ID: 961379556

View in Genome Browser
Species Human (GRCh38)
Location 3:126488105-126488127
Sequence GGCTGAGGTTCCTGAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1158
Summary {0: 1, 1: 0, 2: 22, 3: 489, 4: 646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961379556_961379559 -6 Left 961379556 3:126488105-126488127 CCAGGACTTCAGGAACCTCAGCC 0: 1
1: 0
2: 22
3: 489
4: 646
Right 961379559 3:126488122-126488144 TCAGCCTGGCCCTGCCCCAAAGG 0: 1
1: 0
2: 3
3: 46
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961379556 Original CRISPR GGCTGAGGTTCCTGAAGTCC TGG (reversed) Intronic
900277704 1:1842859-1842881 GGCTTCGCTTCCTGAAGTCTGGG - Intronic
900840666 1:5046334-5046356 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
900847344 1:5114605-5114627 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
901039290 1:6354541-6354563 GGCTGGGGAGGCTGAAGTCCAGG + Intronic
901387698 1:8921915-8921937 GTCTGAGATTCCTCATGTCCAGG + Intergenic
901668403 1:10839397-10839419 GTCTGAGGTTCTTGCAGTGCTGG - Intergenic
902050740 1:13561998-13562020 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
902548180 1:17203486-17203508 GGCTGGGGTTCCTGCAGCCAGGG + Intergenic
903232573 1:21931044-21931066 CTCTGAGGTTCCTGCAGGCCTGG + Intronic
903396146 1:23003195-23003217 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
904063655 1:27730910-27730932 GGCTGAGCCTCCTAAAGTGCTGG + Intronic
904068420 1:27773364-27773386 GGATGATGCTGCTGAAGTCCCGG - Exonic
904393841 1:30204873-30204895 CTCTGAGGTGCCTGATGTCCAGG + Intergenic
904711516 1:32433798-32433820 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
904996589 1:34636168-34636190 GTCTGAGGTGCCTGACATCCAGG - Intergenic
905060643 1:35136551-35136573 GTCTGAGGTCCCTGACATCCAGG - Intergenic
905125962 1:35716366-35716388 GGGTGGGGTGCCTGAAGTCAGGG + Intronic
905344160 1:37300152-37300174 ATCTGTGGTTCCTGATGTCCAGG - Intergenic
905429154 1:37909133-37909155 GTCTGAGGTGCCTGACGTCCAGG + Intronic
905648428 1:39640273-39640295 GGCCGAGGTCCCTAAAGGCCTGG + Intergenic
905732620 1:40307092-40307114 AGCTGAGCCTCCTGAAGTGCTGG + Intronic
906049397 1:42858004-42858026 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
906080800 1:43086976-43086998 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
906744649 1:48213239-48213261 GTCTGAGGTGCCTGACGTTCAGG - Intergenic
907293471 1:53433705-53433727 GTCTGAGGTGCCTGATATCCAGG + Intergenic
907297342 1:53463762-53463784 AGCTGAGTTTCATGGAGTCCTGG - Intronic
907499065 1:54865276-54865298 GGCTTAGGTTTCTGTAGCCCTGG - Intronic
907521133 1:55024087-55024109 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
908461827 1:64354192-64354214 GTCTGAGGTGCCAGATGTCCAGG - Intergenic
908592071 1:65646108-65646130 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
908721640 1:67132268-67132290 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
908852286 1:68387752-68387774 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
909014590 1:70368836-70368858 GTCTGAGGTGCCTGATGTCCAGG + Intronic
909035349 1:70589795-70589817 GTCTGAGGTGCCTGACATCCAGG + Intergenic
909106210 1:71412132-71412154 GGCAGAGGTCCCTGAATGCCAGG - Intronic
909222770 1:72984041-72984063 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
909311088 1:74150263-74150285 GTCTGTGGTTCAAGAAGTCCAGG - Intronic
909551137 1:76899016-76899038 GTCTGAGGTGCCTGATGTCCAGG - Intronic
909776818 1:79492787-79492809 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
909788378 1:79642961-79642983 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
909793095 1:79700553-79700575 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
909909845 1:81246923-81246945 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
910002865 1:82359116-82359138 GTCTGAGGTTCCTGACATCCAGG - Intergenic
911070953 1:93831515-93831537 GTCTGAGGTGCCTGATGTCCAGG + Intronic
911148169 1:94571427-94571449 GTCTGAGATGCCTGACGTCCAGG - Intergenic
911510739 1:98805501-98805523 GTCTGAGGTGCCTGACATCCAGG - Intergenic
911570287 1:99511123-99511145 GTCTGAGGTGCCTGACATCCAGG + Intergenic
911759910 1:101602298-101602320 GTCTGAGGTGCCTGACATCCAGG - Intergenic
911983732 1:104597449-104597471 GTCTGAGGTGCCTGACATCCAGG + Intergenic
912296358 1:108474452-108474474 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
912813445 1:112810892-112810914 GTCTGAAGTGCCTGACGTCCAGG + Intergenic
912815440 1:112824756-112824778 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
913245014 1:116863589-116863611 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
914917553 1:151827843-151827865 GGCTGAGGTTTCTGAGGTCAGGG + Intronic
915214070 1:154328671-154328693 GGCTGCGGCTCCTGCAGTCGGGG + Intronic
915294740 1:154912085-154912107 GGCTGAGATTCCTGAGGTGGGGG - Intergenic
915321167 1:155057200-155057222 GGCTGCAGTTGCTGAAGTTCAGG - Exonic
916328739 1:163592500-163592522 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
916526859 1:165618399-165618421 GACTGAGGTGCCAGAATTCCAGG - Intergenic
917426355 1:174918682-174918704 GGCTGAGGTTGCTTGAGCCCAGG + Intronic
917869517 1:179229342-179229364 GGCTGAGGCTGCTGGAGCCCCGG + Exonic
917980513 1:180266274-180266296 GGGTGAGGCTCATGGAGTCCCGG + Intronic
918346995 1:183615134-183615156 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
918467954 1:184840876-184840898 GGCTGAGGTTATTGACATCCTGG + Intronic
918567793 1:185952524-185952546 GTCTGAGGTGCCTGACGTCCAGG - Intronic
918714524 1:187769705-187769727 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
919091053 1:192979376-192979398 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
919476279 1:198036279-198036301 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
920076503 1:203341168-203341190 GGCTGGGGTCCGTGAAGCCCAGG - Exonic
920105967 1:203553866-203553888 GCCTCAGCCTCCTGAAGTCCTGG - Intergenic
920427454 1:205889489-205889511 GTCTGAGGTGCCTGACATCCAGG - Intergenic
920829283 1:209450422-209450444 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
920901656 1:210115046-210115068 GTCTGAGATGCCTGATGTCCAGG - Intronic
920907888 1:210188762-210188784 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
921212298 1:212910991-212911013 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
921459897 1:215414167-215414189 GTCTGAGGTGCCTGACGTCGAGG - Intergenic
921509140 1:216009485-216009507 GTCTGAGGTGCCTGACGTCTAGG + Intronic
921520013 1:216147033-216147055 GCCTGAGGTGCCTGACATCCAGG + Intronic
921603855 1:217134950-217134972 GGGTCAGGTCCCTGAATTCCAGG - Intronic
921733089 1:218598016-218598038 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
921909110 1:220528392-220528414 GGCCGCGGTTCCTGACGCCCAGG + Intronic
922048299 1:221967457-221967479 GTCTGAGGTGCCTTATGTCCAGG + Intergenic
922049656 1:221977330-221977352 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
922154189 1:223028628-223028650 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
922363674 1:224844733-224844755 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
922598859 1:226834722-226834744 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
922845579 1:228681559-228681581 GTCTGAGGTGCCTTACGTCCAGG - Intergenic
922934705 1:229413885-229413907 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
923075093 1:230602740-230602762 GTCTGAGGTGCCTGACATCCAGG + Intergenic
923244634 1:232119664-232119686 GTCTGAGGTGCCTGACATCCAGG + Intergenic
923257391 1:232233427-232233449 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
923408742 1:233687657-233687679 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
923962665 1:239102827-239102849 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
924180538 1:241435460-241435482 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1062930634 10:1350210-1350232 GTCTGAAGTGCCTGACGTCCAGG + Intronic
1063106534 10:2997243-2997265 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1063362993 10:5472264-5472286 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1063509720 10:6633817-6633839 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1063527799 10:6801314-6801336 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1063598158 10:7456235-7456257 AGCTGAGTTTCCTGAAATCATGG + Intergenic
1064663932 10:17631037-17631059 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1064759243 10:18601731-18601753 GCCTCAGCTTCCCGAAGTCCTGG - Intronic
1065047539 10:21757765-21757787 GGCTGAGCTTCCTGCTGTCCCGG - Intronic
1065443314 10:25773431-25773453 GTCTGAGGTGCCTTACGTCCAGG - Intergenic
1066335626 10:34474685-34474707 GGCTCAGGAGCCTGAAGTCTTGG - Intronic
1066357140 10:34695735-34695757 GGCCGAGCTTCCTGAGATCCAGG + Intronic
1066357158 10:34695808-34695830 GGCTGAGCTTCCTGAGGGCCAGG + Intronic
1066437481 10:35407489-35407511 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1067145632 10:43691793-43691815 GGCTGCAGCCCCTGAAGTCCTGG + Intergenic
1067360262 10:45572591-45572613 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1067985685 10:51141121-51141143 GGCTGAGATTCCAGAAATCAGGG - Intronic
1068058466 10:52037988-52038010 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1068179773 10:53503259-53503281 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1068230855 10:54168241-54168263 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1068360660 10:55972665-55972687 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1068592456 10:58865224-58865246 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
1069236235 10:66077997-66078019 TGATGAGGTCACTGAAGTCCTGG - Intronic
1070474816 10:76820070-76820092 GTCTGAGGTGCCTGAAGTCCAGG + Intergenic
1070730353 10:78823367-78823389 GTCTGTGGGTCTTGAAGTCCTGG - Intergenic
1071550907 10:86565495-86565517 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1071767933 10:88689759-88689781 TGCTGAGCTTCCTGAAGTTGAGG - Intergenic
1071821610 10:89286139-89286161 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1071897848 10:90085265-90085287 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1071916091 10:90296505-90296527 GTCTGAGGTGCCTGACGGCCAGG + Intergenic
1071961003 10:90808929-90808951 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1072011398 10:91305739-91305761 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1072580145 10:96733713-96733735 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1072799512 10:98383418-98383440 GCCTGAACTTCCCGAAGTCCTGG + Intergenic
1073013762 10:100382115-100382137 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1074018900 10:109563807-109563829 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1074406422 10:113183727-113183749 GGGAGAGGTTCCTGAAAGCCTGG - Intergenic
1074550616 10:114438803-114438825 GACTGAGGTTCTTGAAATGCAGG + Intronic
1074740655 10:116482132-116482154 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1075248583 10:120846352-120846374 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1075534353 10:123257486-123257508 AACTGAGGTTCCTGAAGTGAAGG - Intergenic
1075743076 10:124707486-124707508 GCCTAAGCTTCCTGAAGTGCTGG - Intronic
1076144520 10:128106709-128106731 GTCTGAAGTCCCTGAAGACCTGG - Exonic
1076264553 10:129099442-129099464 GGCAGGGATTCCTCAAGTCCAGG + Intergenic
1076795544 10:132796439-132796461 GCCTGAGGTCCTGGAAGTCCTGG + Intergenic
