ID: 961381360

View in Genome Browser
Species Human (GRCh38)
Location 3:126498323-126498345
Sequence TGGGACACAGAGAGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 0, 2: 11, 3: 70, 4: 699}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961381360_961381379 30 Left 961381360 3:126498323-126498345 CCCTGTCCCCTCTCTGTGTCCCA 0: 1
1: 0
2: 11
3: 70
4: 699
Right 961381379 3:126498376-126498398 GCTGTACCATCTCTAGCTACAGG 0: 1
1: 0
2: 0
3: 7
4: 62
961381360_961381371 8 Left 961381360 3:126498323-126498345 CCCTGTCCCCTCTCTGTGTCCCA 0: 1
1: 0
2: 11
3: 70
4: 699
Right 961381371 3:126498354-126498376 AGCCCTCCATCCCTGCCTCCTGG 0: 1
1: 0
2: 3
3: 59
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961381360 Original CRISPR TGGGACACAGAGAGGGGACA GGG (reversed) Intronic
900161251 1:1225029-1225051 AGGGACACAGACTGGGGACACGG + Intronic
900538881 1:3192906-3192928 TGAGTCCCAGAGAGGGGCCAAGG - Intronic
900908015 1:5574620-5574642 TGAGGCACAGAGAGGGGTCAAGG - Intergenic
900956277 1:5888049-5888071 TGGGGCCCAGGGAGGGGCCATGG + Intronic
900991755 1:6101348-6101370 GGGGACAGAGAATGGGGACAGGG + Intergenic
901206031 1:7496424-7496446 GGGGACACAGACAGTGCACACGG - Intronic
901778733 1:11578488-11578510 TGGGACACAGAACAGGGACGGGG + Intergenic
901790547 1:11651548-11651570 TGAGGCACAGAGAGGTGAAACGG + Intronic
901810748 1:11765763-11765785 TCGGAGCCAGGGAGGGGACAGGG - Intronic
902051604 1:13567746-13567768 AGAGACACAGAGAGGAGAGAGGG + Intergenic
902191532 1:14766557-14766579 TGGATCACAGAGAGGGGCCTTGG + Intronic
902583806 1:17425947-17425969 TGGGACCCAGAGAGGGGGCTGGG - Intronic
903064984 1:20694542-20694564 TAAGCCAGAGAGAGGGGACAAGG + Intronic
903134693 1:21301956-21301978 TGAGGCTCAGAGAGGTGACATGG + Intronic
903316879 1:22515034-22515056 GGGTACACAGTGAGAGGACAGGG + Intronic
903326212 1:22570003-22570025 TGAGACTCAGAGAGGTGAAATGG - Intronic
903729278 1:25478798-25478820 TTGGACACAGACAGGGCCCATGG - Intronic
903772150 1:25770724-25770746 GGGCAGACAGAGAGGGGAGAAGG - Intronic
904323038 1:29709032-29709054 TGGGCCACAGAAAGGGGCAAGGG + Intergenic
904768876 1:32870297-32870319 GGGGACACAGAGAGAGGCCCAGG + Intronic
905478561 1:38245820-38245842 TGTGACACAGAAAGCTGACATGG - Intergenic
905746604 1:40423598-40423620 TGAGACACGGAGAAAGGACATGG + Intergenic
905908906 1:41640411-41640433 TTGCACCCAGAGAGGGAACACGG - Intronic
906063536 1:42963487-42963509 AGGGAGACAGAGAGGGGTCAGGG - Intergenic
906200049 1:43954185-43954207 TGGCACAAAGAGAAGGGGCAGGG - Intronic
906301051 1:44681915-44681937 TGGCGCACAGAGAAGAGACATGG - Intronic
906520876 1:46466357-46466379 GGGGATTCAGAGAGGGGACCCGG + Intergenic
906702582 1:47870703-47870725 TGGGACACAGACATGGGAGGAGG + Intronic
907110612 1:51923220-51923242 TGAGACTCAGAGATGGGCCAGGG + Intronic
907408989 1:54271697-54271719 TGGGAAAGAGACTGGGGACATGG - Intronic
907515508 1:54991029-54991051 TGGGACACACAGTGGGGAGTGGG - Intronic
907635796 1:56133785-56133807 TGAGGCCCAGAGAGGAGACAAGG + Intergenic
907713603 1:56907298-56907320 TGGGAGACACAGAGGATACAGGG + Intronic
907944264 1:59119615-59119637 TGGGAGACAGAGATGGGGGATGG - Intergenic
907961990 1:59292672-59292694 TAGTAGACAGAGAGGAGACACGG - Intergenic
908004776 1:59716706-59716728 TGGGAACAAGAGAGCGGACAGGG + Intronic
