ID: 961381108

View in Genome Browser
Species Human (GRCh38)
Location 3:126497102-126497124
Sequence GACGTGGTCACCTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961381108_961381119 21 Left 961381108 3:126497102-126497124 CCTCCTCCACAGGTGACCACGTC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 961381119 3:126497146-126497168 ACTCTGAGTCTGTGTAACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 206
961381108_961381111 -9 Left 961381108 3:126497102-126497124 CCTCCTCCACAGGTGACCACGTC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 961381111 3:126497116-126497138 GACCACGTCTCCCCTCTGCCTGG 0: 1
1: 0
2: 3
3: 21
4: 191
961381108_961381118 20 Left 961381108 3:126497102-126497124 CCTCCTCCACAGGTGACCACGTC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 961381118 3:126497145-126497167 TACTCTGAGTCTGTGTAACCTGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961381108 Original CRISPR GACGTGGTCACCTGTGGAGG AGG (reversed) Intronic
900580518 1:3406349-3406371 GCCCTGGGCACCTGTGGAGGAGG + Intronic
901162196 1:7187040-7187062 GAGGTGCTCACCTGTGATGGGGG + Intronic
903170449 1:21549218-21549240 GACGTGCTCACCTAGGGAGAGGG - Intronic
905173320 1:36121958-36121980 GAAGAGGTCACATGTGGGGGTGG - Intronic
905256140 1:36686722-36686744 GATGTGGACACCTGTGGAGCAGG + Intergenic
906322059 1:44823058-44823080 GGTGTGGTCACCTCTGGCGGCGG + Exonic
906844888 1:49181193-49181215 GAATTGGGCACATGTGGAGGTGG - Intronic
908187550 1:61667165-61667187 GATGTGGACACCCCTGGAGGGGG - Intergenic
908755967 1:67468974-67468996 GACCTGGGAACGTGTGGAGGAGG + Intergenic
912560892 1:110550810-110550832 GATGTGGACATCTTTGGAGGTGG + Intergenic
912860722 1:113211458-113211480 GTAGTGGTCACCCCTGGAGGGGG + Intergenic
919535479 1:198782246-198782268 GACATGCTTACCTGTGGACGGGG + Intergenic
922817013 1:228457159-228457181 GGGGTGGCCACCTGTGGACGAGG + Exonic
924093506 1:240526184-240526206 GACGTGGGCATCTTTGGAGGGGG + Intronic
1069630205 10:69892987-69893009 GACCTGGTCACCTGTGGTCTGGG + Intronic
1077264333 11:1641671-1641693 GAGGTGGTCTCAAGTGGAGGTGG - Intergenic
1077264434 11:1641987-1642009 GAGGTGGTCTCGGGTGGAGGTGG - Intergenic
1077860403 11:6172945-6172967 GATGTGGATACCTGGGGAGGGGG + Intergenic
1078899281 11:15626472-15626494 GACGTGGACATTTTTGGAGGAGG + Intergenic
1080302645 11:30801151-30801173 GAAGTGGTCAGTTGTGGTGGGGG + Intergenic
1083322113 11:61854189-61854211 GACGGGGACTCCTCTGGAGGAGG + Intronic
1085048675 11:73368219-73368241 GACCTGGTCACCTGGGGTGGGGG + Exonic
1090598758 11:128347622-128347644 GAGGCCTTCACCTGTGGAGGCGG - Intergenic
1090890510 11:130918747-130918769 CGGGTGGTCAGCTGTGGAGGGGG + Intergenic
1091100872 11:132872475-132872497 GAGTTGCTCACTTGTGGAGGTGG - Intronic
1091656946 12:2353083-2353105 GGCGAGGTCACCTGTGGAATTGG + Intronic
1097199925 12:57269741-57269763 GAGCTGCTCACCTGTTGAGGGGG + Exonic
1097232699 12:57522334-57522356 GACATGTTGACCTGGGGAGGCGG + Intronic