1077188292 11:1245189-1245211 GCCTGAGGTGGCCGAAGTCCAGG - Exonic
1077189246 11:1248960-1248982 GCCTGAGGTGGCCGAAGTCCAGG - Exonic
1077589995 11:3483872-3483894 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1077612064 11:3649390-3649412 GTCTGAGGTGCCTGACGTCAAGG + Intronic
1077679241 11:4223846-4223868 ATCTGAGGTGCCTGACGTCCAGG - Intergenic
1077688675 11:4320488-4320510 ATCTGAGGTGCCTGATGTCCAGG - Intergenic
1077766507 11:5164541-5164563 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1077850907 11:6074063-6074085 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1077883227 11:6367268-6367290 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1078046241 11:7916387-7916409 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1079230403 11:18644492-18644514 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1079447348 11:20569290-20569312 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
1079454087 11:20622358-20622380 CTCTCAGGTTCCTGAAGTGCAGG + Intronic
1079672684 11:23188149-23188171 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1079727197 11:23891413-23891435 GTCTGAGGTGCCTGACGTCCCGG - Intergenic
1080028026 11:27633302-27633324 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1080227242 11:29974883-29974905 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1080994469 11:37582281-37582303 GTTTGAGGTGCCTGATGTCCAGG - Intergenic
1081159533 11:39735485-39735507 GTCTGAGGTAACTGATGTCCAGG + Intergenic
1081356697 11:42122078-42122100 GTCTGAGGTGCCTGAAGTCCAGG + Intergenic
1082197886 11:49325678-49325700 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1083534292 11:63454376-63454398 GTCTGAGGTTCCTGATGTCCAGG + Intergenic
1083721150 11:64604142-64604164 GGCTGAGGTTCCAGGCATCCTGG - Intergenic
1083958961 11:66003319-66003341 GGCTGGGATTGGTGAAGTCCTGG + Exonic
1084047043 11:66575076-66575098 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1084232179 11:67761170-67761192 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1084353931 11:68624346-68624368 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
1084355428 11:68635196-68635218 GTCTGAGGTTCCTGATGTCCAGG + Intergenic
1084613388 11:70218522-70218544 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1084826975 11:71738932-71738954 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1085455402 11:76662625-76662647 GGCTGGGGTTCCTGGAGGCCTGG - Intronic
1085622873 11:78050467-78050489 AGCTGAGCTTGCTGGAGTCCAGG + Intronic
1085967425 11:81544950-81544972 GGTTAAGGATCCAGAAGTCCTGG + Intergenic
1085987905 11:81807689-81807711 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1086004900 11:82026670-82026692 GTCTGAGGTGCTTGATGTCCAGG + Intergenic
1086125427 11:83344333-83344355 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1086133034 11:83420580-83420602 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1086550082 11:88044635-88044657 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1086657931 11:89382448-89382470 GTCTGAGGTGCCTGACATCCAGG + Intronic
1087127697 11:94643089-94643111 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1087196797 11:95311032-95311054 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1087225381 11:95592838-95592860 TGCAGAGGGTCCTGAAGCCCAGG + Intergenic
1087839657 11:102908314-102908336 GTCTGAAGTGCCTGATGTCCAGG - Intergenic
1087849886 11:103016029-103016051 AGCTGAGGATCTTGAAGTCTGGG - Intergenic
1089472205 11:118730389-118730411 GTCTGAGGTGCCTGACGTGCAGG - Intergenic
1089531311 11:119131684-119131706 CGCTGGGGTTCCTGAAGAGCTGG + Intronic
1089867176 11:121642185-121642207 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1089987317 11:122826106-122826128 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1090107715 11:123869836-123869858 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1090332525 11:125943024-125943046 GGCTGAGGTTCCAAAAGGGCTGG - Intergenic
1090363051 11:126186585-126186607 TGCTGAGGTGCCTTAAGCCCAGG + Intergenic
1090850714 11:130568574-130568596 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1090872070 11:130757717-130757739 TTCTGAGGTGCCTGACGTCCAGG - Intergenic
1090927071 11:131258722-131258744 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1091183545 11:133628271-133628293 GTCTGAAGTTCCTGATGTCCAGG + Intergenic
1091273931 11:134337420-134337442 GGCTGAAGTTCCTGGAGCCCGGG + Intronic
1091886393 12:4020018-4020040 ATCTGAGGTGCCTGACGTCCAGG + Intergenic
1092275867 12:7060637-7060659 GGCTGAGTTTCCCTAAGTCATGG + Intronic
1092416291 12:8292775-8292797 GTCTGAGGTGACTGATGTCCAGG - Intergenic
1092592867 12:9967305-9967327 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1092669928 12:10851448-10851470 GGCTGAGGAAACTGCAGTCCTGG + Intronic
1092723833 12:11466396-11466418 ATCTGAGGTGCCTGATGTCCAGG - Intronic
1092739442 12:11613921-11613943 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1092789597 12:12059899-12059921 GTCTGAGATGCCTGATGTCCAGG + Intronic
1092924967 12:13264182-13264204 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1093024208 12:14232048-14232070 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1093071279 12:14709095-14709117 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1093268125 12:17025909-17025931 GTCTGAGGTGCTTGATGTCCAGG - Intergenic
1093302110 12:17471054-17471076 GTCTGAGGTGTCTGATGTCCCGG + Intergenic
1093578700 12:20764880-20764902 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1093584635 12:20821210-20821232 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1093812968 12:23510269-23510291 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1093950953 12:25164627-25164649 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1094316179 12:29139262-29139284 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1094400546 12:30057450-30057472 GTCTGTGGTGCCTGACGTCCAGG + Intergenic
1095637538 12:44451275-44451297 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1096590747 12:52657664-52657686 AGCTGAGGTTCCTTAGGTTCTGG - Intergenic
1096673116 12:53211705-53211727 GGATGAGGTTCCTGGGGGCCAGG - Exonic
1097243888 12:57595168-57595190 CACGGAGGTTCCTGAAGACCTGG - Exonic
1097398469 12:59103340-59103362 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1097417169 12:59327440-59327462 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1097542313 12:60956221-60956243 GTCTGAGGTGCCTGATCTCCAGG - Intergenic
1097568974 12:61307866-61307888 TCCTGAGGTCCCTGAGGTCCAGG - Intergenic
1097694061 12:62760220-62760242 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1098173752 12:67770858-67770880 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1098402129 12:70086901-70086923 GTCTGAGGTGCCTGAAGTCCAGG + Intergenic
1098503038 12:71216637-71216659 TGCTAAGCTTCCTGAAGTTCTGG - Intronic
1098628948 12:72704836-72704858 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1098919785 12:76292919-76292941 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1099188594 12:79541354-79541376 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1099292215 12:80787303-80787325 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1099560742 12:84171489-84171511 GCCTGAGGTTCTTGAAGTCAGGG - Intergenic
1099695622 12:86015056-86015078 GCCTCAGCTTCCTGAAGTGCTGG + Intronic
1099836223 12:87911635-87911657 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1099977307 12:89559292-89559314 GCCTCAGCTTCCTAAAGTCCTGG + Intergenic
1100561226 12:95750575-95750597 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1100940179 12:99716661-99716683 GTCTGAGGTGCCTGACATCCAGG + Intronic
1101023557 12:100578080-100578102 GGCTGTGGTTCATGAAGAACAGG + Intronic
1101278511 12:103226904-103226926 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1102116929 12:110409913-110409935 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1102222381 12:111203293-111203315 GGCTCAGCCTCCTGAAGTGCTGG - Intronic
1102515598 12:113444256-113444278 GCCTGAGCTTCCTGGAGGCCTGG + Intergenic
1102962602 12:117102376-117102398 AGCTGAGCTTCAGGAAGTCCAGG + Intergenic
1103692920 12:122790451-122790473 GGCTGGTCTTCTTGAAGTCCTGG - Intronic
1103814944 12:123647218-123647240 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
1104339579 12:127935427-127935449 GCCTCAGCTTCCTAAAGTCCTGG - Intergenic
1104832380 12:131762294-131762316 GCCTGAGCCTCCTGAAGTGCTGG - Intronic
1105959472 13:25317242-25317264 AGATGAGGTTCCAGAAGTCATGG + Intronic
1106664248 13:31835182-31835204 GGCTGATGATCTTGAACTCCTGG + Intergenic
1106943328 13:34800146-34800168 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1107075463 13:36317930-36317952 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1107220410 13:37973412-37973434 GTCTGAGGTGCCTGACGTCTAGG - Intergenic
1107683260 13:42871639-42871661 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1108202577 13:48057865-48057887 GTCCGAGGTGCCTGACGTCCAGG + Intronic
1108512874 13:51171353-51171375 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1108803991 13:54131927-54131949 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1108913531 13:55582471-55582493 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1108919663 13:55659200-55659222 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1108947316 13:56041798-56041820 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1108953064 13:56116644-56116666 GTCTGAGGTGCCTGACGTCTAGG - Intergenic
1109499174 13:63214609-63214631 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1109709776 13:66145563-66145585 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1109716865 13:66230600-66230622 GTCTGAGGTTCCTGACGTCCAGG - Intergenic
1109870132 13:68322826-68322848 GGCAGAGGTGCCTGAGGTCATGG - Intergenic
1110549120 13:76792107-76792129 GCCTCAGCCTCCTGAAGTCCTGG + Intergenic
1110765349 13:79275620-79275642 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1110978361 13:81867625-81867647 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1111126156 13:83912492-83912514 GTCTCAGGTGCCTGACGTCCAGG - Intergenic
1111301931 13:86359894-86359916 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1111362243 13:87190701-87190723 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1111458958 13:88517034-88517056 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1111630331 13:90840946-90840968 ATCTGAGGTGCCTGACGTCCAGG + Intergenic
1111631819 13:90852793-90852815 ATCTGAGGTGCCTGACGTCCAGG - Intergenic
1112236712 13:97643808-97643830 GTCTGAAGTGCCTGATGTCCAGG + Intergenic
1112889438 13:104212291-104212313 GTCTGAGGTGCTTGATGTCCAGG - Intergenic
1113324222 13:109266845-109266867 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1114040491 14:18673903-18673925 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
1114045528 14:18872416-18872438 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
1114118684 14:19647052-19647074 GCCTCAGCTTCCTGAAGTGCTGG + Intergenic
1114221558 14:20702023-20702045 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1115231599 14:31166599-31166621 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
1115240711 14:31249514-31249536 GTCTGAGGTACCTGAAGTCCAGG - Intergenic
