ID: 961380862

View in Genome Browser
Species Human (GRCh38)
Location 3:126495852-126495874
Sequence CATGGTGGCCACACTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 12, 3: 50, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961380862_961380875 27 Left 961380862 3:126495852-126495874 CCCCTCCCAGTGTGGCCACCATG 0: 1
1: 0
2: 12
3: 50
4: 311
Right 961380875 3:126495902-126495924 CTTGTGTGTGCACCCTCTCAGGG 0: 1
1: 0
2: 0
3: 15
4: 139
961380862_961380874 26 Left 961380862 3:126495852-126495874 CCCCTCCCAGTGTGGCCACCATG 0: 1
1: 0
2: 12
3: 50
4: 311
Right 961380874 3:126495901-126495923 TCTTGTGTGTGCACCCTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 138
961380862_961380873 2 Left 961380862 3:126495852-126495874 CCCCTCCCAGTGTGGCCACCATG 0: 1
1: 0
2: 12
3: 50
4: 311
Right 961380873 3:126495877-126495899 GCTGGCACAAACAGTCACACAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961380862 Original CRISPR CATGGTGGCCACACTGGGAG GGG (reversed) Intronic
900585374 1:3430065-3430087 CATGCTGGACATACTGGTAGAGG - Intronic
900990432 1:6096000-6096022 CATGGAGGTGACCCTGGGAGAGG + Intronic
901050357 1:6423200-6423222 CAAGGTGGCCACCTTAGGAGTGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901476801 1:9495393-9495415 CCTGGTGGCCGCACGAGGAGTGG - Intergenic
902377669 1:16037453-16037475 CATGGGGTCCACACTAGGACTGG + Intergenic
902734820 1:18393346-18393368 CACCGTGGTCACCCTGGGAGTGG + Intergenic
903318075 1:22524601-22524623 CCTGGTGGCCACATGGGAAGTGG + Intronic
903377967 1:22878373-22878395 CATGGTGCCCATCCTGGGACAGG + Intronic
904451001 1:30611630-30611652 CATGATGGCCAGCCTGGAAGAGG - Intergenic
904877558 1:33668173-33668195 CATGGAGGCGACACTGGGCCAGG + Intronic
905013442 1:34761968-34761990 CAGGGTGCCCTCCCTGGGAGAGG - Exonic
905132554 1:35771771-35771793 CAAGCTGGCCACACTGGCAGTGG - Intergenic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
906040752 1:42786130-42786152 CTTGGAGGCCACACTGGGCAGGG + Intronic
913073392 1:115320885-115320907 AAGTGTGGCCTCACTGGGAGTGG + Intronic
914720750 1:150286848-150286870 CAAGGTGGGTAGACTGGGAGGGG - Exonic
917513767 1:175689742-175689764 CAGGGTGGCCAGACAGGGAGGGG + Intronic
919789147 1:201279016-201279038 CATGGTGACCAGACTGTGACAGG - Intergenic
919823018 1:201484703-201484725 GATGGTGGCCTCACTCAGAGTGG + Exonic
920928945 1:210368874-210368896 CATGTTGGCCAGACTGGTCGTGG - Intronic
922616254 1:226962922-226962944 CATGGAGTCCAGGCTGGGAGGGG - Intronic
1063455143 10:6177895-6177917 TGGGGTGGACACACTGGGAGTGG + Intronic
1064089677 10:12373016-12373038 CCTGGTGGCCACCCGGGAAGTGG - Intronic
1064223180 10:13459208-13459230 CATGGTGGCCAACTGGGGAGAGG + Intronic
1064370922 10:14751034-14751056 CATGGTGGCACATCTGGGAGGGG + Intronic
1064655055 10:17548409-17548431 CATGGTGGGCCTACAGGGAGGGG + Intergenic
1067046659 10:42989000-42989022 CATGGTGGCCAGAGAGGAAGGGG - Intergenic
1067064793 10:43097575-43097597 CATAGTGGCCTCACAGGGCGAGG - Intronic
1067370422 10:45677323-45677345 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067389366 10:45848872-45848894 CATGGTGGCCGCACAGAGAGTGG + Intronic