1098766908 12:74502399-74502421 GAAGTGGTCCCCTGTGTATGAGG - Intergenic
1100619199 12:96255399-96255421 GATGAGGTCACTTGTGGAGAGGG + Intronic
1103547663 12:121713262-121713284 GGCGTGTTCATCTGTGGGGGTGG + Intronic
1103893357 12:124256282-124256304 TAGGTGGTTACCTGGGGAGGGGG - Intronic
1104091763 12:125523575-125523597 GACGTGGACATCTCTGGAGGGGG + Intronic
1104614238 12:130255131-130255153 GGTGTGGTGACCTGCGGAGGAGG + Intergenic
1109030689 13:57184078-57184100 GTCCTGGTGACCTGTGCAGGTGG + Intergenic
1109511136 13:63376170-63376192 GATGTGGTCATTTTTGGAGGGGG - Intergenic
1112318385 13:98385135-98385157 GACGTGGTCACCTAGGGACAAGG + Intronic
1114209230 14:20601443-20601465 GGGGTGGTTACCTGTGAAGGGGG - Intronic
1114411146 14:22501618-22501640 AACATGCTCACCTTTGGAGGGGG + Intergenic
1115766780 14:36631234-36631256 CACATGGACACATGTGGAGGGGG + Intergenic
1117189677 14:53277763-53277785 GGGGTGGTTACCTGTGGATGAGG + Intergenic
1117383658 14:55190456-55190478 GAGGGGGTCACCTGTGTAGCTGG + Intronic
1123663240 15:22585037-22585059 GGCGTGGACAACTGTGGATGTGG - Intergenic
1123920189 15:25064649-25064671 GACGTGGTGACCAGTGGACGTGG + Intergenic
1124259339 15:28174464-28174486 GGCGTGGACAACTGTGGATGTGG - Exonic
1124317069 15:28679475-28679497 GGCGTGGACAACTGTGGATGTGG - Intergenic
1124579815 15:30943662-30943684 GAGGTGGACTCCTGTGAAGGAGG - Intronic
1125759086 15:42084936-42084958 CAGGTGGTCACCTGTGGCTGTGG - Intronic
1128609282 15:69060979-69061001 GCAGTGGTTAACTGTGGAGGAGG + Intronic
1128725565 15:69986120-69986142 TAGGTGGTGAGCTGTGGAGGTGG - Intergenic
1129219909 15:74126128-74126150 AAGGTGCTCCCCTGTGGAGGAGG + Intronic
1129480112 15:75817316-75817338 GAAATGGTTCCCTGTGGAGGGGG - Intergenic
1129685758 15:77685226-77685248 GAAGGGGTGATCTGTGGAGGAGG + Intronic
1130098495 15:80873962-80873984 GCAGTGCTCACCTGTGGATGTGG - Exonic
1132056682 15:98656199-98656221 GATGTGCACACCTGTGGATGGGG + Intronic
1132556584 16:575348-575370 GATGAGGTCCCCTGTGGAAGGGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1132830519 16:1925796-1925818 CACGTGGGCACAGGTGGAGGGGG + Intergenic
1132915567 16:2341592-2341614 GTCGGGGTCACCTGAGGAGGTGG + Intergenic
1133039672 16:3053766-3053788 GAAGTGGTCAGCTGTGGCTGGGG + Intronic
1133043519 16:3073399-3073421 GAAGTGGTCAGCTGTGGCTGGGG + Intronic
1133284758 16:4685453-4685475 GCAGTCGTCATCTGTGGAGGCGG + Intronic
1135591129 16:23705934-23705956 GTCGGGGTCACCTGGGGAGTCGG + Intronic
1136294351 16:29293209-29293231 GATGTGGTGACGGGTGGAGGTGG - Intergenic
1136674976 16:31894828-31894850 GCCGTGAACTCCTGTGGAGGTGG + Intronic
1137425684 16:48378460-48378482 GAGGTGGTTTCCTGTGAAGGGGG + Intronic
1139762042 16:69192195-69192217 GAGGTGATCACCTTTGGAGCCGG + Intronic
1139872756 16:70120622-70120644 CAGGTGGTCATCTGTGGAGGTGG + Exonic
1140363021 16:74360708-74360730 CAGGTGGTCGTCTGTGGAGGTGG - Intergenic
1141930926 16:87202285-87202307 GAGGTGGACACCTGTGATGGAGG + Intronic