1115904691 14:38192277-38192299 GTCTTAGGTGCCTGACGTCCAGG + Intergenic
1116179561 14:41517443-41517465 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1116490716 14:45499641-45499663 GTCTGACGTGCCTGACGTCCAGG - Intergenic
1116534897 14:46016629-46016651 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1116573340 14:46545428-46545450 ATCTGAGGTGCCTGACGTCCAGG + Intergenic
1116613394 14:47105659-47105681 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1116702521 14:48259621-48259643 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1116703410 14:48266597-48266619 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1116952798 14:50894672-50894694 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1117095086 14:52289081-52289103 GTATGAGGAACCTGAAGTCCTGG + Intergenic
1117115009 14:52502199-52502221 GGCAGAGGCTCCAGAAGCCCCGG - Intronic
1117174040 14:53129911-53129933 GTCTGAGGTGCCCGACGTCCAGG + Intronic
1118247317 14:64123953-64123975 GCCTCAGGCTCCTGAAGTGCTGG - Intronic
1118937420 14:70300416-70300438 GTCTGAGGTGCCTTATGTCCAGG - Intergenic
1119022305 14:71125780-71125802 GTCTGAAGTGCCTGACGTCCAGG + Intergenic
1119089705 14:71770382-71770404 GGCTGAGCTTCCTAAAGTCAGGG - Intergenic
1119248520 14:73132891-73132913 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1119317080 14:73704978-73705000 GTCTGAGTTGCCTGACGTCCAGG + Intergenic
1119329431 14:73783227-73783249 GGGTGATGTTGCTGGAGTCCCGG + Intronic
1119560449 14:75585259-75585281 GTCTGAGGTGCCTGACATCCAGG - Intronic
1119713958 14:76845072-76845094 GCCTCAGGCTCCTGAAGTTCTGG - Intronic
1120181054 14:81342724-81342746 GGTAGAGGATCCTGGAGTCCCGG + Intronic
1120251510 14:82065317-82065339 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1120539681 14:85737210-85737232 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1120660077 14:87239249-87239271 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1120725564 14:87936074-87936096 GGCTGGGGTGGCTGAAGTCTGGG - Intronic
1121415678 14:93777789-93777811 GGCTGAGATTCCAGAGGGCCAGG + Intronic
1121980702 14:98451381-98451403 GCCTGAGGTGCCTGACGTCTAGG - Intergenic
1122040877 14:98986686-98986708 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1122381456 14:101309905-101309927 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1122507510 14:102241087-102241109 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1122830347 14:104392781-104392803 GGCTGTGGTTCCCGAGGGCCTGG + Intergenic
1123117044 14:105899527-105899549 CCCTGAGGTTCCTGCAGCCCAGG - Intergenic
1123470022 15:20543121-20543143 GGCAGAGGTTCCTGAGCACCTGG - Intergenic
1123648033 15:22457576-22457598 GGCAGAGGTTCCTGAGCACCTGG + Intergenic
1123730316 15:23138117-23138139 GGCAGAGGTTCCTGAGCACCTGG - Intergenic
1123748454 15:23335535-23335557 GGCAGAGGTTCCTGAGCACCTGG - Intergenic
1123882607 15:24689776-24689798 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1124280832 15:28359412-28359434 GGCAGAGGTTCCTGAGCACCTGG - Intergenic
1124301872 15:28552213-28552235 GGCAGAGGTTCCTGAGCACCTGG + Intergenic
1124562673 15:30790026-30790048 GGCAGAGGTTCCTGAGCACCTGG + Intergenic
1125045659 15:35240271-35240293 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1125131631 15:36289866-36289888 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1125213341 15:37240441-37240463 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1125848973 15:42886006-42886028 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1125890269 15:43260442-43260464 AGCTCCGGTTCCTGAAGTACAGG + Exonic
1126530274 15:49703371-49703393 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1126843626 15:52740074-52740096 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1126912516 15:53431045-53431067 GTCTGAGGTGCCTGACGTTCAGG - Intergenic
1127718784 15:61679218-61679240 GGCTGAGTTTCATGAATTCATGG - Intergenic
1128309495 15:66621633-66621655 GGGTGGGGTTCCGGAAATCCAGG - Intronic
1128634893 15:69296905-69296927 AGCATAGATTCCTGAAGTCCTGG + Intergenic
1128875598 15:71198699-71198721 AGCTGGGGTTCCTGAATGCCAGG - Intronic
1129645750 15:77430456-77430478 GGTTGTGGTTTCTTAAGTCCTGG - Intronic
1130304430 15:82703682-82703704 GTCTGAGGTGCCTGATGTCCAGG + Intronic
1130823696 15:87521535-87521557 AGCTGAAGTTCCTTAATTCCTGG - Intergenic
1130854999 15:87832759-87832781 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1130947593 15:88560700-88560722 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1131164737 15:90134258-90134280 GTCTGAGATGCCTGATGTCCAGG + Intergenic
1131391930 15:92056799-92056821 TCCTGAGGATCCTGAAGTCCAGG - Intronic
1131447618 15:92512991-92513013 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1131684058 15:94752227-94752249 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1131882628 15:96876042-96876064 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1132262895 15:100441759-100441781 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1132340289 15:101074027-101074049 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1132384562 15:101390800-101390822 GGCTGAGGCTCCTGGACTTCTGG + Intronic
1132511428 16:343776-343798 GGCTGAGATCACTGGAGTCCAGG + Intronic
1133606349 16:7391877-7391899 GGCTGAGATTCCTGAGGTAAGGG + Intronic
1133651276 16:7816189-7816211 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
1133765848 16:8837221-8837243 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1133766838 16:8844029-8844051 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1133938053 16:10284615-10284637 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1134086553 16:11361441-11361463 GTCTGAGGGTCCTGTAGTCATGG + Intronic
1134342300 16:13356791-13356813 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1135025528 16:18996368-18996390 GTCTGAGGTGCCTGACATCCAGG - Intronic
1136111842 16:28068313-28068335 GCCTCAGCTTCCTAAAGTCCTGG - Intergenic
1136546230 16:30956719-30956741 GGCTGAGGTTTCTGAAGGCTGGG - Intergenic
1137363312 16:47839984-47840006 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1137782984 16:51113746-51113768 GGCTGAGGCTCGAGAAGTCGAGG + Intergenic
1138804824 16:60080320-60080342 GTCTTAGGTGCCTGACGTCCAGG + Intergenic
1139039350 16:62983378-62983400 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
1139179655 16:64731598-64731620 TGCTGAGTTTCCTAAAGGCCTGG - Intergenic
1139943165 16:70620672-70620694 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1139943833 16:70624993-70625015 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1141096910 16:81169505-81169527 GCCTCAGGCTCCTGAAGTGCTGG + Intergenic
1141865332 16:86746247-86746269 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1142324710 16:89407083-89407105 GGCTGAGGCTGGTGAAGCCCAGG + Intronic
1142666687 17:1467614-1467636 GGCGGGGGTTCCTCAAGTTCTGG - Intronic
1143194216 17:5063207-5063229 ACCTGAGCTTCCCGAAGTCCTGG + Intergenic
1143414510 17:6736190-6736212 GTGTGAGGTGCCTGACGTCCAGG - Intergenic
1144104558 17:11973421-11973443 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1146597780 17:34184762-34184784 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1147023343 17:37557751-37557773 GGCTGAGGCTGCTTGAGTCCAGG + Intronic
1147157473 17:38551434-38551456 GGCTGAGGCCCCAGAGGTCCTGG - Intronic
1147364234 17:39950143-39950165 GGCTGAGGTTTTGGATGTCCAGG - Intergenic
1148125989 17:45237217-45237239 GGCGTGGGTGCCTGAAGTCCTGG + Intronic
1149319401 17:55468952-55468974 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1150282895 17:63939827-63939849 GGATGAGGCTCCTGGAGCCCTGG + Exonic
1150310156 17:64121734-64121756 GCCTCAGCTTCCTGAAGTGCTGG + Intronic
1150645310 17:66974221-66974243 CGCTGAGCTTCCTGGAGGCCAGG + Intronic
1150860611 17:68796843-68796865 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1151700662 17:75740895-75740917 GGCTTCGGCTCCTGGAGTCCCGG - Intronic
1151839877 17:76610162-76610184 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1152094188 17:78263596-78263618 GGCTCTGCTTCCTGGAGTCCAGG + Intergenic
1152271471 17:79327376-79327398 GGGTGAATTTCCTGATGTCCAGG - Intronic
1152453773 17:80401012-80401034 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
1152474757 17:80510737-80510759 GGCTGAGGTTCCTGTTGGACTGG + Intergenic
1152698054 17:81806082-81806104 GGCTGAGGCTGCTGTGGTCCTGG - Intronic
1152749978 17:82058173-82058195 GGCTGAGGCTCCTGCAGCTCAGG + Exonic
1152879163 17:82805532-82805554 GGCAGAGGGTCCCGAAGGCCGGG + Intronic
1153153870 18:2127240-2127262 GGCTGAGGCTGCTGAAGTAGAGG - Intergenic
1154189484 18:12216976-12216998 ATCTGTGGTTCCTGAGGTCCAGG - Intergenic
1154412938 18:14151096-14151118 GGCAGAGGATCCTGGAGGCCTGG - Intergenic
1155089616 18:22493912-22493934 GACTGAGTTTCAGGAAGTCCAGG + Intergenic
1155173699 18:23285526-23285548 GTCTGAGGTGCATGACGTCCAGG + Intronic
1155437483 18:25828109-25828131 GGCTGAGCTGCCTGGAGGCCTGG - Intergenic
1155587299 18:27381389-27381411 GGGTGAGGTTACTGAAGACTTGG + Intergenic
1155892819 18:31288485-31288507 GTCTGAGGTGACTGACGTCCAGG - Intergenic
1155941424 18:31805263-31805285 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1155961829 18:32001738-32001760 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1156087650 18:33426156-33426178 ACCTCAGGTTCCTGAAGTGCTGG + Intronic
1156229367 18:35139009-35139031 TGCTGAGGTTACTGAGGTCAGGG - Intronic
1156237235 18:35217242-35217264 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1156252052 18:35360554-35360576 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1156302129 18:35845357-35845379 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1156915693 18:42463005-42463027 GTCTGAGCTGCCTGATGTCCAGG + Intergenic
1156923263 18:42548667-42548689 GGCTGTGGTTCATGAAGAGCTGG + Intergenic
1156924174 18:42556734-42556756 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1156938407 18:42738112-42738134 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1156958062 18:42992362-42992384 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1157722630 18:49937120-49937142 GGCTGAGGCTACTGATGTCAAGG + Intronic
1157906521 18:51574295-51574317 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1158336263 18:56417094-56417116 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1158394764 18:57070851-57070873 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1158576821 18:58645210-58645232 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1159164346 18:64683120-64683142 GTCTGAGGTGTCTGACGTCCAGG + Intergenic
1159834933 18:73326136-73326158 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1159929101 18:74293939-74293961 GTCTGAGGTTCCTGACATCCAGG + Intergenic
1160043976 18:75370004-75370026 GGCTGTCTTTCATGAAGTCCTGG + Intergenic
1160159562 18:76460931-76460953 GCCTCGGGTTCCTAAAGTCCTGG - Intronic
1161045554 19:2132560-2132582 GGCTGGGGCTGCTCAAGTCCTGG + Exonic
1161656047 19:5515611-5515633 GCTTTTGGTTCCTGAAGTCCAGG - Intergenic
1161711092 19:5848539-5848561 GTCTGAGGTGCCTGACGTTCAGG + Intronic
1161711860 19:5853254-5853276 GTCCGAGGTGCCTGACGTCCAGG + Intergenic
1162212561 19:9104134-9104156 GCCTCAGGCTCCCGAAGTCCTGG + Intergenic
1162274347 19:9640973-9640995 GTCTGAGATGCCTGATGTCCAGG - Intronic
1162355829 19:10184232-10184254 AGCTGATGTTCCTAAAGGCCTGG + Intronic
1162942597 19:14022158-14022180 GCCTCAGCTTCCTGAAGTCCTGG + Intergenic