1067444886 10:46335672-46335694 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067502104 10:46814968-46814990 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067544964 10:47186204-47186226 CATGGTGAGCACTCTGGCAGTGG - Intergenic
1067592483 10:47525052-47525074 CATGGTGGCCGCACAGAGAGTGG + Intronic
1067639599 10:48033125-48033147 CATGGTGGCCGCACAGAGAGTGG + Intergenic
1067873897 10:49987183-49987205 CATGGTGGCCGCACAGAGAGTGG - Intronic
1069788484 10:71004778-71004800 CAGGGGGGCCACACAGGGATGGG - Intergenic
1069797280 10:71061573-71061595 CATCGTGGCCACACTGAGGAAGG + Intergenic
1070136577 10:73699237-73699259 CATGGTGGCCGCACAGAGAGTGG + Intergenic
1071137564 10:82469578-82469600 CATGGTGGCTAGAATAGGAGTGG + Intronic
1071514928 10:86291108-86291130 CATGGTGGCCACACTCTCTGGGG - Intronic
1073584146 10:104692512-104692534 CATGGTGCCTGCACTGGGATGGG + Intronic
1074355839 10:112782322-112782344 CTTGGAGGCCACACTGGAAAAGG + Intronic
1075029049 10:119008882-119008904 TTTGGTGGCCACACTGTGGGGGG + Intergenic
1075267050 10:121009845-121009867 ACTTGTGGCCACAGTGGGAGAGG - Intergenic
1075657060 10:124169008-124169030 CAAAGTGCCCATACTGGGAGTGG + Intergenic
1076825945 10:132968264-132968286 CATGATGCCCACACTGGGGAGGG - Intergenic
1076884478 10:133255491-133255513 CTTGGTGGCCACCCAGGGCGAGG + Intergenic
1076931278 10:133533502-133533524 CATGAGGGCCATCCTGGGAGAGG - Intronic
1077037466 11:502389-502411 CATGGTGGCCTTTCTGGGGGTGG - Exonic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1077336278 11:2006163-2006185 CATGGTGTCCTCACAGGTAGAGG - Intergenic
1078020236 11:7650951-7650973 CATGGAGGCCTCATTGTGAGTGG + Exonic
1078099469 11:8321270-8321292 CAGGGTGGGGTCACTGGGAGTGG + Intergenic
1078728802 11:13957269-13957291 CATGGTGTCCAGGCTGGGTGGGG + Intergenic
1079106247 11:17574187-17574209 GATGCTGGCCACACAAGGAGAGG + Intronic
1080531679 11:33182379-33182401 CTGTGTGGCCCCACTGGGAGAGG - Intergenic
1080868297 11:36214345-36214367 CATCTTGGCCACTTTGGGAGAGG + Intronic
1081767647 11:45622571-45622593 GATGGAGGCCACCCTGGGATGGG - Intergenic
1081999856 11:47388322-47388344 CATGGTTGAGACACTGGGAGAGG + Intergenic
1082086497 11:48054652-48054674 CCCGGGGGCCACACTGTGAGAGG - Intronic
1084730839 11:71072339-71072361 CACGGTGCACACACTGGGCGGGG + Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1087405174 11:97721645-97721667 CATTGTGGACAGACAGGGAGGGG + Intergenic
1087700904 11:101435277-101435299 GAAGGTGGCCACAGTGGGAGTGG + Intergenic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1089319419 11:117614870-117614892 AGTGTTGGCCACACTGTGAGGGG - Intronic
1089607900 11:119652226-119652248 CATGGTGACCACACCGGGTGGGG - Intronic
1090192158 11:124779713-124779735 CAAGCTGGCCACACTGGAAATGG + Intronic
1090698146 11:129269385-129269407 CATGATGGTCTCTCTGGGAGAGG + Intronic
1090845718 11:130528247-130528269 CAGGGTGGCTTCACTGGAAGAGG + Intergenic
1091303422 11:134522491-134522513 GATGGTGCCCACACAGGGAGTGG - Intergenic
1202819262 11_KI270721v1_random:61345-61367 CATGGTGTCCTCACAGGTAGAGG - Intergenic
1091791413 12:3274171-3274193 TTTGGTTGCCACAATGGGAGGGG - Intronic
