ID: 961380384

View in Genome Browser
Species Human (GRCh38)
Location 3:126492785-126492807
Sequence GATTATCCCCAGAGGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961380369_961380384 25 Left 961380369 3:126492737-126492759 CCACATGTCCACTGTAGTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 154
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380366_961380384 27 Left 961380366 3:126492735-126492757 CCCCACATGTCCACTGTAGTCTG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380373_961380384 -1 Left 961380373 3:126492763-126492785 CCAGACACCTCCCCCAATCCCAG 0: 1
1: 1
2: 4
3: 63
4: 635
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380372_961380384 2 Left 961380372 3:126492760-126492782 CCTCCAGACACCTCCCCCAATCC 0: 1
1: 1
2: 4
3: 65
4: 667
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380367_961380384 26 Left 961380367 3:126492736-126492758 CCCACATGTCCACTGTAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 144
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380374_961380384 -8 Left 961380374 3:126492770-126492792 CCTCCCCCAATCCCAGATTATCC 0: 1
1: 1
2: 4
3: 21
4: 240
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117
961380371_961380384 17 Left 961380371 3:126492745-126492767 CCACTGTAGTCTGGGCCTCCAGA 0: 1
1: 0
2: 1
3: 17
4: 191
Right 961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG 0: 2
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961380384 Original CRISPR GATTATCCCCAGAGGGGCCT TGG Intronic
902264480 1:15252164-15252186 GCTTATCCCGAGAGGGTTCTTGG + Intronic
903193945 1:21671238-21671260 CATCATCCCCAGAAGCGCCTCGG - Intergenic
918920371 1:190701815-190701837 GATTATTTCCAGAGAGGCTTAGG - Intergenic
919743498 1:200994433-200994455 GGTCATCCCAGGAGGGGCCTAGG - Intronic
1064373907 10:14778351-14778373 GATTCTCTCCAGAAGGGGCTTGG + Intergenic
1070184867 10:74051803-74051825 GTTTATCCCAAGAGGGTTCTTGG + Intronic
1070639068 10:78153311-78153333 GACTATATCCAGAGGGGCTTGGG - Intergenic
1072526869 10:96279627-96279649 GCTTAGCTCCAGAGGGTCCTTGG - Intergenic
1072693813 10:97588909-97588931 GTTTATACCCTGAGAGGCCTTGG + Intronic
1073267299 10:102235364-102235386 GACTTTCCTGAGAGGGGCCTGGG - Intronic
1075629811 10:123994257-123994279 CACTATCCCCAGGGAGGCCTTGG - Intergenic
1076132400 10:128022393-128022415 GACAATGCCCAGTGGGGCCTTGG - Intronic
1076761516 10:132608263-132608285 GAGCATCCCCAGTGGGGCCGTGG + Intronic
1079988859 11:27226164-27226186 GATCATCCAAAGAGGGGCATTGG - Intergenic
1080500140 11:32862843-32862865 CAATATCCCCACAGGGGCCCTGG - Intergenic
1085282504 11:75340434-75340456 CTGTTTCCCCAGAGGGGCCTTGG - Intronic
1087025564 11:93646050-93646072 GATTAGATCCAGAGGTGCCTAGG + Intergenic
1088035455 11:105307264-105307286 GGTTATCCACAGAGGTTCCTCGG + Intergenic
1089697617 11:120225759-120225781 GATCATCCCCAGTGAGGCCATGG + Exonic
1090157431 11:124455668-124455690 GTTTATCCCCAGAGCTTCCTGGG - Intergenic
1095106152 12:38235366-38235388 TATTACCCCCAGAAGGGTCTGGG - Intergenic
1102233717 12:111281168-111281190 CATTATCAACAGAGGGGCTTTGG + Intronic
1102510541 12:113412397-113412419 CATTCTCCCCAGAGTGACCTAGG - Intronic
1102687958 12:114738953-114738975 GTTTGTCCCCAGAGCGACCTTGG - Intergenic
1102924464 12:116816143-116816165 GATTAAGCCCATAGTGGCCTGGG - Intronic
1103043637 12:117717118-117717140 GATTATCCCCAAGGTGGGCTGGG - Intronic
1103224792 12:119277419-119277441 GATTAGCCTCAGAGGTGACTGGG + Intergenic