1163239645 19:16052641-16052663 GGCTGAGGTTGCAGAAGACATGG - Intergenic
1163487160 19:17594882-17594904 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1163900402 19:20095223-20095245 GTCTGAGGTGCCTTACGTCCAGG - Intronic
1163906918 19:20156064-20156086 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1164004205 19:21134019-21134041 GTCTGAAGTGCCTGACGTCCAGG - Intergenic
1164152853 19:22569727-22569749 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1164202615 19:23031043-23031065 ATCTGAGGTGCCTGATGTCCAGG - Intergenic
1164922631 19:32100833-32100855 GGCTCAGCCTCCTGAAGCCCAGG + Intergenic
1165205173 19:34177909-34177931 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
1165249106 19:34515439-34515461 GTCTGAGGTGCTTGATGTCCAGG + Intergenic
1165497119 19:36159609-36159631 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1166499053 19:43327697-43327719 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1166685478 19:44793784-44793806 GGCTGGGGGTCCTGGACTCCTGG + Intronic
1166736715 19:45090219-45090241 GCCAGAGGTTCCTGAAATCCAGG + Exonic
1166905922 19:46108304-46108326 GTCTGAGATGCCTGATGTCCAGG - Intergenic
1166916995 19:46202217-46202239 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1166927266 19:46277581-46277603 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1167046716 19:47053958-47053980 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1167099295 19:47394165-47394187 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1167366741 19:49058494-49058516 GGAGGAGGGTCCTGGAGTCCTGG - Exonic
1167855805 19:52238777-52238799 GCCTCAGCCTCCTGAAGTCCTGG + Intergenic
1167900939 19:52621870-52621892 GTCTGAGGTGCCTTATGTCCAGG + Intronic
1167902029 19:52629256-52629278 GTCTGAGGTGCCTGACATCCAGG + Intronic
1168051471 19:53832766-53832788 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1168095467 19:54112159-54112181 GGCTGAGATTGCTAGAGTCCAGG + Intronic
1168137420 19:54360719-54360741 TGCTTAGGTTCCTGGAGCCCTGG - Intronic
1168149205 19:54435904-54435926 GGCGGGGGGTCCTGAACTCCTGG + Intronic
1168212238 19:54899136-54899158 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1168228097 19:55010984-55011006 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1168248009 19:55123997-55124019 GTCTGAGGTACCTGATATCCAGG + Intergenic
925433970 2:3820132-3820154 GTCTGAGGTGCCTGACGTCCAGG - Intronic
925544434 2:5002468-5002490 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
925840002 2:7982519-7982541 GGCTCAGTTTCCTGCAGTTCAGG - Intergenic
925849703 2:8068502-8068524 GGCTGAGTTTCCTCCAGGCCAGG + Intergenic
926407659 2:12571261-12571283 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
926413481 2:12628005-12628027 GTCTGAGATGCCTGACGTCCAGG + Intergenic
926464202 2:13168196-13168218 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
926815667 2:16796163-16796185 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
927134042 2:20083789-20083811 GTCTGAGGTGCCTGATGTCTAGG + Intergenic
928569245 2:32586666-32586688 GCCTCAGCCTCCTGAAGTCCTGG + Intronic
928770056 2:34695327-34695349 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
928778179 2:34791185-34791207 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
928857045 2:35814556-35814578 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
928914747 2:36458694-36458716 GACTGATGTTCCTGAAGGACAGG + Intronic
928928443 2:36600527-36600549 GTCTGAGGTGCCTTACGTCCAGG + Intronic
929004954 2:37385211-37385233 GTCTGAGGTGCCTAACGTCCAGG - Intergenic
929076797 2:38084978-38085000 GTCTGAGGTGCCTGACATCCAGG - Intronic
929684654 2:44023288-44023310 GTCTGAGGTGCCTGACATCCAGG - Intergenic
930099244 2:47590280-47590302 GTCTGAGGTGCCTTATGTCCAGG - Intergenic
930487488 2:52026351-52026373 GTCTGAGATGCCTGACGTCCAGG - Intergenic
930954983 2:57194471-57194493 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
930958259 2:57230348-57230370 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
931026508 2:58117619-58117641 GTCTGAGGTGCCTGACGTCCAGG - Intronic
931042566 2:58315597-58315619 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
931177448 2:59868270-59868292 GGGTTAGGTTCCTGCAGCCCTGG - Intergenic
931204913 2:60137589-60137611 GTCTGAGGTTCCTGGCGTCATGG - Intergenic
931236826 2:60419128-60419150 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
931609051 2:64079425-64079447 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
931625659 2:64254035-64254057 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
931850307 2:66245431-66245453 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
931948144 2:67333080-67333102 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
932088492 2:68783710-68783732 GCCTCAGCTTCCTGAAGTGCTGG + Intronic
932159585 2:69447911-69447933 GTCTGAGGTGCCTGATATCCAGG - Intergenic
932295739 2:70622122-70622144 GTCTGAGGTGCCTGACGTCCAGG + Intronic
932358933 2:71089251-71089273 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
932367760 2:71163890-71163912 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
932505104 2:72221627-72221649 GGCTGAGATTCCTGACCTCATGG - Intronic
932854327 2:75218012-75218034 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
932974066 2:76578074-76578096 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
933012977 2:77089865-77089887 GTCTGAGGTGCCTGATGTCCAGG + Intronic
933079159 2:77966611-77966633 GTCTGAGGTGCCTGACATCCAGG + Intergenic
933163613 2:79052875-79052897 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
933179882 2:79216052-79216074 GTCCGAGGTGCCTGACGTCCAGG - Intronic
933329635 2:80878672-80878694 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
933552516 2:83793138-83793160 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
935098983 2:99974279-99974301 TGCTGAGGTTTCCGAAGTCTAGG - Intronic
935218141 2:100990593-100990615 GGCTTGGGATCCTGAGGTCCAGG + Intronic
935593633 2:104863372-104863394 GGCTCAGGTTCCAGAGGTTCTGG + Intergenic
936794414 2:116188468-116188490 GTCTGAGATGCCTGATGTCCAGG - Intergenic
936883224 2:117280244-117280266 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
939083263 2:137687191-137687213 GTCTGAGGTGCCTGACATCCAGG - Intergenic
939307285 2:140427619-140427641 GTCTGAGGTGCCTGATATCCAGG + Intronic
940107222 2:150114066-150114088 GTCTGAGATGCCTGAAGTCCAGG + Intergenic
940182823 2:150954512-150954534 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
941229810 2:162897807-162897829 GGCTGAGGCTGCTGAAATTCTGG - Intergenic
941340288 2:164297356-164297378 GTCTGAGGTGCCTGACATCCAGG + Intergenic
941353272 2:164460617-164460639 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
941456312 2:165714717-165714739 GTCTGAGGTGCCTTATGTCCAGG - Intergenic
941966288 2:171304158-171304180 GCCTCAGGCTCCTCAAGTCCTGG - Intergenic
942096968 2:172543214-172543236 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
942413223 2:175733303-175733325 GGCTGAGGTTACTGAGGCTCAGG - Intergenic
942551001 2:177119227-177119249 GCCTTAGCTTCCTGAAGTGCTGG - Intergenic
943061456 2:183045360-183045382 GTCTGAGATGCCTGATGTCCAGG + Intergenic
943331239 2:186561729-186561751 GGCTGAACTTCCTGGAGTCGGGG - Intergenic
943413048 2:187564700-187564722 GTCTGAGGTGCCTGACGTCTAGG - Intronic
943421696 2:187674676-187674698 GTCTGAGGTGCCTGACGTACAGG - Intergenic
943450005 2:188034692-188034714 GTCTGAGGTGCCTGACATCCAGG + Intergenic
943460298 2:188165101-188165123 GTCTGAGTTGCCTGACGTCCAGG - Intergenic
943461314 2:188173438-188173460 GTCTGAGGTGCCTGACATCCAGG - Intergenic
943806531 2:192131923-192131945 GTCTGAGGTGCCTGACGTCCAGG + Intronic
943835031 2:192507526-192507548 GTCTCAGGTGCCTGACGTCCAGG + Intergenic
943865240 2:192919548-192919570 GTCTGAGGTGGCTGATGTCCAGG + Intergenic
944250902 2:197579575-197579597 GTCTGAGATGCCTGACGTCCAGG + Intronic
944387327 2:199180860-199180882 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
944394017 2:199248414-199248436 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
944876238 2:203966129-203966151 GTCTGAGGTGGCTGACGTCCAGG - Intergenic
945153221 2:206811063-206811085 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
945173335 2:207018710-207018732 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
945301605 2:208220494-208220516 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
945361528 2:208900723-208900745 GTCTGAGGTGCCTGACATCCAGG + Intergenic
945375989 2:209079564-209079586 GTCTGAGGTGCCTGACGTCTAGG + Intergenic
945394189 2:209300727-209300749 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
945554580 2:211262962-211262984 ATCTGAGGTGCCTGATGTCCAGG + Intergenic
945564791 2:211383803-211383825 GGCTGTGGTTCCAGTAGTCAGGG + Exonic
945857998 2:215091045-215091067 GTCTGAGGTGCCTGACGTCCAGG + Intronic
945938194 2:215923860-215923882 GTCTAAGGTGCCTGACGTCCAGG + Intergenic
946215151 2:218178238-218178260 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
946229879 2:218284643-218284665 GGCTGAGGTACCCGAAGGACTGG - Intronic
946781163 2:223194074-223194096 GTCTGAGGTGCCTGATGTCCAGG - Intronic
946886374 2:224226775-224226797 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
946893159 2:224298175-224298197 GTCTGAGGAGCCTGACGTCCAGG + Intergenic
947416806 2:229905023-229905045 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
947508098 2:230725313-230725335 GGCTGGGATTGGTGAAGTCCTGG - Intronic
947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG + Intronic
948390564 2:237608444-237608466 ATCTGAGGTGCCTGACGTCCAGG + Intergenic
1168839148 20:898000-898022 GTCTGAGGTGCCTGATGTCCAGG + Intronic
1168943451 20:1732340-1732362 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1169405210 20:5316466-5316488 GGCTTAGATCCCTGCAGTCCCGG - Intergenic
1169848661 20:10025481-10025503 GGAAGAGGTTCCTGATTTCCAGG + Intronic
1170045927 20:12085238-12085260 GGCAAAGGATCCTGGAGTCCTGG - Intergenic
1170068978 20:12344485-12344507 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1170084995 20:12520333-12520355 GTCTGGGGCTCCTGAAGTGCTGG + Intergenic
1170106118 20:12755373-12755395 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1170325605 20:15152068-15152090 GTCTGAGATGCCTGACGTCCAGG - Intronic
1170680562 20:18521859-18521881 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1170820821 20:19755335-19755357 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1170877984 20:20268301-20268323 TGCTGATGTTACTGAAGCCCAGG + Intronic
1172494693 20:35371754-35371776 GCCTCAGCTTCCTGAAGTGCAGG - Intronic
1173118754 20:40270561-40270583 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1173502875 20:43566389-43566411 GGCAGTGGTGCCTGAAGCCCTGG + Exonic
1174257825 20:49271463-49271485 GTCTGCGGTTCCTACAGTCCTGG + Exonic
1174321817 20:49747996-49748018 GGCAGAGCTTCCTGGAATCCAGG + Intergenic
1175235591 20:57508481-57508503 GACAGATGCTCCTGAAGTCCTGG + Intronic
1175278342 20:57787128-57787150 GTCTGAGGTGGGTGAAGTCCAGG - Intergenic
1175890821 20:62315154-62315176 GGCTGTGGCTGCTGAAGCCCAGG - Exonic
1176860072 21:14007156-14007178 GGCAGAGGATCCTGGAGGCCTGG + Intergenic
1177031301 21:15984044-15984066 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1177100506 21:16893657-16893679 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1177119446 21:17122955-17122977 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1177639166 21:23824285-23824307 GCCTCAGGTTCCTAAAGTGCTGG + Intergenic