1093041593 12:14387369-14387391 CTTGGTGGCGAGAGTGGGAGGGG + Intronic
1093320521 12:17707995-17708017 AAGGGTGTCCACACTGGGAGGGG + Intergenic
1094721052 12:33063934-33063956 CATGGTGGTCAGACTGGGTTGGG - Intergenic
1097190880 12:57219083-57219105 CTTGGTGCCAGCACTGGGAGTGG + Intronic
1097262315 12:57726639-57726661 CGTGGTGGCCGCGCTGGGCGTGG + Exonic
1101436670 12:104670135-104670157 CCTGCTGGCCTCACAGGGAGAGG + Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1102971952 12:117175597-117175619 GCTGGTGGCAACACTGGGACTGG - Intronic
1103620866 12:122186367-122186389 CATGCTGGCCACACTATGTGGGG - Intronic
1104580500 12:130007882-130007904 CATGGTGGCCACTCAGCCAGCGG - Intergenic
1104760260 12:131293906-131293928 CATTGTGGCTCCACAGGGAGAGG + Intergenic
1104819508 12:131666740-131666762 CATTGTGGCTCCACAGGGAGAGG - Intergenic
1104889883 12:132135000-132135022 CACCGTGGGCACACTCGGAGAGG - Intergenic
1105408611 13:20151453-20151475 CATGGGGGCTGCACTGGGACAGG - Intronic
1107435260 13:40376020-40376042 CATGATGGCCCCACTGGGAAGGG + Intergenic
1107832753 13:44389001-44389023 ACTTGTGGCCACACAGGGAGTGG - Intronic
1108461992 13:50676019-50676041 CATAGTGGGAACACTGGGGGAGG - Intronic
1108604761 13:52026422-52026444 CATTCTGGCCACATGGGGAGTGG + Intronic
1110857594 13:80313429-80313451 AATGCTGGTCACTCTGGGAGAGG + Intergenic
1111729638 13:92057239-92057261 CAAGGTAGCCAAACTGAGAGAGG + Intronic
1113364823 13:109666215-109666237 CATTCTGGCCAAACTGGGATGGG + Intergenic
1121584797 14:95055869-95055891 CACAGTGACCACACAGGGAGGGG + Intergenic
1121774819 14:96583730-96583752 CATGGTGGCCACGCCAGGAAGGG + Intergenic
1121840441 14:97129571-97129593 CATGGTGGCCAGACCAGGGGGGG + Intergenic
1122325634 14:100879473-100879495 CCTGGTGGCCTCAGTGGGGGTGG + Intergenic
1122615498 14:103015088-103015110 GATGGTGGCCAGGCTGGAAGTGG + Intronic
1122689995 14:103527770-103527792 CGTGGTGGCCCCACAGGGACAGG + Intergenic
1124106632 15:26744039-26744061 GATGTTGGTCACACTGGGAGGGG - Intronic
1124863612 15:33467802-33467824 CATGATTGCAACACTGGAAGGGG - Intronic
1126714769 15:51502933-51502955 CATGGGGCTCACACTAGGAGAGG + Exonic
1127960914 15:63890079-63890101 AATGATCGCCACTCTGGGAGGGG - Intergenic
1128450806 15:67804982-67805004 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1128618900 15:69132278-69132300 CACGGGGGCCACTCAGGGAGAGG + Intergenic
1130259251 15:82342978-82343000 CATGGAGGCTGCACCGGGAGAGG - Intronic
1130269425 15:82436187-82436209 CATGGAGGCTGCACCGGGAGAGG + Intronic
1130282014 15:82526205-82526227 CATGGAGGCTGCACCGGGAGAGG + Intergenic
1130473383 15:84242368-84242390 CATGGAGGCTGCACCGGGAGAGG + Intronic
1130480797 15:84356432-84356454 CATGGAGGCTGCACCGGGAGAGG + Intergenic
1130490915 15:84431327-84431349 CATGGAGGCTGCACCGGGAGAGG - Intergenic
1130502499 15:84510126-84510148 CATGGAGGCTGCACCGGGAGAGG - Intergenic
1131813827 15:96201834-96201856 CAGGGTGGCCATGCTGGAAGAGG - Intergenic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1132387716 15:101412029-101412051 CATGGGAGGCACACAGGGAGTGG + Intronic
1132597980 16:761895-761917 CATGGTGGCCTCCCTGAAAGGGG + Intronic
