenic
964869616 3:161298992-161299014 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
965534853 3:169813179-169813201 ATGAGAATTGCCAGGGAGGAAGG + Intergenic
965962799 3:174448616-174448638 ATGAGTATTGCCAGGGAAGAAGG + Intronic
966071600 3:175885382-175885404 GAGAGGAGCCCCTGGGAGGAGGG - Intergenic
967003801 3:185363784-185363806 GTGAGGAACGGCAGAAAGGACGG - Intronic
969454176 4:7291754-7291776 GTGAGAATCACAAGGGAGCAGGG - Intronic
969476344 4:7424570-7424592 GTGAGGAGCGGCAAAGAGGAGGG - Intronic
969714817 4:8863378-8863400 GTGAGCAGCACCAGGGAGGCGGG - Intronic
970141493 4:12987278-12987300 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
972353103 4:38255711-38255733 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
972635469 4:40880105-40880127 GTGATGATCTCCAGTGCGGATGG + Intronic
972791981 4:42381503-42381525 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
973288891 4:48449788-48449810 GGGAGGAAAGGCAGGGAGGACGG - Intergenic
974799824 4:66802219-66802241 GCGAGTATTGCCAGGGAAGAAGG + Intergenic
978856162 4:113397286-113397308 GTGAGCAAAACCAGGGAGGAGGG + Intergenic
979552338 4:122005090-122005112 ATGAGGATCGAGATGGAGGAGGG - Intergenic
986631861 5:9781836-9781858 GTGAGGATAGGCAGGGATGATGG - Intergenic
987051941 5:14154239-14154261 GAGAGGCTGGCCAGGGAGGGAGG + Intronic
987284639 5:16443572-16443594 CTAATGATGGCCAGGGAGGAAGG - Intergenic
988566240 5:32321732-32321754 GTGAGTATTGCCAGGGAAGAAGG + Intergenic
990910351 5:60845301-60845323 GTCAGGACCACCAGAGAGGATGG + Intergenic
990965921 5:61447780-61447802 GTGAGTATTGCCAGGGAATAAGG + Intronic
994791518 5:104232600-104232622 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
996037626 5:118776169-118776191 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
996615119 5:125432203-125432225 TAGAGGCTCACCAGGGAGGAAGG - Intergenic
999773460 5:154792761-154792783 ATGAGGATTGCCAGCGAGGCGGG + Exonic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1000714240 5:164621473-164621495 GTGAGGAGCACAAGGGAGGTAGG - Intergenic
1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG + Intergenic
1001854247 5:174996947-174996969 TTGAGGATCAGCAGTGAGGAGGG + Intergenic
1001922254 5:175609942-175609964 GTGAGCAGGGCCTGGGAGGATGG - Intergenic
1002314348 5:178333637-178333659 ATGAGGAGCGCCAGGATGGAAGG - Intronic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1004887245 6:20062986-20063008 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1006370646 6:33641705-33641727 GTGAGGAATGGCAGGGAGGCTGG - Intronic
1006836668 6:37003012-37003034 GAGAGGAACACCAGGGAGGGAGG + Intergenic
1007335516 6:41152358-41152380 GGGAGGAGCGTCAGGGAGGCAGG - Intronic
1007751547 6:44074560-44074582 GTCAAGATCGCCGGGAAGGAAGG + Intergenic
1008204948 6:48643486-48643508 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1008982422 6:57500277-57500299 GTGAGGAACGGCTTGGAGGAGGG - Intronic
1010494438 6:76515800-76515822 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1011490028 6:87882191-87882213 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1012244581 6:96912244-96912266 GGGAGGAAAGCCAGTGAGGAGGG - Intergenic
1012311135 6:97725129-97725151 GTTAGGAAAGCTAGGGAGGAGGG + Intergenic
1013068365 6:106705323-106705345 CTGAGTATTGCCAGGGAAGAAGG + Intergenic
1014139893 6:117929271-117929293 ATGAGTATTGCCAGGGAAGAAGG - Intronic
1014154276 6:118093028-118093050 GTGAGGATGGCCAGGCACGGTGG + Intronic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1016127071 6:140416923-140416945 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1016200634 6:141403211-141403233 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1019196627 6:170286973-170286995 GTGAAGAGAGGCAGGGAGGAAGG + Intronic
1019479715 7:1260994-1261016 GTGGAGAACGCCAGGGAGGGAGG - Intergenic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1019748623 7:2714780-2714802 GTGAGACTCTCCATGGAGGAGGG + Exonic
1021562897 7:21986562-21986584 GTGAGAATTACCAGGGAGGAAGG - Intergenic
1021604333 7:22395111-22395133 CTGAGTATTGCCAGGGAAGAAGG - Intergenic
1022036414 7:26538551-26538573 GGGAGGAACTCCAGGGAGAATGG - Exonic
1022834279 7:34098761-34098783 GTGATCAAAGCCAGGGAGGAAGG + Intronic
1023396886 7:39759701-39759723 CTGAGGAAAGCCAGGAAGGATGG - Intergenic
1024291224 7:47805991-47806013 GAAAGGATCCCCAGGGAAGAGGG + Intronic