1177894322 21:26843132-26843154 GTCTGAGATTCCTTAAGGCCCGG - Intronic
1178001077 21:28162653-28162675 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1178100786 21:29266461-29266483 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
1178567771 21:33703931-33703953 GGCTGAGCTTCCTGCACTCCTGG + Intronic
1178750633 21:35299484-35299506 AGCTGAGGTCCCTGCACTCCAGG + Intronic
1178914902 21:36700713-36700735 GGCTGGGGTGCGGGAAGTCCGGG + Intronic
1179015406 21:37591253-37591275 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1179212133 21:39333847-39333869 GGCTGAGGCTCCTTAAGCCCAGG + Intergenic
1179387436 21:40956438-40956460 GTCTGAGATGCCTGATGTCCAGG + Intergenic
1179650493 21:42805283-42805305 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1180175617 21:46085746-46085768 GGGGGAGGGTCCTGGAGTCCTGG - Intergenic
1180464059 22:15595033-15595055 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
1180560779 22:16612749-16612771 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
1180982548 22:19885611-19885633 GGCTGTGGTCCCTGCAGGCCGGG + Intronic
1182113828 22:27743478-27743500 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1182128181 22:27831526-27831548 AGCTGAGGTTCCTGAAGCATGGG + Intergenic
1182732161 22:32504291-32504313 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1182741760 22:32572777-32572799 AGCTGGAGTTGCTGAAGTCCTGG - Intronic
1183291462 22:37004235-37004257 GGCAGAGGCTGCAGAAGTCCAGG - Intronic
1183635789 22:39061743-39061765 GTCTGAGGTATCTGATGTCCAGG - Intronic
1183689684 22:39381758-39381780 GGCTGGGGTCCATGTAGTCCTGG - Exonic
1184593077 22:45498763-45498785 GCCTGAGATTCTTGCAGTCCAGG - Intergenic
1184830790 22:46985032-46985054 GGCAGAGGCTCCTGAACTCATGG - Intronic
1185087472 22:48748693-48748715 AGCTGCGGTTCCTGAGCTCCTGG - Intronic
1185254597 22:49825341-49825363 GGCTCAGGTGCCTGAAGACTTGG + Intronic
1185348323 22:50320331-50320353 GCCTGAGCCTCCTGAAGTGCTGG + Intronic
949162220 3:894898-894920 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
949190511 3:1244000-1244022 GTCTGAGGTGCCTTACGTCCAGG - Intronic
949253787 3:2020384-2020406 GGCTCAGCCTCCTGAAGTGCTGG + Intergenic
949671032 3:6399143-6399165 GTCTGAGGTGCCTGACATCCAGG + Intergenic
949827319 3:8178506-8178528 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
950121683 3:10485944-10485966 GGCTGAGTTTCATGATGCCCTGG - Intronic
950426223 3:12926059-12926081 GCCTCAGCTTCCTGAAGTACTGG - Intronic
950926377 3:16745805-16745827 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
951298928 3:20971750-20971772 GTCTGAGGTGCCTGACATCCAGG - Intergenic
951316435 3:21193432-21193454 GTCAGAGGTGCCTGACGTCCAGG - Intergenic
951889112 3:27552386-27552408 GTGTGAGGTACCTGACGTCCAGG - Intergenic
952343678 3:32465639-32465661 GTCTGAGGTGCCTGATGTCCAGG - Intronic
952663578 3:35878576-35878598 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
952895381 3:38075262-38075284 GTCTGAGGTGCCTTACGTCCAGG - Intronic
952896174 3:38080485-38080507 GTCTGAGGTGCCTGATGTCCAGG - Intronic
953077255 3:39582022-39582044 GTCTGAGATGCCTGACGTCCAGG - Intergenic
953159015 3:40400913-40400935 GACTGTGGTTCTTGAAGACCCGG - Exonic
953177069 3:40562471-40562493 GTCTGAGGTGCCTGACATCCAGG + Intronic
953253220 3:41265119-41265141 GGCTGAGGATTCTGCAGTGCTGG - Intronic
953366192 3:42347545-42347567 GCCTGATGTCCCTGATGTCCCGG - Intergenic
953825821 3:46250500-46250522 GTCTGAGGTGCCTGATGTCCAGG - Intronic
953834580 3:46331657-46331679 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
953841286 3:46391991-46392013 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
954768080 3:52939322-52939344 GCCTGAGCTTCCTAAAGTGCTGG - Intronic
954818761 3:53306465-53306487 GCCTCAGCTTCCTGAAGTGCTGG - Intronic
954959864 3:54554661-54554683 GGCTGAGGAACATTAAGTCCAGG + Intronic
954969383 3:54638705-54638727 GTGTGAGGTGCCTGACGTCCAGG - Intronic
955253241 3:57305157-57305179 GTCTGAGGTGCCTGACGTCCAGG + Intronic
956233625 3:67042953-67042975 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
956290519 3:67655073-67655095 AGGTGAGGTTCCTGCAGCCCAGG + Intergenic
956549105 3:70439097-70439119 GTCTGAGGAGCCTGACGTCCAGG - Intergenic
956555223 3:70513958-70513980 GGCAGAGGTTCATAAAGTCAGGG + Intergenic
956691961 3:71886926-71886948 GCCTGAGCCTCCCGAAGTCCTGG - Intergenic
956709097 3:72024464-72024486 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
956885531 3:73555426-73555448 TGCAGAGATTCCTGCAGTCCAGG + Intronic
957060013 3:75474264-75474286 GTCTGAGGTGACTGACGTCCAGG - Intergenic
957155286 3:76537249-76537271 GTCTGAGGTGCCTTATGTCCAGG - Intronic
957295125 3:78325367-78325389 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
957317424 3:78587369-78587391 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
957451326 3:80386340-80386362 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
957675371 3:83357350-83357372 GTCTGAGGTGCCTGACATCCAGG - Intergenic
957903130 3:86523158-86523180 GGCTGAGTTTGCAGAACTCCTGG - Intergenic
957904980 3:86542679-86542701 GTCTGAGGTGCCTGATATCCAGG - Intergenic
957985571 3:87570814-87570836 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
958181938 3:90071889-90071911 GTCTGAGGTGCCTGACCTCCAGG - Intergenic
958421833 3:93939237-93939259 GTCTGAGGTGCCTGACGTCCAGG + Intronic
958750879 3:98192434-98192456 GTCTGAAGTGCCTGATGTCCAGG + Intronic
959485889 3:106926937-106926959 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
959543825 3:107570901-107570923 GTCTGAGGTGCCTGACGTCCAGG - Intronic
959637724 3:108593912-108593934 GCCTCAGCTTCCTAAAGTCCTGG + Intronic
959772961 3:110122014-110122036 GCCTCAGGCTCCTGAAGTGCTGG - Intergenic
959972378 3:112421784-112421806 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
960310232 3:116109526-116109548 GTCTGAGGTGCCTGACGTCCAGG - Intronic
961164883 3:124756760-124756782 GTCTGAGATGCCTGACGTCCAGG - Intergenic
961379556 3:126488105-126488127 GGCTGAGGTTCCTGAAGTCCTGG - Intronic
961712888 3:128840784-128840806 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
961730462 3:128961216-128961238 GTCTGAGGTGCCTGACGTCCCGG + Intronic
961893834 3:130151374-130151396 GCCTCAGGTCCCTGATGTCCAGG - Intergenic
961934896 3:130572803-130572825 GTCTGAGATTCCTGAAGTCCAGG - Intronic
962205441 3:133430627-133430649 GTCTGAGGTGCCTGACGTCCAGG + Intronic
962444971 3:135455990-135456012 GGCTGAATTTCCTGAATTCTTGG - Intergenic
963111968 3:141695518-141695540 GTCTGAAGTGCCTGATGTCCAGG - Intergenic
963425092 3:145114433-145114455 GCCTGAGGTGCCTGATGTCCAGG + Intergenic
963456788 3:145555397-145555419 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
963468492 3:145711851-145711873 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
963520326 3:146355033-146355055 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
963521503 3:146363530-146363552 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
963563303 3:146895119-146895141 GGGTGAGATTCCAGAAGCCCTGG - Intergenic
963663219 3:148153138-148153160 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
963684211 3:148415835-148415857 GTCTGAGATGCCTGACGTCCAGG + Intergenic
964067703 3:152598480-152598502 GTCTGAGGTGCCTTAAGTCCAGG + Intergenic
964125581 3:153230941-153230963 GTCTGAGGTGCCTTACGTCCAGG - Intergenic
964176214 3:153827871-153827893 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
964300371 3:155279417-155279439 GTCTGAGGTGCCTGACATCCAGG - Intergenic
964906629 3:161726076-161726098 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
964983518 3:162713860-162713882 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
965262777 3:166505035-166505057 GTCTGAGGTGCCTGACATCCAGG - Intergenic
965336210 3:167432690-167432712 GTCTGAGGTGGCTGATGTCCAGG + Intergenic
965625000 3:170676750-170676772 GTCTGAGGTGCCTGATGCCCAGG - Intronic
965640167 3:170822210-170822232 GTCTGAGGTGCCTGATGTCCAGG - Intronic
965713281 3:171577903-171577925 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
965862101 3:173160167-173160189 GTCGGAGGTGCCTGATGTCCAGG - Intergenic
966066727 3:175829211-175829233 GTCTGAGGTGCCTGACGTCCGGG + Intergenic
966105204 3:176325831-176325853 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
966232963 3:177670054-177670076 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
966279180 3:178209007-178209029 GTCTGAGGTGCCTGACCTCCAGG + Intergenic
966860128 3:184226908-184226930 GCCTTAGGCTCCTGAAGTGCTGG + Intronic
966948513 3:184795345-184795367 AGCTGTGGTTCCTGCTGTCCTGG + Intergenic
967005487 3:185378774-185378796 GTCTGAGGTGCCTGACATCCAGG - Intronic
967151967 3:186659111-186659133 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
967212283 3:187179735-187179757 GTCTGAGGTGCCTGACGTCCAGG - Intronic
967244287 3:187470498-187470520 ATCTGAGGTGCCTGATGTCCAGG - Intergenic
967372037 3:188757443-188757465 GGCTCAGGTTCTTGGATTCCAGG + Intronic
967496099 3:190146008-190146030 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
967561272 3:190921608-190921630 GTCTGAGGTGCCTGACATCCAGG + Intergenic
967624768 3:191670709-191670731 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
967658233 3:192075306-192075328 GTCTGAGATGCCTGACGTCCAGG - Intergenic
967740363 3:192997140-192997162 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
967815137 3:193792113-193792135 AACTGAGGTCCCTGAACTCCTGG - Intergenic
968413435 4:408098-408120 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
968449927 4:670489-670511 GCCTCAGCTTCCTGAAGTGCTGG + Exonic
968780575 4:2577666-2577688 GCCTGAGCCTCCTGAAGTGCTGG + Intronic
968832406 4:2939814-2939836 GGCTGTGGCTGCTCAAGTCCTGG + Intronic
968993266 4:3928864-3928886 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
969654233 4:8487072-8487094 GTCTGATGTGCCTGACGTCCAGG - Intronic
969713870 4:8859221-8859243 GCCTGAGGTTCCTCATATCCTGG - Intronic
969748937 4:9095735-9095757 GTCTGAGATGCCTGATGTCCAGG + Intergenic
969810002 4:9640376-9640398 GTCTGAGGTGACTGACGTCCAGG + Intergenic
970029352 4:11657966-11657988 GTCTGAGGTGCCTGACATCCAGG - Intergenic
970041971 4:11807748-11807770 GTCTGAGGTGCCTGACCTCCAGG + Intergenic
970256542 4:14174738-14174760 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
970513212 4:16801231-16801253 TGCTGTGGTTCATGAAGCCCAGG - Intronic
970532604 4:16999157-16999179 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
970602626 4:17652580-17652602 GCCTGAGATTCCTGGAGCCCTGG + Intronic
970854164 4:20634496-20634518 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
971123305 4:23726244-23726266 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
971180437 4:24324712-24324734 GTCTGAGGTTCCTGACGTCCAGG + Intergenic
971200019 4:24502513-24502535 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
972128740 4:35802637-35802659 GTCTGAGCTCCCTGAAGTGCTGG - Intergenic
972786922 4:42335203-42335225 GCCTGGGCTTCCTGAAGTGCTGG - Intergenic
973627235 4:52785067-52785089 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
973646655 4:52956931-52956953 GGCTGGAGTTGCTGAAATCCTGG + Intronic
973751005 4:54021267-54021289 GTCTGAGGTGCCTGACATCCAGG + Intronic