1132998116 16:2834594-2834616 CATGGTGGCCAGGCTGGGCCTGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135207262 16:20493899-20493921 CCTAGTGGCCACCTTGGGAGAGG + Intergenic
1135211623 16:20529733-20529755 CCTAGTGGCCACCTTGGGAGAGG - Intergenic
1135887582 16:26325375-26325397 CATGGTGGCTCCACTTTGAGAGG + Intergenic
1137406615 16:48194090-48194112 CAAGGTGTCCACATTGGGTGGGG - Intronic
1137558409 16:49487982-49488004 CATGGAGGCCACAGTGGCACAGG - Exonic
1138130873 16:54478903-54478925 AATGGTGGTCACAGTGGTAGTGG - Intergenic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1140420584 16:74815756-74815778 CAGGGTGGCCGCAGTGGAAGTGG + Intergenic
1141454012 16:84126394-84126416 TTTGGTCGTCACACTGGGAGTGG + Intronic
1141545091 16:84761521-84761543 CCTTGTGGCCCCACTGGGAGAGG - Intronic
1141577051 16:84970794-84970816 GATGGTGGCCACATGGGAAGTGG - Intergenic
1141827051 16:86487943-86487965 GATGCTGGCAACCCTGGGAGTGG - Intergenic
1142169533 16:88614229-88614251 CACAGTGGCCACACTTGGAGGGG + Intronic
1143375695 17:6465794-6465816 CTTGGAGGCCAGGCTGGGAGTGG - Intronic
1143840085 17:9725047-9725069 CAAGGTGGCCACACAGGGACAGG + Intronic
1144275892 17:13667829-13667851 CATGGTGGCTCCACTGCCAGGGG - Intergenic
1145193423 17:20867312-20867334 CATGGGGGCTACACTGCCAGCGG - Intronic
1145298601 17:21613769-21613791 CATGGGGGCTACACTGCCAGCGG + Intergenic
1145351641 17:22089582-22089604 CATGGGGGCTACACTGCCAGCGG - Intergenic
1145827115 17:27885319-27885341 CAAGGTGGCTTCACTGAGAGAGG - Intronic
1146408139 17:32557424-32557446 AAAGGTGGCCAAACTGGGTGGGG + Intronic
1146660444 17:34662122-34662144 CATGGTGCCCTCAGTGGCAGGGG + Intergenic
1146841725 17:36161038-36161060 CCTTATGCCCACACTGGGAGAGG - Intergenic
1146854037 17:36248998-36249020 CCTTATGCCCACACTGGGAGAGG - Intronic
1146869941 17:36372890-36372912 CCTTATGCCCACACTGGGAGAGG - Intronic
1146877298 17:36423971-36423993 CCTTATGCCCACACTGGGAGAGG - Intronic
1147072823 17:37973514-37973536 CCTTATGCCCACACTGGGAGAGG - Intergenic
1147084344 17:38053052-38053074 CCTTATGCCCACACTGGGAGAGG - Intronic
1147100292 17:38177018-38177040 CCTTATGCCCACACTGGGAGAGG - Intergenic
1147944185 17:44070965-44070987 CATGGAGTCCACGCTGGGCGCGG + Exonic
1148228435 17:45916041-45916063 CATGGTGGGCTGACTGGGACAGG - Intronic
1150083235 17:62260065-62260087 CCTTATGCCCACACTGGGAGAGG - Intergenic
1151842649 17:76628809-76628831 AATGATGGCCACAATGGGGGAGG - Intronic
1152030201 17:77837657-77837679 AATGGTGGCCTCCCTTGGAGAGG - Intergenic
1152430055 17:80243874-80243896 CATGAAGGCCAGGCTGGGAGGGG + Intronic
1152549876 17:81023960-81023982 CCTGGTGGACAGCCTGGGAGTGG - Intergenic
1152555500 17:81051064-81051086 CAGGGAGGCCACACCGGGAGTGG - Intronic
1152879363 17:82806602-82806624 GATGGGGGCCTCACAGGGAGGGG - Intronic
1152895273 17:82907306-82907328 CAAGGTGGTCACATTGGCAGGGG + Intronic
1153641591 18:7162489-7162511 CATGGTGGCAGGACAGGGAGCGG - Intergenic
1158669742 18:59464088-59464110 CATGGTGGAGACAGTGGGGGAGG - Intronic
1158860641 18:61588994-61589016 CATGGTGGCCTCATGTGGAGAGG - Intergenic
1160059268 18:75514782-75514804 CAGGGTGGTCTCACAGGGAGTGG - Intergenic