1104324806 12:127785963-127785985 AATTATGTCCAAAGGGGCCTGGG - Intergenic
1105407217 13:20142539-20142561 GGCTGTCCCCAGCGGGGCCTCGG + Exonic
1105544290 13:21340478-21340500 TCTTGCCCCCAGAGGGGCCTTGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108356368 13:49631909-49631931 GATTTTCCCCAGTGGCCCCTGGG + Exonic
1113881754 13:113630906-113630928 GGTTCCCCCCAGAGGGGCCCAGG + Intronic
1114671437 14:24413443-24413465 GATCAGCCCCAGGAGGGCCTGGG - Intronic
1118914974 14:70095263-70095285 GACTATCCTAAGAGGGCCCTAGG + Intronic
1124087342 15:26563267-26563289 AATGAACCCCAGAGGGACCTGGG + Intronic
1124823263 15:33068465-33068487 GATTATGATCAGAGAGGCCTGGG + Intronic
1127542531 15:59955216-59955238 GATTATTCCCAGTGTGGGCTAGG + Intergenic
1128576251 15:68777245-68777267 AAATAGCCCCAGATGGGCCTGGG + Intergenic
1129176076 15:73840687-73840709 GTTTGACCCCAGAGTGGCCTTGG - Intergenic
1129349482 15:74946752-74946774 GATTCTCCCAGGAGGGACCTGGG - Intergenic
1131759517 15:95605266-95605288 GATTATACCAAAAGGGGCCTGGG + Intergenic
1132298221 15:100760130-100760152 GATTCTTCGCAGAGGGTCCTAGG + Intergenic
1135551758 16:23403967-23403989 CATGTTCTCCAGAGGGGCCTGGG - Intronic
1136358547 16:29762584-29762606 GCTTAGCCCAAGAGGGTCCTTGG - Intergenic
1136884375 16:33922517-33922539 GGGGTTCCCCAGAGGGGCCTTGG - Intergenic
1139642109 16:68299195-68299217 GATTAGCTCCAGAGGAGCCCTGG - Exonic
1141690842 16:85595392-85595414 AAGTCTCCGCAGAGGGGCCTTGG - Intergenic
1141797648 16:86285970-86285992 GATTGTCCCCGGAGGGGTCAAGG - Intergenic
1143187513 17:5019603-5019625 CATTATCCCTGGTGGGGCCTGGG - Intronic
1144889764 17:18487856-18487878 GGTTGTCCCCAGAGTGACCTGGG - Intronic
1145142450 17:20456461-20456483 GGTTGTCCCCAGAGTGACCTGGG + Intronic
1145793456 17:27642447-27642469 GGTTGTCCCCAGAGTGACCTGGG - Intronic
1145808261 17:27749993-27750015 GGTTGTCCCCAGAGTGACCTGGG - Intergenic
1146482216 17:33213865-33213887 GAGAATGCCCAGAGGGGCCAGGG - Intronic
1146955293 17:36933634-36933656 GATCAGCCCCAGAGGGACCCTGG - Intergenic
1149070555 17:52536833-52536855 GCTTATCCCCAGAGAGTCCCTGG - Intergenic
1151509912 17:74552004-74552026 GCTTCTCCTCAGATGGGCCTGGG + Intergenic
1152459066 17:80431887-80431909 GAGTGTCCCCAGAGAGTCCTTGG + Intronic
1152504367 17:80737972-80737994 CATTCTCCCCAGCGGGGCTTTGG - Intronic
1152727941 17:81956825-81956847 GCTTTGCCCCAGAAGGGCCTGGG - Intronic
1159462634 18:68740207-68740229 GATTATCCCCTAAGGGACATTGG - Intronic
1159889998 18:73944003-73944025 CATCATCCCCAGAGGGGCCCTGG + Intergenic
1162801784 19:13115392-13115414 GATTTGCCCTAGAGGTGCCTGGG - Exonic
925917007 2:8614117-8614139 GATGAACCCTAGGGGGGCCTGGG + Intergenic
926107208 2:10159971-10159993 GACTTTCCCCCGAGGGCCCTGGG - Intronic
927836744 2:26404990-26405012 GTTCTTCCCCAAAGGGGCCTAGG - Intronic
928129613 2:28640310-28640332 GCTCATCCTCAGAGGGTCCTGGG + Intronic
928875069 2:36028463-36028485 CACCATCCCCAGAGGGGCCTTGG - Intergenic
929247444 2:39718410-39718432 GAATATCCACAGCTGGGCCTAGG + Intergenic
931709531 2:64976677-64976699 AGTTATCCCCAGAAGGGCCAGGG + Intergenic
936521775 2:113216067-113216089 GAGTGTCCCCAGAGGGGCTGTGG + Exonic
939965451 2:148606126-148606148 TGTAATCCCCAAAGGGGCCTAGG - Intergenic
941730336 2:168910478-168910500 CATTACCCTCAGAGGGGACTGGG + Intronic
942531318 2:176913197-176913219 GTCTATACACAGAGGGGCCTTGG + Intergenic
947328381 2:229002327-229002349 GACTATGCCCAGAAGAGCCTTGG - Intronic