974428514 4:61768500-61768522 GTCTGAGGTGCCTGAAGTCCAGG - Intronic
974903658 4:68032087-68032109 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
975151953 4:71032680-71032702 GTCTGAGGTGCCTGATGTCTAGG + Intergenic
975865207 4:78718084-78718106 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
975934009 4:79558204-79558226 GTCTGAGGTGGCTGACGTCCAGG - Intergenic
976696417 4:87923353-87923375 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
976740077 4:88347980-88348002 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
976884696 4:89969019-89969041 GTCTGAGGTGCCTGACATCCAGG - Intergenic
977010198 4:91625575-91625597 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
977013048 4:91658849-91658871 GTCTGAGGTGCCTTATGTCCAGG - Intergenic
977022710 4:91776315-91776337 GTCTGAAGTTCCTTATGTCCAGG - Intergenic
977041898 4:92027330-92027352 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
977062628 4:92275718-92275740 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
977075329 4:92443186-92443208 GTCTGAGGTGCCTGACGTCCAGG - Intronic
977198546 4:94088835-94088857 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
977217265 4:94297412-94297434 GTCTGAGGTGCCTGACATCCAGG - Intergenic
977446558 4:97138852-97138874 ATCTGAGGTGCCTGACGTCCAGG - Intergenic
977782568 4:100996035-100996057 GTCTGAGTTGCCTGACGTCCAGG - Intergenic
978001235 4:103557974-103557996 GTCTGAGGTGCCTGACATCCAGG - Intergenic
978031359 4:103942617-103942639 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
978438492 4:108710511-108710533 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
978585034 4:110268217-110268239 GCCTCGGGTTCCTAAAGTCCTGG - Intergenic
979054745 4:115979879-115979901 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
979265239 4:118694748-118694770 GGCTGAAATGCCTGTAGTCCAGG - Intronic
979379815 4:119995406-119995428 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
979640795 4:123011535-123011557 GTCTGAGGTGCCTGACGTCCAGG - Intronic
979711812 4:123788694-123788716 GCCTGAGTTGCTTGAAGTCCTGG - Intergenic
979798444 4:124876421-124876443 GTCTGAGGTGCCTGACATCCAGG - Intergenic
979850424 4:125565862-125565884 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
979895280 4:126149348-126149370 GTCTGAGGTGCCTGACATCCAGG - Intergenic
980003467 4:127515693-127515715 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
980112047 4:128645057-128645079 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
980270696 4:130580485-130580507 GGCTGTGATTCCAGAAGACCTGG - Intergenic
980284831 4:130768833-130768855 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
980388802 4:132119687-132119709 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
980472560 4:133267930-133267952 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
980491473 4:133533401-133533423 TTCTGAGGTGCCTGACGTCCAGG - Intergenic
980527753 4:134013643-134013665 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
980575752 4:134682118-134682140 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
980611892 4:135171503-135171525 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
980885420 4:138757429-138757451 GCCTGAAGTTTCTGAAGTCAAGG + Intergenic
980903811 4:138929358-138929380 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
981525085 4:145700611-145700633 GTCTGAGGTGCCTGACGTCCAGG + Intronic
981539606 4:145834227-145834249 GTCTGAGGTGCCTGACATCCAGG + Intronic
982084080 4:151816813-151816835 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
982180595 4:152745564-152745586 GTCTGAGGTGCCTGACGTCCAGG - Intronic
982318683 4:154057736-154057758 GCCTGAGGTGCCTGATGTCCAGG + Intergenic
982396836 4:154923099-154923121 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
982414316 4:155112674-155112696 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
982497230 4:156107692-156107714 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
982535327 4:156601782-156601804 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
982634670 4:157879182-157879204 GGCCGGGGTTGCTGAGGTCCAGG - Intergenic
983023746 4:162710586-162710608 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
983055367 4:163094589-163094611 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
983345437 4:166521994-166522016 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
983414832 4:167440031-167440053 GTCTGAGGTGCCTGACATCCAGG - Intergenic
983447938 4:167877733-167877755 GTCTGAGGTGCCTGACATCCAGG + Intergenic
983647346 4:170005097-170005119 GGCTGGGATTCCTGGAGACCTGG - Intronic
983659460 4:170117939-170117961 GTCTGAGGTGCCTGACATCCTGG + Intergenic
983707560 4:170678964-170678986 GTCTGAGGTGCCTGACATCCAGG + Intergenic
983883889 4:172960638-172960660 GTCTGAGGTGCCTGGTGTCCAGG - Intronic
984165474 4:176299088-176299110 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
984322066 4:178208620-178208642 GTCTGAGGTGTCTGATGTCCAGG + Intergenic
984393731 4:179169101-179169123 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
984411599 4:179404677-179404699 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
984437141 4:179721916-179721938 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
984700545 4:182816006-182816028 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
984760492 4:183358787-183358809 GGTTGAGCTTTCTGAAGACCTGG + Intergenic
985057517 4:186048444-186048466 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
985079140 4:186246417-186246439 GTCTGAGGTGCCTGACGTCCAGG - Intronic
985389995 4:189483689-189483711 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
985435606 4:189927320-189927342 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
985582236 5:704275-704297 GTCTGAGGTGCCTTATGTCCAGG + Intergenic
986193419 5:5517056-5517078 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
986374973 5:7121782-7121804 TTCTGAGGCTTCTGAAGTCCTGG + Intergenic
986388762 5:7265085-7265107 GTCTGAGGTGCCTGACATCCAGG + Intergenic
986555673 5:9008123-9008145 GTCTGAGGTGCCTTACGTCCAGG - Intergenic
986905660 5:12491336-12491358 GTCTGAGGTACCTGAAGTCCAGG + Intergenic
986919706 5:12666765-12666787 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
987109036 5:14667622-14667644 GCCGCAGCTTCCTGAAGTCCTGG + Intronic
987281919 5:16421492-16421514 GTCTGAGGTGCCTGACGTCTAGG + Intergenic
987487387 5:18539807-18539829 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
987498246 5:18673069-18673091 GTCTGAGGTTCCTGACGTCCAGG - Intergenic
987755709 5:22096311-22096333 GTCTGAGGTGCCTGATGTCCAGG + Intronic
988363360 5:30264794-30264816 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
988415199 5:30938257-30938279 GCCTCAGCTTCCTGAAGTGCTGG - Intergenic
989659807 5:43787591-43787613 GTCTGAGGTGCCTGATATCCAGG + Intergenic
990497015 5:56358611-56358633 AGATGAGGTTCCAGAAGCCCAGG - Intergenic
992394544 5:76358836-76358858 GTCTTAGGTGCCTGACGTCCAGG + Intergenic
992452173 5:76884982-76885004 GTCTGAGGTGCCTGACGTCCAGG - Intronic
992915843 5:81452374-81452396 GACTCAGCTTCCTGAAGTGCTGG + Intronic
992927876 5:81609132-81609154 TGCTGAAGTCCCTGAATTCCTGG - Intronic
992960715 5:81954760-81954782 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
993836587 5:92825480-92825502 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
993901318 5:93585575-93585597 GGCTGGGGCTCCTGTGGTCCCGG + Intronic
994126238 5:96171134-96171156 GGCTAAGGTGCCTGACGTCCAGG - Intergenic
994295026 5:98080537-98080559 GGCTGAGGTGCCTGACATCCAGG + Intergenic
994324698 5:98435698-98435720 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
994532658 5:100988465-100988487 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
994556806 5:101316391-101316413 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
994775568 5:104033107-104033129 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
994989429 5:106979863-106979885 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
995769263 5:115651983-115652005 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
995899490 5:117050592-117050614 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
996052791 5:118951468-118951490 GTCTGAGGTGCCTGACGTCTAGG - Intronic
996203373 5:120701817-120701839 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
996344942 5:122477835-122477857 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
996358753 5:122623123-122623145 GTCTGAGGTGCCTGACATCCAGG - Intergenic
996509785 5:124305259-124305281 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
996527931 5:124498510-124498532 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
996575133 5:124970856-124970878 GTCTGAGGTACCTGACGTCCAGG - Intergenic
996726125 5:126674578-126674600 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
996745566 5:126843789-126843811 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
997746282 5:136302787-136302809 GTCTGAGGTGCCTGACGTCCAGG + Intronic
997769795 5:136543840-136543862 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
997772759 5:136569560-136569582 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
998693835 5:144615662-144615684 GTCTGAGGTGCCCGATGTCCAGG - Intergenic
998995270 5:147864760-147864782 GTCTGAGGTGCCTGACATCCAGG + Intergenic
998996515 5:147873184-147873206 GTCTGAGGTGCCTGACGTCCAGG - Intronic
999316619 5:150588372-150588394 GGCTGGGGTTGCAGAAGTCCAGG - Intergenic
999618984 5:153453921-153453943 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1000438471 5:161241441-161241463 GTTTGAGGTGCCTGATGTCCAGG + Intergenic
1000439597 5:161249944-161249966 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1000519531 5:162279603-162279625 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1000606805 5:163335499-163335521 CTCTGAGGTGCCTGATGTCCAGG + Intergenic
1000833018 5:166127310-166127332 GAGGGAGGTTCCTGGAGTCCAGG + Intergenic
1000885451 5:166743339-166743361 GTCTGAGGTGCCTGGTGTCCAGG - Intergenic
1000935762 5:167302125-167302147 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1001331573 5:170766243-170766265 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1001870590 5:175151015-175151037 GCCTCAGCTTCCTGAAGTGCTGG + Intergenic
1001871131 5:175156949-175156971 GGCTGAGATTCCTGAGGAGCAGG + Intergenic
1002611086 5:180418952-180418974 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1003430290 6:6032008-6032030 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1004106140 6:12668868-12668890 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1004283644 6:14301177-14301199 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1004508116 6:16263218-16263240 GTCTGAGGTGCCTGACATCCAGG - Intronic
1004575105 6:16887441-16887463 GTCTGAGCTGCCTGACGTCCAGG + Intergenic
1004768702 6:18758291-18758313 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1004836879 6:19540376-19540398 GTCTAAGGTGCCTGACGTCCAGG + Intergenic
1004986362 6:21087442-21087464 GCCTCAGCTTCCTGAAGTGCTGG + Intronic
1005014776 6:21365718-21365740 GTCTGAGGTGCCTAATGTCCAGG - Intergenic
1005786698 6:29251465-29251487 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1007084712 6:39135258-39135280 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1007781468 6:44257191-44257213 GGCTGGGGACCCTGACGTCCCGG - Intronic