1160059444 18:75516062-75516084 GAAGGTGGCCTCAGTGGGAGGGG - Intergenic
1160388393 18:78512055-78512077 CATGGCGGCCCCACTGCCAGTGG - Intergenic
1160942386 19:1626554-1626576 CGCGGTGGCCACACAGGGTGCGG - Intronic
1161331791 19:3692081-3692103 CATGGTGGGCGCCCAGGGAGTGG - Intronic
1162382454 19:10339603-10339625 CATGGTGGCCATTCTGACAGAGG + Exonic
1162822150 19:13229532-13229554 CTTTGTGGCCACAAAGGGAGTGG - Intronic
1163262697 19:16200669-16200691 CAGCGTGGCCACACTGGGCTGGG + Intronic
1163390593 19:17027558-17027580 TGAGGTGGCCACACGGGGAGGGG - Intergenic
1164180379 19:22813173-22813195 CATGTTGGCCAGACTGGTGGAGG + Intergenic
1164721260 19:30433248-30433270 CATGCTGGTCACAGTGGGATGGG - Intronic
1165828535 19:38719239-38719261 GGTGGTGGCCAGAGTGGGAGAGG - Intronic
1166688065 19:44808051-44808073 GTCGCTGGCCACACTGGGAGAGG - Intergenic
1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG + Exonic
1167267324 19:48490057-48490079 CCTCGTGGCCACCTTGGGAGAGG - Intronic
1167793732 19:51695751-51695773 CATGGGGGACAAACTTGGAGGGG + Intergenic
926777647 2:16438351-16438373 AATGCTGGGCATACTGGGAGCGG + Intergenic
927251020 2:20994844-20994866 CATGGTGTTCAATCTGGGAGGGG - Intergenic
931960015 2:67471884-67471906 ATTTGTGACCACACTGGGAGTGG - Intergenic
933698708 2:85239021-85239043 CATGTTGGCCAAACTGGTATTGG + Intronic
933842591 2:86299369-86299391 TTTGGTTGCCACACTTGGAGTGG - Intronic
936603973 2:113929395-113929417 CATGGTGGCAGCACTTTGAGAGG - Intronic
936966902 2:118135725-118135747 CATGGTAACCACACAGGGAGAGG - Intergenic
937330602 2:121025939-121025961 CGTGGTGGCCACATTGTGAGTGG + Intergenic
938189386 2:129261973-129261995 CAAGGTGGCTCCACTGGAAGTGG + Intergenic
939059623 2:137404848-137404870 CTTGGTGGGAACAGTGGGAGGGG + Intronic
939133589 2:138267412-138267434 CTAGGTGGGCTCACTGGGAGCGG - Intergenic
942192967 2:173489118-173489140 CATTATGGCCACACTGGGGAAGG - Intergenic
942402933 2:175622538-175622560 CATGCAGGACAAACTGGGAGGGG - Intergenic
944316726 2:198292556-198292578 CAGGGAAGCCACACTGGGACGGG - Intronic
946158163 2:217820478-217820500 CATGGTGCCCCCACTTGCAGGGG + Intronic
946817090 2:223590298-223590320 CATGTTGGCAACAGTGGGGGTGG + Intergenic
1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG + Intergenic
1170887610 20:20355063-20355085 GAAGGTGGTCACACTGTGAGAGG + Intronic
1170887721 20:20355597-20355619 GAAGGTGGTCACACTGTGAGAGG + Intronic
1171300461 20:24055361-24055383 TATGGTGGGGACAGTGGGAGCGG + Intergenic
1171561985 20:26134807-26134829 CATGGGGGCTACACTGCCAGCGG - Intergenic
1172126160 20:32626544-32626566 CATGGTGGCAACACTGGACGGGG + Intergenic
1172126674 20:32628694-32628716 CCTGGTGGCCAGAGTGGAAGTGG + Intergenic
1172128287 20:32638546-32638568 CTTGGTGGCCACCCTGGAAGAGG + Intergenic
1172874945 20:38158454-38158476 CATGGTGGCCGGGCTGGGATGGG + Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174317553 20:49714068-49714090 GGCGGTGGCCGCACTGGGAGAGG - Intergenic
1174425499 20:50429330-50429352 CATGGTGATCTCCCTGGGAGAGG - Intergenic
1175843838 20:62048631-62048653 CAAGGTGGGCATACAGGGAGAGG - Intronic
1176144255 20:63558469-63558491 CAAGGAGGCCTCCCTGGGAGAGG - Intronic