948381076 2:237550379-237550401 GATTAGCCCCAAAGGGCCCTGGG - Intronic
948588441 2:239035480-239035502 GAGCCTCCCCAGCGGGGCCTGGG + Intergenic
1171097739 20:22347995-22348017 GAGTATCCACAGAGTGGCCCTGG + Intergenic
1172470915 20:35194712-35194734 GACTAACCCCAGAGTGGCATGGG + Intergenic
1175259525 20:57665801-57665823 TGTTAGCCCCTGAGGGGCCTTGG - Intronic
1175386264 20:58597224-58597246 GATTACATTCAGAGGGGCCTCGG - Intergenic
1175812518 20:61866129-61866151 GATTTTGCCCAGAGGACCCTCGG + Intronic
1177207353 21:18025427-18025449 GATGATAGCCAGAGGGGCTTTGG - Intronic
1179905727 21:44422031-44422053 GCTCATCCGCAGAGGGGCCTGGG + Intronic
952760504 3:36909308-36909330 GATTTTCTCCAGTGTGGCCTGGG + Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
956201370 3:66709751-66709773 GTTTATCCCCTCAGGAGCCTAGG + Intergenic
961332865 3:126153341-126153363 CATTTTCTCCAGAGGAGCCTAGG + Intronic
961380187 3:126492002-126492024 GATTATCCCCAGAGGGGCCTTGG + Intronic
961380384 3:126492785-126492807 GATTATCCCCAGAGGGGCCTTGG + Intronic
964169816 3:153756616-153756638 GAATATCCCAAAAGGAGCCTTGG - Intergenic
978472626 4:109086775-109086797 GTTTCTACTCAGAGGGGCCTAGG + Intronic
985643423 5:1074209-1074231 CATTGTCCCCTCAGGGGCCTCGG - Intronic
988722219 5:33890564-33890586 GTTTATCACCCGAGTGGCCTTGG + Intronic
988961994 5:36379704-36379726 AATGATTCCCAGAGGGGTCTAGG + Intergenic
995235037 5:109818924-109818946 TGTTATCCCCAGAGGGTCCTGGG - Intronic
998185450 5:139975613-139975635 GATATTCCCCAGATGGCCCTAGG - Intronic
998388341 5:141771322-141771344 AGGTATCCCCAGAGGGGACTCGG - Intergenic
1005844789 6:29768964-29768986 GCATGTCCCCATAGGGGCCTGGG + Intergenic
1006730226 6:36230819-36230841 AAATATCCCCTGAGGGACCTTGG - Exonic
1019145435 6:169972734-169972756 CATTATCCTCAGAAGGCCCTGGG - Intergenic
1019284617 7:217300-217322 GATGACCCCAGGAGGGGCCTGGG - Intronic
1022261087 7:28705594-28705616 CATTTTCCCCAGAGGGACTTGGG - Intronic
1025794089 7:64721427-64721449 TATTCTCCCTAGAAGGGCCTTGG + Intergenic
1031361950 7:120857841-120857863 GACTATCCCCAGGCGGGCGTGGG - Exonic
1033163265 7:139015974-139015996 GATCATCCCCAGCAGGGCATTGG + Intergenic
1036183220 8:6602458-6602480 GATTCTCCCCAGAGAGGCTGGGG - Intronic
1037752386 8:21691346-21691368 GATTCTCCCCAGAGAGGACCAGG - Exonic
1044953332 8:97454680-97454702 GACAATTCCCAGAGAGGCCTTGG - Intergenic
1045387763 8:101687926-101687948 GATTCTCCATAGGGGGGCCTTGG + Exonic
1045683712 8:104689729-104689751 GATTATTACCATAGGGGCTTGGG + Intronic
1049162423 8:141105899-141105921 GATTCTTCCCAGAAGGGCGTGGG - Intergenic
1049445340 8:142627900-142627922 GAGTATCCCCGGTGGGGGCTGGG - Intergenic
1051162557 9:14224725-14224747 TGGTATCCCCAGTGGGGCCTGGG + Intronic
1052645957 9:31233273-31233295 GATTATTCTCAGAGATGCCTGGG - Intergenic
1059063607 9:111059337-111059359 AATTCTCCCCAAAGGGGCCAGGG - Intergenic
1060451925 9:123750776-123750798 GATTTCTCCCAGAGGGGCCCCGG + Intronic
1060738814 9:126084112-126084134 GATTATCCCCAGAAGACACTGGG + Intergenic
1062372391 9:136246816-136246838 GATTCTCCCCAGAGGGCCCCTGG + Intergenic
1186066898 X:5776166-5776188 GAAGACCTCCAGAGGGGCCTTGG + Intergenic
1187193917 X:17063037-17063059 GATGATCCCCAGAAGGAACTTGG + Intronic
1189915266 X:45850689-45850711 GACTATCCCAAGAGGGTCTTTGG + Intergenic
1198933034 X:141880159-141880181 TCTTATCCCCAGCAGGGCCTGGG - Intronic
1198963344 X:142204784-142204806 TCTTATCCCCAGCAGGGCCTGGG + Intronic
1200076614 X:153554413-153554435 GAATCTTGCCAGAGGGGCCTGGG + Intronic