1008773054 6:55002727-55002749 GGCTGAGGTTCTTGAACAACTGG - Intergenic
1008850335 6:56015050-56015072 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
1009269690 6:61601550-61601572 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1009343487 6:62587427-62587449 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1009359242 6:62792978-62793000 GTCTGAGATGCCTGATGTCCAGG + Intergenic
1009464219 6:63951367-63951389 GTCTGAGGTGCCTGATGTCCAGG + Intronic
1010071848 6:71752805-71752827 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1010586816 6:77664763-77664785 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1010829808 6:80514558-80514580 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1010841440 6:80652069-80652091 GTCTGAGGTGCCTGATATCCAGG - Intergenic
1010894655 6:81349324-81349346 GTCTGAGATGCCTGATGTCCAGG - Intergenic
1011279778 6:85665387-85665409 GGCTGAGGCGCGAGAAGTCCAGG - Intergenic
1011771062 6:90674438-90674460 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1012014510 6:93834304-93834326 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1012066659 6:94558157-94558179 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1012674978 6:102103444-102103466 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1013023549 6:106245077-106245099 GGTTTGTGTTCCTGAAGTCCAGG - Intronic
1013408003 6:109859969-109859991 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1013660317 6:112289265-112289287 GGCTCAAGTTACTGAACTCCTGG - Intergenic
1013843802 6:114426550-114426572 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1013891585 6:115033383-115033405 GTCTGAGGTGCCTGATATCCAGG + Intergenic
1014132016 6:117845938-117845960 GGCAGAGCCTCCTGATGTCCTGG + Intergenic
1014360277 6:120466478-120466500 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1014454988 6:121624650-121624672 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1014555724 6:122841319-122841341 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1014611958 6:123558093-123558115 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1014614789 6:123586504-123586526 GTCTGAGGTGCCTGACATCCAGG - Intronic
1014718775 6:124893535-124893557 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1014794114 6:125706088-125706110 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1015165100 6:130193817-130193839 GTCTGAGGTGCCTGATGTCCAGG + Intronic
1015266619 6:131296956-131296978 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1015269545 6:131324923-131324945 GTCTGAGGTGACTGACGTCCAGG + Intergenic
1015271254 6:131340373-131340395 GTCTGAGGTGCCTGAAGTCCAGG + Intergenic
1015323714 6:131903169-131903191 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1015355678 6:132274888-132274910 AACTGAAGTTCCTCAAGTCCTGG + Intergenic
1016114267 6:140261634-140261656 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1016204417 6:141454307-141454329 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1016248740 6:142017298-142017320 GTCTGAGGTGCCCGACGTCCAGG + Intergenic
1016518688 6:144924676-144924698 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1016535870 6:145107357-145107379 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1016650410 6:146454627-146454649 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1016940210 6:149477212-149477234 TGCTGTGGCTCCTGAACTCCTGG - Intronic
1017389375 6:153922984-153923006 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1017479099 6:154832259-154832281 GGCTGTGTTCCCAGAAGTCCAGG - Exonic
1017890996 6:158639312-158639334 GGCTGGGGGGCCAGAAGTCCCGG + Intronic
1017955525 6:159174455-159174477 GGCTTCGGCTCCAGAAGTCCAGG - Intronic
1018077467 6:160229942-160229964 GTCTGAGGTCCCTGATATCCAGG + Intronic
1018084622 6:160290797-160290819 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1018477038 6:164152877-164152899 GGCAGAGATTCCTGAAGAACAGG - Intergenic
1018495526 6:164342966-164342988 GTATGAGGTGCCTGACGTCCAGG - Intergenic
1018521597 6:164656378-164656400 GTCTGAGGTGCCTGATGTGCAGG - Intergenic
1019183229 6:170205664-170205686 CGGTGAGGTTCCTGACTTCCTGG + Intergenic
1019405707 7:882799-882821 GGCTGAGGCTCCTCAAGACCTGG - Intronic
1019448875 7:1085940-1085962 GACGGAAGTTCCTGCAGTCCGGG + Intronic
1020019986 7:4859919-4859941 TGCTGAGTTTCCTGAAGGTCTGG + Exonic
1020315924 7:6905275-6905297 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
1020324061 7:6960906-6960928 GTCTGAGATGCCTGATGTCCAGG - Intergenic
1020490503 7:8777350-8777372 GGCTCAGCTTCCTGAAGTGCTGG + Intergenic
1020532832 7:9357631-9357653 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1020541246 7:9462742-9462764 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1020794083 7:12661045-12661067 GTCTGAGATGCCTGATGTCCAGG + Intergenic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1021393494 7:20122060-20122082 GTCTGAGGTGCCTAACGTCCAGG + Intergenic
1021637196 7:22704744-22704766 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1021660497 7:22914600-22914622 GTCTGGGGTGCCTGACGTCCAGG + Intergenic
1021810542 7:24397760-24397782 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1021978009 7:26028383-26028405 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1022372761 7:29786370-29786392 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1022447288 7:30480724-30480746 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1022452490 7:30527711-30527733 GCCAGAGGTTCCTGAACACCTGG - Intronic
1022572909 7:31471265-31471287 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1022708939 7:32833846-32833868 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1022710162 7:32842114-32842136 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1022854833 7:34304103-34304125 GTCTGAAGTGCCTGACGTCCAGG - Intergenic
1023699010 7:42874834-42874856 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1023970915 7:44990176-44990198 GTCTGAGCCTCCTGAAGTGCTGG - Intergenic
1024026342 7:45413103-45413125 CACTAAGGGTCCTGAAGTCCTGG + Intergenic
1024176170 7:46843366-46843388 GGCTCAGCCTCCTGAAGTGCTGG - Intergenic
1024697505 7:51871501-51871523 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1024739374 7:52337878-52337900 GTCTGAGGTGCCTGATATCCAGG - Intergenic
1027157751 7:75780601-75780623 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1027158107 7:75782744-75782766 GCCTGAGGTGCCTGACGTCCAGG + Intronic
1027354296 7:77341150-77341172 GTCTGAGGTGCCTGACTTCCAGG + Intronic
1027813343 7:82934241-82934263 GGCTGTGTTTCTTGAAATCCTGG + Intronic
1028590032 7:92484044-92484066 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1028670390 7:93395420-93395442 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1028690055 7:93641348-93641370 GTCTGAGGTGCCTGACATCCAGG + Intronic
1029316982 7:99724381-99724403 GTCTGAGGTGCCTGACATCCAGG + Intronic
1029500091 7:100923621-100923643 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1030193307 7:106830818-106830840 GTCTGAGGTGCCTTACGTCCAGG + Intergenic
1030441811 7:109596268-109596290 GTTTGAGGTGCCTGACGTCCAGG - Intergenic
1030751623 7:113237790-113237812 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1031004551 7:116456982-116457004 GTCTGAGGTGCCTGACATCCAGG + Intronic
1031296493 7:120010355-120010377 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1031355315 7:120781363-120781385 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1031364867 7:120889870-120889892 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1031399870 7:121317070-121317092 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1031422582 7:121568241-121568263 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1031525474 7:122818404-122818426 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1031685727 7:124730514-124730536 GTCTGAGTTGCCTGATGTCCAGG + Intergenic
1031728048 7:125263129-125263151 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
1031776208 7:125911472-125911494 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1031777218 7:125919080-125919102 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1032540212 7:132696909-132696931 TGCTGAGGTTCCTGTAATCTGGG + Intronic
1033084590 7:138330483-138330505 ATCTGAGGTGCCTGACGTCCAGG + Intergenic
1033211394 7:139462732-139462754 GTCTGAGGTGCCTGACGTCCAGG + Intronic
1033465167 7:141583049-141583071 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1033676074 7:143541448-143541470 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1033695761 7:143787991-143788013 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1033909580 7:146247586-146247608 GTCTGAGGTGCCTGATGTCCAGG - Intronic
1034084952 7:148314286-148314308 GTCTGAGGTGCCTGACATCCAGG - Intronic
1034333959 7:150308469-150308491 GTCTGAGGTGCCTTACGTCCAGG + Intronic
1034402169 7:150869749-150869771 GCCTGAGCCTCCTGAAGTTCTGG - Intergenic
1035043424 7:155947609-155947631 GGCTGATGTTCCTGGACTCTTGG + Intergenic
1035379758 7:158430347-158430369 GGCTGAGGGGCCTGTAGACCCGG + Intronic
1035880785 8:3242453-3242475 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1036071040 8:5440875-5440897 GTCTGAAGTGCCTGATGTCCAGG - Intergenic
1036281362 8:7403922-7403944 GTCTCAGGTGCCTGACGTCCAGG + Intergenic
1036340105 8:7907650-7907672 GTCTCAGGTGCCTGACGTCCAGG - Intergenic
1037584747 8:20268737-20268759 GGCTGAGGTTGCTGAGGTGCTGG + Intronic
1038183547 8:25251088-25251110 GTCTGAGGTTCCTCTAGTGCTGG + Intronic
1038443219 8:27586024-27586046 GGCTGAGGTTGCTGTTCTCCTGG - Intergenic
1038756323 8:30344107-30344129 GGCTCAGCCTCCTGAAGTGCAGG + Intergenic
1039499122 8:38002935-38002957 GTCTGTGGTGCCTGATGTCCAGG - Intergenic
1040647892 8:49420933-49420955 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1041651974 8:60310778-60310800 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1042358074 8:67851616-67851638 GACTGTGTTTCCTGAAGTACAGG + Intergenic
1042453432 8:68974656-68974678 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1042707241 8:71676396-71676418 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1043353794 8:79390317-79390339 GTCCGAGGTGCCTGACGTCCAGG - Intergenic
1043476881 8:80613762-80613784 GGCTGAGGTTGCTTGAGTCCAGG - Intergenic
1043598719 8:81914882-81914904 GTCTGAGGTGTCTGACGTCCAGG + Intergenic
1043718016 8:83509355-83509377 GTCTGAGGTGCCTGACTTCCAGG - Intergenic
1043720727 8:83544871-83544893 GTCTGAGGTGCATGATGTCCTGG + Intergenic
1043837607 8:85064428-85064450 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1044148633 8:88746427-88746449 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1044258738 8:90094419-90094441 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1044416967 8:91949502-91949524 GTCTGAGTTGCCTGAAGTCCAGG + Intergenic
1044910828 8:97056472-97056494 GTCTGAGGTTCCAGAAGCCAAGG + Intronic
1044921867 8:97176579-97176601 GCCTGAGGTGCCTGACGTCCAGG + Intergenic
1044925042 8:97202424-97202446 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1045197400 8:99945354-99945376 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1045644668 8:104287442-104287464 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1046074773 8:109302296-109302318 GTCTGTGGTGCCTGATGTCCAGG + Intronic