1176269212 20:64226915-64226937 CATGGTGGCCACGCTTTGTGAGG + Intronic
1176649335 21:9530827-9530849 CATGGGGGCTACACTGCCAGTGG + Intergenic
1179494212 21:41761474-41761496 GAGGGAGGCCACACTGGTAGGGG - Intronic
1180984478 22:19896474-19896496 CATGTTGGCCACATGTGGAGGGG - Intronic
1181075606 22:20374057-20374079 CATGATGCCCAGCCTGGGAGAGG + Intronic
1181171324 22:21011776-21011798 GCTGGTGGGCACACAGGGAGGGG - Intronic
1181178027 22:21048752-21048774 GCTGGTGGGCACACAGGGAGGGG + Intronic
1182456000 22:30450930-30450952 GATGGTGGCCATGCTGGGATTGG + Intronic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
952851556 3:37733930-37733952 CAGGATGTTCACACTGGGAGTGG - Intronic
952886872 3:38017565-38017587 CATGGAGGGCACATTGGAAGCGG - Intronic
953354683 3:42245591-42245613 CAAGGTGGCAACAGTGGAAGTGG + Intergenic
953904071 3:46859469-46859491 CGTGCTGGCCACGCTGGGTGAGG - Exonic
954225390 3:49177785-49177807 CATAGTGGCCACCCTGGGATGGG + Exonic
954381378 3:50220908-50220930 CCCAGTGGCCACACTGGGATAGG + Exonic
954412163 3:50375550-50375572 GATGGTGGTCACAGTGGGAGAGG + Intronic
954414369 3:50385753-50385775 CATGGAGGCCAGAGTGGAAGCGG + Intronic
954618084 3:51980502-51980524 CATAGTGGCCACTCAGCGAGGGG - Exonic
954746616 3:52791028-52791050 CTTGGAGGCCACACTGGAGGTGG - Intronic
954800991 3:53186756-53186778 CATGGAGGGCAGACTGGAAGTGG - Intronic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
956713298 3:72057203-72057225 CATGCTGGGCACACTGGTATGGG - Intergenic
961053923 3:123770495-123770517 CATGGTGTCCACACAGGGAGTGG + Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961999131 3:131276475-131276497 CATGTGGGCCACTCTGGGAAGGG + Intronic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968817607 4:2829853-2829875 CATGATGGCAGCACTGGAAGTGG - Exonic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
968917085 4:3501291-3501313 CATGGTGCCGACAGTGGGAGCGG - Intronic
969179397 4:5425302-5425324 CATGGTGGCCCCACTGTCACAGG - Intronic
969960322 4:10938723-10938745 CATGGTGGTCATAAAGGGAGAGG - Intergenic
973573184 4:52261132-52261154 CAGGGAGGCCAGACGGGGAGGGG - Intergenic
975877829 4:78865634-78865656 AATGGTCAGCACACTGGGAGTGG - Exonic
979989242 4:127355018-127355040 CATGGCGGCCACCCTGGAATAGG + Intergenic
981179028 4:141716805-141716827 CATCCTGGGCACACTGGGTGGGG - Intronic
981625134 4:146746967-146746989 TAAGGTGGCCACACTGAGAAGGG + Intronic
981992159 4:150934669-150934691 CATGTTGGCCACACTGGTCTCGG - Intronic
983653292 4:170054895-170054917 GATGGTGGCCAGACTAGGAAAGG - Intergenic
985621839 5:960091-960113 CAGGATGGGCACACTGGGTGGGG - Intergenic
985699006 5:1359163-1359185 CCTGGAGGCCATTCTGGGAGGGG - Intergenic
985957157 5:3274398-3274420 CATGGTAGCCACATAGGGTGAGG - Intergenic
985970820 5:3377216-3377238 CTTGGTGGCAACACTGGCAGAGG - Intergenic
986672653 5:10156830-10156852 CATTCTGGGCACACTGGGACAGG + Intergenic
987082883 5:14441493-14441515 CGTGGTGACCACCTTGGGAGGGG + Intronic
987621893 5:20345780-20345802 CATTGTGGCCACTCTGGAATTGG - Intronic
991650425 5:68847117-68847139 CATGGTGGCCAGACTGGAAGGGG + Intergenic
991711077 5:69409210-69409232 CAGAGGGTCCACACTGGGAGAGG - Intronic