1142100256 16:88267256-88267278 GATGTGGTGACGGGTGGAGGCGG - Intergenic
1143780532 17:9226497-9226519 GAGGTGGTCTCGTGGGGAGGTGG + Intronic
1143780537 17:9226513-9226535 GAGGTGGTCTCGTGGGGAGGCGG + Intronic
1144727566 17:17509535-17509557 GAAGTAATCACCTGTGGATGAGG + Exonic
1148564938 17:48627046-48627068 GACGTTGTCCGCTTTGGAGGGGG + Intronic
1150472170 17:65446609-65446631 GACATGGGCACGTGTGCAGGTGG + Intergenic
1151536059 17:74739356-74739378 AAGGAGGTAACCTGTGGAGGGGG - Intronic
1152465298 17:80462851-80462873 GACCTGGTCACATGAGGAGTGGG - Intergenic
1152592319 17:81219781-81219803 CACTTGTTCACCTGTGGAGCTGG + Intronic
1153394199 18:4599462-4599484 GACTTGGGCTCCTGTGGTGGAGG + Intergenic
1157196231 18:45622369-45622391 TAGGTGGTCACCTGTGAGGGAGG + Intronic
1157580829 18:48773323-48773345 CACGTGGTCTCTTGTGGAGAGGG + Intronic
1158559977 18:58505489-58505511 GACCAGGGCACCTGTAGAGGAGG - Intronic
1159198360 18:65148671-65148693 GACGTGGTCACATTAGAAGGTGG - Intergenic
1159537776 18:69736833-69736855 GAAATGGTGACCTGTGGAGAAGG + Intronic
1161221126 19:3118731-3118753 GCGGTGGTCACCCCTGGAGGCGG + Intronic
1161350001 19:3786158-3786180 GACGTGCTCACCTGCTCAGGGGG + Intronic
1162443397 19:10707348-10707370 GACTGGGCCACGTGTGGAGGAGG + Exonic
1162919664 19:13893131-13893153 GACGAGCTCACCTGGGAAGGAGG + Exonic
1163834198 19:19563297-19563319 GCCGTGGTGACAAGTGGAGGTGG + Intronic
1164549920 19:29201386-29201408 CACCTGGTCACCTGATGAGGGGG - Intergenic
1164619991 19:29689674-29689696 GACCTGGTGTCCAGTGGAGGAGG + Intergenic
1165240967 19:34467003-34467025 GCCATACTCACCTGTGGAGGTGG - Exonic
1166646526 19:44535895-44535917 GATGTGGGCACCTTTGGTGGGGG + Intergenic
1168072800 19:53962225-53962247 GACGGGGGCTCCTGGGGAGGAGG + Intergenic
925306345 2:2850151-2850173 GACTTCCTCACCTGTGAAGGAGG - Intergenic
925712857 2:6758496-6758518 GACATGGGCACCTGTGGGAGAGG - Intergenic
927645713 2:24875558-24875580 GACAGGGTCACCTGGGAAGGTGG + Intronic
928318441 2:30264172-30264194 GACATGGACATCTGTGGGGGTGG - Intronic
928890442 2:36197658-36197680 GACGTGGACATATCTGGAGGTGG - Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
929788922 2:45009995-45010017 GACGCGGTGACCTGGGGAGAAGG - Intergenic
942901366 2:181123879-181123901 GAGGTGGTTTCCTGTGGAGCAGG - Intergenic
945909765 2:215635407-215635429 CACCTGGTTACCAGTGGAGGGGG + Intergenic
948159053 2:235809198-235809220 TACCTGCTCATCTGTGGAGGGGG + Intronic
1170801526 20:19594253-19594275 TACATGGTGACCTGTGTAGGGGG - Intronic
1171985223 20:31655488-31655510 GACGTGGGCACTTGTTGACGTGG + Intergenic
1172017299 20:31884874-31884896 GACATGGACATCTTTGGAGGTGG + Intronic
1172663898 20:36586039-36586061 GTAGTGGTCAGCTGTGGGGGAGG + Intronic
1173572516 20:44086612-44086634 GTGGTGGTTACCTGGGGAGGTGG - Intergenic
1174115483 20:48223944-48223966 GACGTGGACACCTTTCGTGGGGG - Intergenic
1176088627 20:63309264-63309286 GACGGGGCCACCTGCGGTGGGGG - Intronic