1024483000 7:49884330-49884352 TTGAGTATTGCCAGGGAAGAAGG + Intronic
1026900123 7:74032418-74032440 GTGAGGATCGCCACGGGGCCTGG + Intronic
1028684375 7:93575524-93575546 GAGAGGATGGCGAGGGAAGACGG + Intergenic
1028740910 7:94273999-94274021 ATGAGGATTGCCAGGAAAGAAGG + Intergenic
1031182545 7:118435901-118435923 GTGAGGGTTCCCAGGGAAGAGGG - Intergenic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1032960439 7:137027355-137027377 GTGAGGATGGAGAGGAAGGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1034317834 7:150150164-150150186 ATGAGTATTGCCAGGGAGGAAGG - Intergenic
1034774918 7:153817088-153817110 ATGAGTATTGCCAGGGAGGAAGG + Intergenic
1035076417 7:156180626-156180648 GTGAGCAGCCTCAGGGAGGAGGG + Intergenic
1035115200 7:156518019-156518041 GTGAGGAAGGCCCGTGAGGAAGG + Intergenic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1035701494 8:1642117-1642139 GTGAGGACCGGCAGGGTCGAGGG - Intronic
1035704066 8:1661441-1661463 GCGAGTATTGCCAGGGAAGAAGG + Intronic
1035746898 8:1967484-1967506 GTGGGGGTGCCCAGGGAGGAGGG - Intergenic
1036433700 8:8713396-8713418 GTGACGATAGCCAGGGGTGAAGG - Intergenic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037464003 8:19141201-19141223 CTGAGGATCCCCAGGAAGGGCGG + Intergenic
1038231751 8:25706898-25706920 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1038349042 8:26760004-26760026 CTGAGAGTCCCCAGGGAGGAAGG + Intronic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1040829536 8:51661752-51661774 GTGAGGAAAGCCAGAAAGGAAGG + Intronic
1040853396 8:51924904-51924926 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1040972700 8:53154363-53154385 GTGGGGAGAGCCAGGGAGCAGGG + Intergenic
1042781082 8:72491853-72491875 GTGTGGATCGAGAGGAAGGAAGG + Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1045057992 8:98385544-98385566 CTGAGGACCTCCAGGAAGGAGGG + Intergenic
1045531549 8:102989687-102989709 GTGAGTATTGCCAGAGAAGAAGG - Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048132228 8:131710570-131710592 CTGAGGATCTCCAGGTTGGATGG + Intergenic
1048848445 8:138621316-138621338 CAGAGGATCGCCAGTGAGGCTGG + Intronic
1053289143 9:36868539-36868561 GTGAGGATGGGGAGGGAGAAAGG + Intronic
1053314641 9:37041104-37041126 GTCATGAGAGCCAGGGAGGAGGG + Intergenic
1054887467 9:70214209-70214231 ATGAGGAGTGCCAGGGAAGAGGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1057395791 9:94678889-94678911 GTAAGTATTGCCAGGGAAGAAGG + Intergenic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1060150282 9:121284052-121284074 GGGAGGCTGGCCAGGGAGGGGGG + Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060468485 9:123929378-123929400 GTGTGGATGGCCGGGGAGGAAGG - Intronic
1060583333 9:124770930-124770952 GCGAGGGTCGGCAGAGAGGAGGG + Intronic
1060952457 9:127612676-127612698 AGGAGGATGGCGAGGGAGGAGGG - Intronic
1061558967 9:131390396-131390418 ATGAGGATGGTCAGGGAGGTAGG + Intergenic
1061887871 9:133601878-133601900 GGGAGGAGCCTCAGGGAGGAAGG + Intergenic
1061912969 9:133734697-133734719 GTGAGGCCGGGCAGGGAGGATGG + Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1185822547 X:3219334-3219356 TTGAGGACCGGCAGGCAGGATGG + Intergenic
1186057266 X:5663157-5663179 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1186661816 X:11675504-11675526 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1188908807 X:35820683-35820705 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1189534583 X:41923431-41923453 GCGAGGATCGCCGCGGAGGGAGG + Intronic
1189634952 X:42997205-42997227 ATGAGTATTGCCAGGGAAGAAGG - Intergenic
1192874089 X:75210439-75210461 GAGAGGATGGCTAGGGAGAAGGG + Intergenic
1193412100 X:81177025-81177047 ATAAGGGTAGCCAGGGAGGAAGG + Intronic
1194085095 X:89516510-89516532 GTTAGCATTGCCAGGGAAGAAGG - Intergenic
1195472449 X:105246392-105246414 ATGAGTATTGCCAGGGAAGAAGG + Intronic
1195795306 X:108641362-108641384 GTGAGGATCATCATGGTGGACGG + Intronic
1197179329 X:123517484-123517506 ATGAGTATTGCCAGGGAAGAAGG + Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1199788705 X:151129704-151129726 TTGAGTATTGCCAGGGAAGAAGG + Intergenic
1200437743 Y:3172394-3172416 GTTAGCATTGCCAGGGAAGAAGG - Intergenic
1202372041 Y:24205383-24205405 GTGAGGCTTGCGTGGGAGGAGGG - Intergenic
1202498744 Y:25464733-25464755 GTGAGGCTTGCGTGGGAGGAGGG + Intergenic