992093839 5:73342265-73342287 CAAGTGGGCCACACTGGGAAAGG + Intergenic
992449173 5:76860207-76860229 CTTGGTGGCCACAATGGGAGCGG - Intronic
993105475 5:83595693-83595715 CAAGGTGGACACACTGGCAGTGG + Intergenic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
997593699 5:135092055-135092077 AGTGGTGGCCAGACTGGGACAGG + Intronic
998482904 5:142477705-142477727 CATGTTGGCCACACTGGTGTGGG + Intergenic
998535898 5:142930484-142930506 CATGAAGGTCACACTGGGACTGG - Intronic
1000071450 5:157744098-157744120 CATGGTGGCCAAAGAGGAAGGGG + Exonic
1001754044 5:174152669-174152691 CAGGGTGGCCTCTCTGAGAGTGG - Intronic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1004120158 6:12813819-12813841 CCTGTGGGCCACACTCGGAGTGG - Intronic
1004449382 6:15730804-15730826 CATGTGGGCCACTCTGGGAAGGG + Intergenic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1006385056 6:33726273-33726295 CATGGGGCCCACACAGTGAGAGG - Intronic
1006391250 6:33760219-33760241 CATGGTAGCCACCCCTGGAGAGG + Intergenic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1007794647 6:44337670-44337692 CAAGGTGGAGACAGTGGGAGTGG + Intronic
1008503833 6:52209594-52209616 TCTGTGGGCCACACTGGGAGAGG + Intergenic
1010013362 6:71075435-71075457 CATGGTGACCCCTCTGGGATGGG + Intergenic
1010850336 6:80767998-80768020 CTTGGCAGCCTCACTGGGAGGGG + Intergenic
1013607310 6:111762214-111762236 GCTGGGGGCCACCCTGGGAGAGG + Intronic
1014251244 6:119117500-119117522 CAAGGTGACCACAGTGGAAGAGG - Intronic
1015253086 6:131147707-131147729 CATGGTGGGCACACAGGGCATGG - Intronic
1016314373 6:142770434-142770456 CAGGGTGGCCACGCTGTCAGAGG + Exonic
1017068534 6:150551660-150551682 CATGTTGGCCAGGCTTGGAGTGG + Intergenic
1018431822 6:163728887-163728909 GATTGTTGCCACACTGGGAGAGG + Intergenic
1018626915 6:165788908-165788930 GATGGTGCACACACTGGGGGTGG - Intronic
1019065375 6:169291829-169291851 CAAGGTGGCCACAGTCTGAGAGG - Intergenic
1019285233 7:219982-220004 CTTTGTGTCCACACTGGGTGTGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019584119 7:1787456-1787478 CCTGGGGACCACACTGGGAAGGG - Intergenic
1020420081 7:7993535-7993557 AATAGTAGCCAAACTGGGAGGGG - Intronic
1022477494 7:30721231-30721253 CATGGTGGTGATATTGGGAGAGG - Intronic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1025275881 7:57580886-57580908 CATGGGGGCTACACTGCCAGTGG + Intergenic
1025637943 7:63340053-63340075 CTTGGTGGCCTCCATGGGAGTGG + Intergenic
1025644753 7:63408046-63408068 CTTGGTGGCCTCCATGGGAGTGG - Intergenic
1025850279 7:65238903-65238925 CATGGTCGCCAGGCTGGGGGTGG + Intergenic
1026369600 7:69685461-69685483 GATGGTGGCCAAACAGGAAGTGG - Intronic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1029647517 7:101867521-101867543 CACCGTGGGCACACTGGGAGGGG + Intronic
1029952691 7:104603832-104603854 CATGCTGGGCACACTGGGGTGGG + Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1032135151 7:129269690-129269712 TATGGTGGCTACACTTTGAGAGG - Intronic
1032858784 7:135858696-135858718 CAGGGAGGCACCACTGGGAGTGG + Intergenic
1033657026 7:143381428-143381450 CAGGGCGGCCCCACGGGGAGGGG + Intronic
1039135979 8:34323195-34323217 CATGGTGGCCAAAGTGGACGAGG - Intergenic