1176144449 20:63559360-63559382 GAGGTGGTCTCCTGTGAGGGTGG + Exonic
1177377694 21:20294582-20294604 GATGTGGACATCTTTGGAGGTGG + Intergenic
1178368029 21:32003868-32003890 GATGTGGATACATGTGGAGGGGG - Exonic
1179974649 21:44857600-44857622 GACGGTGTCACCTGTGGTGGTGG - Intronic
1180139713 21:45886087-45886109 GACGTGGTGAGGTGTGGAGGAGG + Intronic
1180139724 21:45886139-45886161 GACATGGTGAGGTGTGGAGGAGG + Intronic
1180139748 21:45886240-45886262 GATGTGGTGAGGTGTGGAGGAGG + Intronic
1180139761 21:45886292-45886314 GATGTGGTGAGGTGTGGAGGAGG + Intronic
1180139795 21:45886442-45886464 GATGTGGTGAGGTGTGGAGGAGG + Intronic
1180139808 21:45886494-45886516 GACGTGGTAAGGTGTGGAGGAGG + Intronic
1180139820 21:45886546-45886568 GATGTGGTGAGGTGTGGAGGAGG + Intronic
1180139832 21:45886598-45886620 GACGTGGTGAGGTGTGGAGGAGG + Intronic
1180139847 21:45886650-45886672 GATGTGGTGAGGTGTGGAGGAGG + Intronic
1181112445 22:20610031-20610053 CTCGTAGACACCTGTGGAGGTGG - Intergenic
1181935627 22:26436417-26436439 GACGGGGTGCCCTGGGGAGGTGG + Intronic
1183745770 22:39690963-39690985 GCCGTGGGAATCTGTGGAGGAGG + Intergenic
1185172484 22:49301955-49301977 CGCGGGGTCACCTCTGGAGGAGG + Intergenic
949654565 3:6202378-6202400 GAAATGGTCTCCTGTGGATGAGG + Intergenic
951244336 3:20323375-20323397 GACGAAGAAACCTGTGGAGGGGG + Intergenic
953249707 3:41233586-41233608 AATGTGGTCACCTGTGCAGCTGG + Exonic
955291114 3:57693042-57693064 GGCGCGGTCCGCTGTGGAGGCGG - Exonic
955469732 3:59273891-59273913 CACGAGGTCACCTTTGGAAGGGG + Intergenic
956733006 3:72214026-72214048 GACGTGGACCTCTTTGGAGGAGG + Intergenic
959166737 3:102789439-102789461 TTCCTGGGCACCTGTGGAGGAGG + Intergenic
960709001 3:120508226-120508248 GCCAAGGTCACCTATGGAGGCGG + Intergenic
961200431 3:125041259-125041281 GTAGTGGTCACCTTTGGAGAGGG - Intronic
961321967 3:126082903-126082925 GGCGAGGTCCCCTGTGAAGGTGG - Intronic
961329099 3:126128521-126128543 GGCGAGGTCCCCTGTGAAGGTGG + Intronic
961381108 3:126497102-126497124 GACGTGGTCACCTGTGGAGGAGG - Intronic
961429097 3:126867736-126867758 GACTTGGTCACCAGTGGATTGGG - Intronic
962228126 3:133633459-133633481 GAGGTGCTCACCTTTAGAGGAGG - Intronic
962249575 3:133827558-133827580 GCTGTGGTCACCTGAGGATGTGG - Exonic
966277692 3:178195285-178195307 GAGGTGGTCAGCTGTGAAGAGGG - Intergenic
967784058 3:193470828-193470850 GAGGTTGTCAGCTGTGGAGATGG + Intronic
968337363 3:197925203-197925225 GATGAGGTCATCTGTGGGGGAGG + Intronic
968337380 3:197925260-197925282 GATGAGGTCATCTGTGGGGGAGG + Intronic
968337399 3:197925317-197925339 GACGAGGTCATCTGTGGGGGAGG + Intronic
968337416 3:197925374-197925396 GACGAGGTCATCTGTGGGGGAGG + Intronic
968337435 3:197925431-197925453 GATGAGGTCATCTGTGGGGGAGG + Intronic
968472837 4:789918-789940 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472864 4:789996-790018 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472894 4:790072-790094 GGCGTGGCCACCTGTTGGGGTGG - Intronic