1046293998 8:112197320-112197342 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1046386459 8:113513724-113513746 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1046443133 8:114283476-114283498 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1046511965 8:115213729-115213751 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1046559156 8:115816088-115816110 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1047484643 8:125318157-125318179 GCCTCAGGCTCCTGAAGTGCTGG - Intronic
1047829655 8:128616120-128616142 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1047856255 8:128915891-128915913 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1048143651 8:131820654-131820676 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1048168561 8:132084464-132084486 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1048327344 8:133449840-133449862 GGCTGGGGTTCCTGAGTCCCGGG - Intergenic
1048454620 8:134566649-134566671 GGCTGAGTTCCCAGAAGTGCTGG + Intronic
1048585537 8:135771358-135771380 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1048728541 8:137412516-137412538 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1048764355 8:137829058-137829080 GTCTGAGATGCCTGACGTCCAGG - Intergenic
1049218414 8:141418049-141418071 GGCTGGGGTCCCGGAAGGCCTGG - Intronic
1049354277 8:142179909-142179931 GGCTGAGGTCCAGGAAGTCCTGG - Intergenic
1049443258 8:142618750-142618772 GGATGAGGCTCCTGGAGCCCCGG - Intergenic
1049868941 8:144958519-144958541 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1050140349 9:2510876-2510898 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1050258232 9:3815409-3815431 GTCTGAGATGCCTGATGTCCAGG - Intergenic
1050474035 9:6021433-6021455 GTCTGAGGTGCCTAACGTCCAGG + Intergenic
1051052501 9:12949804-12949826 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1051849408 9:21489913-21489935 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1051953522 9:22662760-22662782 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1052162965 9:25289171-25289193 GTCTAAGGTGCCTGACGTCCAGG + Intergenic
1052191709 9:25670399-25670421 GTCTGAGATGCCTGACGTCCAGG + Intergenic
1052653207 9:31327863-31327885 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1052720762 9:32168766-32168788 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1053057897 9:35004944-35004966 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1053060091 9:35023875-35023897 GTCTGTGGTGCCTGACGTCCAGG - Intergenic
1053078589 9:35155465-35155487 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1054807611 9:69408991-69409013 GTTTGAGGTGCCTGACGTCCAGG - Intergenic
1055232942 9:74087151-74087173 GTCTGAGGTTCCTGACGTCCAGG + Intergenic
1055347841 9:75356019-75356041 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1055809932 9:80138904-80138926 GTCTGAGGTGCCTGACGTCGAGG + Intergenic
1055881634 9:81010483-81010505 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1056044857 9:82704922-82704944 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1056061046 9:82885267-82885289 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1056323763 9:85460130-85460152 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
1056391755 9:86147259-86147281 GTCTGAGGTTCCTGATGTCCAGG + Intergenic
1056850003 9:90074672-90074694 GGTTCAGGTTCCTGAATTCCTGG + Intergenic
1056882858 9:90414059-90414081 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1057234722 9:93349089-93349111 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1057265090 9:93611762-93611784 GCCTCAGCTTCCTGAAGTGCTGG + Intronic
1057312093 9:93949032-93949054 GGCTGAGCTTCCCGGAGCCCGGG - Intergenic
1057377867 9:94541326-94541348 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1057683847 9:97216112-97216134 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1057812705 9:98270072-98270094 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1057981959 9:99671649-99671671 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1058026334 9:100144930-100144952 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1058612281 9:106789671-106789693 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1058902326 9:109452808-109452830 GCCTTGGGTTCCTGAAGTGCTGG + Intronic
1059546287 9:115178881-115178903 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1059574505 9:115474861-115474883 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1059606829 9:115843431-115843453 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1059757007 9:117303120-117303142 GGGTGAAGTTCGTGAAGTCAGGG - Intronic
1059863607 9:118489900-118489922 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1060001003 9:119958539-119958561 GCCTGGGATTCCTAAAGTCCTGG - Intergenic
1060226025 9:121791452-121791474 GTCTGAGGTGCCTTATGTCCAGG + Intergenic
1060318587 9:122534825-122534847 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1060738001 9:126078866-126078888 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1060920154 9:127414777-127414799 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1060972600 9:127747303-127747325 GGCTGAGGCCCCTGACCTCCGGG - Intronic
1061170033 9:128947350-128947372 GGCTGAGGGGCCCGAAGTCTAGG - Exonic
1061582934 9:131548536-131548558 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1062483358 9:136762596-136762618 GGCTCAGGTTCTTTAACTCCTGG - Intronic
1185858553 X:3557339-3557361 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1185960807 X:4544698-4544720 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1185990938 X:4893090-4893112 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1186112997 X:6276414-6276436 GTCTGAGGTGTCTGACGTCCAGG - Intergenic
1187086644 X:16048898-16048920 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1187103889 X:16221052-16221074 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1187273792 X:17801485-17801507 GGCTGGGGATCCTCAGGTCCAGG + Exonic
1188201128 X:27293753-27293775 GTCTGAGGTGCCTTATGTCCAGG - Intergenic
1188301187 X:28506659-28506681 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1188333147 X:28896850-28896872 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1188419364 X:29976757-29976779 GTCTGAGGTGCCTGACGTCCGGG + Intergenic
1188463495 X:30453307-30453329 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1188552529 X:31378998-31379020 GTCTGAGGTGCCTGATGTCCAGG + Intronic
1189491112 X:41472527-41472549 GTCAGAGGTTCTTGAAATCCAGG - Intronic
1190727125 X:53196993-53197015 GGCTGAGGCTCGTGAGGCCCTGG - Exonic
1191014319 X:55792534-55792556 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1191762915 X:64663830-64663852 GGCTCAGCTTCCTGTTGTCCAGG + Intergenic
1192454467 X:71265659-71265681 GTCTGAGGTGTCTGATGTCCAGG + Intergenic
1192564455 X:72152013-72152035 GGCTGAGGGTCCAGAAGGCAGGG - Intergenic
1192706013 X:73529113-73529135 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1192731774 X:73808220-73808242 GTCTGAGGTGCCTGATATCCAGG - Intergenic
1192935977 X:75858844-75858866 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1193536935 X:82728005-82728027 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1193885813 X:86983290-86983312 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1193941375 X:87683376-87683398 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1194186364 X:90777529-90777551 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1194293739 X:92104446-92104468 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1194308652 X:92277256-92277278 GTCTGAGGTGCCTGACATCCAGG - Intronic
1194351169 X:92825986-92826008 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1194366981 X:93024418-93024440 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1194503107 X:94703044-94703066 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1194660565 X:96625504-96625526 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1194822884 X:98528482-98528504 GTCTGAAGTGCCTGACGTCCAGG - Intergenic
1194873925 X:99163658-99163680 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1195017074 X:100790674-100790696 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1195291287 X:103433790-103433812 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1195312931 X:103651305-103651327 AGCAGATGTTCCTGAAGTACTGG + Intergenic
1195421478 X:104679878-104679900 GGTTGAGCTTCCTGAATGCCAGG - Intronic
1195593442 X:106659228-106659250 GCCTCAGGCTCCTGAAGTGCTGG + Intronic
1195841358 X:109179892-109179914 GTCTGAGGTGCCTGACATCCAGG + Intergenic
1195908797 X:109869425-109869447 GTCTGAGGTGCCTGAAGTCCAGG - Intergenic
1196072965 X:111545402-111545424 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1196165426 X:112532101-112532123 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1196221101 X:113112936-113112958 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1196299896 X:114041484-114041506 GTTTGAGGTGCCTGACGTCCAGG + Intergenic
1196330705 X:114468248-114468270 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1196341836 X:114605527-114605549 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1196533653 X:116816674-116816696 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1196572386 X:117280661-117280683 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1196584993 X:117419117-117419139 GTCTGAGGTACCTGATGTCCAGG + Intergenic
1196773973 X:119321975-119321997 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1197064792 X:122223520-122223542 GTCTGAGGTGCCTGACTTCCAGG + Intergenic
1197352180 X:125393076-125393098 GTCTGAGGTGCCTGACATCCAGG - Intergenic
1197470841 X:126864578-126864600 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1197768078 X:130071906-130071928 GGCTGAGGCCCCAGAGGTCCGGG + Intronic
1197793520 X:130278513-130278535 GTCTAAGGTGCCTGACGTCCAGG + Intergenic
1197932958 X:131713538-131713560 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1198598331 X:138260270-138260292 GTTTGAGGTGCCTGATGTCCAGG + Intergenic
1198599513 X:138268519-138268541 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1198810335 X:140529706-140529728 GGATGAGTTTGCTGAAGTACTGG - Intergenic
1198965794 X:142227993-142228015 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1198983873 X:142427785-142427807 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1199377747 X:147133360-147133382 GTCTGAGGTGCCTGACGTCCAGG - Intergenic
1199576359 X:149317161-149317183 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1200419757 Y:2952175-2952197 GCCTCAGCTTCCTAAAGTCCTGG + Intronic
1200532959 Y:4359606-4359628 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1200611260 Y:5328987-5329009 GTCTGAGGTGCCTGACGTCCAGG - Intronic
1200659494 Y:5942666-5942688 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1200675202 Y:6140674-6140696 GTCTGAGGTGCCTGATGTCCAGG + Intergenic
1200806314 Y:7436926-7436948 GACTCAGTTTCCTGAAGTGCTGG - Intergenic
1200812686 Y:7501844-7501866 GTCAGAGGTGCCTGATGTCCAGG + Intergenic
1201473617 Y:14358679-14358701 GTCTGAGGTGCCTGATGTCCAGG - Intergenic
1201524547 Y:14917347-14917369 GGCTCAGCTTCCCAAAGTCCTGG - Intergenic
1201581273 Y:15513852-15513874 GTCTGAGGTGCCTGACGTCCAGG + Intergenic
1201724934 Y:17140929-17140951 GTCTGAGGTGCCTGACATCCAGG - Intergenic