1041880798 8:62747717-62747739 CATTGTGGTCAAACTGTGAGTGG - Intronic
1042621123 8:70705574-70705596 CAAGGAGGCCATACTGGAAGTGG + Intronic
1042898423 8:73695752-73695774 GTTGGTGGCCACACAAGGAGAGG + Intronic
1045268339 8:100640476-100640498 CATGCAGCCCACACTGAGAGTGG - Intronic
1045661278 8:104440553-104440575 CATGTTGGCCAGACTGGTCGAGG - Intronic
1049017654 8:139932266-139932288 CATGGTGGCTACCCTGAGCGAGG - Exonic
1049841665 8:144777283-144777305 CAAGGTGCCCAGACTGAGAGGGG + Intronic
1053243841 9:36518471-36518493 TATGTTGGCCACACTGGGTCTGG + Intergenic
1054765273 9:69037631-69037653 CATGCTGTCCACACAGGCAGGGG - Intronic
1056756169 9:89383274-89383296 CATGTAGTCCACACTGGGGGTGG - Intronic
1057043771 9:91867753-91867775 CACTGTGGCCAGACTGGGACGGG - Intronic
1057141200 9:92727749-92727771 TTTGGTGGCTACACGGGGAGTGG - Intronic
1057925350 9:99142088-99142110 CAGTGTGGCCACAGTGGGAATGG - Intronic
1057939801 9:99271976-99271998 CAGGGTGGGCACTGTGGGAGGGG + Intergenic
1058428698 9:104899197-104899219 GATGGTGGCCAAGCTGGGATTGG + Intronic
1059421688 9:114196287-114196309 GAAGGTGGCCTCCCTGGGAGCGG - Intronic
1060152866 9:121299842-121299864 CATGGTGGCGACAGCGGCAGGGG - Exonic
1060754866 9:126205559-126205581 CATGCTGGCCACACTCGATGAGG - Intergenic
1061952072 9:133942273-133942295 AACGGTGGCCACCCTTGGAGTGG - Intronic
1062123785 9:134848639-134848661 GGTGGTGTCCGCACTGGGAGCGG - Intergenic
1062542260 9:137046685-137046707 CCTGGTGGCCTCACTGAGCGCGG - Intergenic
1203627076 Un_KI270750v1:34375-34397 CATGGGGGCTACACTGCCAGTGG + Intergenic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1187280105 X:17852072-17852094 GATGGTTGCAACACTGGGAGAGG - Intronic
1188696418 X:33197318-33197340 CATGGTATCAACATTGGGAGAGG - Intronic
1189373068 X:40445401-40445423 CATGGTGGGGAGGCTGGGAGAGG - Intergenic
1190027544 X:46939115-46939137 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1190320727 X:49177811-49177833 CATAGTGGGGACATTGGGAGTGG + Intronic
1190499501 X:51060562-51060584 TTTGGTGGCCACACTGCCAGTGG - Intergenic
1192053333 X:67746941-67746963 CTTGGTGGGCAGACTGGCAGAGG + Intergenic
1194099500 X:89686238-89686260 GCTGTTGGCCACACGGGGAGAGG - Intergenic
1194377611 X:93154307-93154329 CATGGAGGCCACACTGCCAGTGG - Intergenic
1195407103 X:104526912-104526934 CATGGTCTCCCCACTGGGATTGG + Intergenic
1197769386 X:130080473-130080495 CATTGTGGCCAAACTGGGATCGG + Intronic
1199084268 X:143610643-143610665 CATGGTGCCCACATCGGGTGAGG - Intergenic
1199222873 X:145337742-145337764 CATGGGGGCCAGACAGGCAGAGG + Intergenic
1199746333 X:150774080-150774102 AATGGAGGCCACAGTGGCAGGGG - Intronic
1200452505 Y:3347616-3347638 GCTGTTGGCCACACGGGGAGAGG - Intergenic
1202073242 Y:21014337-21014359 CCTGGTGGCCACATCAGGAGAGG - Intergenic
1202077942 Y:21056191-21056213 CCTGGTGGCCACATCAGGAGAGG - Intergenic
1202369601 Y:24187903-24187925 CCTGGAGGCCACCCTGGAAGAGG - Intergenic
1202377431 Y:24250305-24250327 CAGGCTGGCCACATTGGGTGAGG + Intergenic
1202493349 Y:25419816-25419838 CAGGCTGGCCACATTGGGTGAGG - Intergenic
1202501184 Y:25482214-25482236 CCTGGAGGCCACCCTGGAAGAGG + Intergenic