974793116 4:66714889-66714911 GACGTGGTGACCTTTGGATGGGG - Intergenic
985812022 5:2097292-2097314 GACGTGGTCGCCAGGGGACGAGG - Intergenic
985929352 5:3044532-3044554 GATATTGTGACCTGTGGAGGTGG + Intergenic
986276667 5:6281260-6281282 GACTTGGTGACCTGTGGGGTGGG - Intergenic
986571482 5:9170520-9170542 AACGTGGTCATATTTGGAGGTGG + Intronic
986594529 5:9407630-9407652 CAAGTGTTCACCTGTGGAAGAGG + Intronic
988511622 5:31869218-31869240 GACTTGGTCAGCTGTGCGGGAGG + Intronic
993111582 5:83663472-83663494 GATGAGATCACCTGGGGAGGGGG - Intronic
999008434 5:148007517-148007539 GCCGAGGACACCTGTGGTGGTGG + Intergenic
999229285 5:150052277-150052299 GAAGTGGTCTCCTGTGGGGAGGG + Exonic
999377695 5:151098167-151098189 TTTGTCGTCACCTGTGGAGGTGG - Intergenic
1000978187 5:167787734-167787756 CAGGTGTTCACCTGTGCAGGTGG + Intronic
1001966735 5:175914792-175914814 GCTGTGGTCAGGTGTGGAGGTGG - Intergenic
1002250213 5:177924412-177924434 GCTGTGGTCAGGTGTGGAGGTGG + Intergenic
1002309744 5:178307121-178307143 GATGCGGCCACCTGGGGAGGGGG - Intronic
1003175424 6:3750352-3750374 CAGGTGGTCACCCATGGAGGGGG + Intronic
1006694905 6:35922677-35922699 GACGTGGACACCTGTAGGTGGGG + Intergenic
1017246917 6:152236927-152236949 GACGTGGTCCCATCTGGATGAGG - Exonic
1019804271 7:3111546-3111568 AAAGTGGTCACCTGGGGAGAGGG + Intergenic
1019908387 7:4082129-4082151 GAGGGGGCCACCTGAGGAGGGGG + Intronic
1023499146 7:40829732-40829754 GACATGGTCATCTGTGGAGTAGG - Intronic
1026648303 7:72192396-72192418 GACGTGGGAATCTGTGGATGGGG + Intronic
1034453071 7:151148294-151148316 GAGGTGGACTCCTGGGGAGGGGG - Intergenic
1035945311 8:3955172-3955194 CACGTGGTCACGGGTGGTGGAGG - Intronic
1037596183 8:20356231-20356253 TGGGTGGTCACCTGGGGAGGAGG - Intergenic
1043748827 8:83909542-83909564 GATGTGGTGACCTTTGGATGGGG - Intergenic
1045646598 8:104305526-104305548 GAGGTGGTCAGCTGTGGACGTGG + Intergenic
1049432874 8:142573468-142573490 GCTGTTGTCACCTGTGGAGGTGG - Intergenic
1049729479 8:144168570-144168592 GACATAGGCACGTGTGGAGGGGG - Intronic
1050652778 9:7791187-7791209 GGCATGGTTACCTGTGGAGTGGG - Intergenic
1051167567 9:14280642-14280664 AACGTTGTCTCCTGTGGAAGTGG - Intronic
1051244295 9:15093481-15093503 GACATGGACATCTCTGGAGGAGG + Intergenic
1056761521 9:89418965-89418987 GACGGGGGCTCCTGTAGAGGAGG - Intronic
1057187420 9:93064721-93064743 GAGGAAGTCAGCTGTGGAGGTGG + Intronic
1057632016 9:96727105-96727127 GAGGTTGTCACCTCTTGAGGTGG + Intergenic
1062305794 9:135906796-135906818 GACGCGGTCACCTGGCGAGTGGG - Intronic
1186052576 X:5614625-5614647 GAAGTTGTCACCTGAGAAGGAGG - Intergenic
1187067013 X:15850631-15850653 GACTTGGTCACCTCTAGAAGTGG - Intronic
1187173525 X:16873179-16873201 GAGGTGATTACCTGTGGGGGTGG - Intergenic
1189845975 X:45138918-45138940 GACCTGCTCCCCTGTGGATGGGG + Intergenic
1190339910 X:49287817-49287839 GCTGTGGTCTCCTGTGGATGTGG + Exonic
1192118756 X:68435053-68435075 GACATGGACATCTGTGAAGGAGG + Intergenic