908311759 1:62891208-62891230 TTGGCCAAAGATAGGGGACAAGG - Intergenic
908568754 1:65386589-65386611 TGGGATGCAGAGAGGGGGCCTGG + Intronic
908572965 1:65428379-65428401 GGAGACACAGAGAGGGGAAGGGG - Intronic
908849743 1:68363767-68363789 TGGGGCATTGAGAAGGGACATGG + Intergenic
909086834 1:71178462-71178484 TGGGAGACAGAAAAGGCACATGG + Intergenic
909468297 1:75999380-75999402 TGAGATACAGAGAGGAGTCAAGG - Intergenic
909944681 1:81650228-81650250 TGGAAAACAGAGAAGGAACATGG + Intronic
910247311 1:85153382-85153404 TGGGATATACAGGGGGGACAGGG + Intergenic
915137927 1:153746741-153746763 TGTCACACAGAGTGGGGAAAAGG - Intronic
915252850 1:154602811-154602833 AGGAACACAGAGAGGGGAGCAGG + Intronic
915254542 1:154616365-154616387 GGGGACAGAGAGATGGGGCATGG - Intronic
915559034 1:156675892-156675914 TGGGCCACACAGAGGTGCCATGG - Intronic
916087706 1:161282785-161282807 TGTGAGAAAGAGAGGGGTCAAGG - Intronic
916846076 1:168651624-168651646 GGGGAGAAAGAGAGGGGACTAGG - Intergenic
917202716 1:172533716-172533738 TGGGAGAGAGAGAGGTGCCAAGG + Intronic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
918070644 1:181131404-181131426 AGGGACACTGGGTGGGGACAGGG + Intergenic
918097815 1:181349138-181349160 TGGGACAGAGAGAAGGTGCAGGG + Intergenic
918248977 1:182684838-182684860 TGGGACACAAGGAGGCGAAACGG + Intergenic
919257313 1:195141225-195141247 TGGGACCTAGAAAGGGGAGAAGG - Intergenic
919270289 1:195333022-195333044 TGGGACACAGATATGGGCAAAGG + Intergenic
919283063 1:195517574-195517596 TGAGACACAGAGAGGGAAAGTGG + Intergenic
919983691 1:202658393-202658415 TCTGACGCAGGGAGGGGACACGG - Intronic
920199220 1:204249267-204249289 AGGGACCCAGAGAGTGGAGAAGG + Intronic
920377758 1:205518515-205518537 TGGGCCACAGGGAAGGGGCAAGG + Intronic
920528272 1:206684727-206684749 GCGGACAGTGAGAGGGGACAGGG - Intergenic
920678825 1:208057638-208057660 AGAGACACAGGGAGGAGACAGGG - Intronic
920811182 1:209287229-209287251 TGGGACACAGAGATGCGGAAAGG - Intergenic
921278707 1:213544533-213544555 GGGAACACACAGAGGGGCCACGG - Intergenic
921281385 1:213571440-213571462 TGGGAAGCAGAGAGGAGATAGGG + Intergenic
922464101 1:225834894-225834916 GGGGACGCATAGAGAGGACAGGG + Intronic
922727217 1:227928059-227928081 TGGGTCACAGGGAGAGGGCAGGG - Intronic
923126967 1:231040895-231040917 TGGGACAGAGGGAGTGGAGACGG - Intergenic
923238508 1:232058187-232058209 TGGGAAGCAGAGAGGGCAGAGGG - Intergenic
923329075 1:232906010-232906032 AGGGCCGCAGAGAGGAGACAGGG + Intergenic
923702242 1:236310992-236311014 TGGGACGTAGTGAGGGGACATGG + Intergenic
924023479 1:239809428-239809450 GGGGACACAGTGAGGGAAGATGG - Intronic
1063897842 10:10701006-10701028 TGGGACACAGAGAGACATCAAGG - Intergenic
1064421022 10:15190925-15190947 TGGGACTGAGAGAGAGGAGAAGG - Intergenic
1065344451 10:24735513-24735535 TGGGAGAGAAAGAGGGGTCAAGG - Intergenic
1065392469 10:25197258-25197280 TGGGACACAAAGAGGTGAGATGG - Intronic
1065434091 10:25689433-25689455 GGTGAGTCAGAGAGGGGACAGGG + Intergenic
1066503108 10:36014007-36014029 TGGGAAACAGAGTTGGAACACGG - Intergenic
1067807448 10:49403017-49403039 TGGTACATGGAGAGGGGACTGGG + Intergenic
1068895505 10:62195512-62195534 TGAGACAGAGAGAGAGGACAGGG + Exonic
1068941820 10:62688164-62688186 GGGGACAGGGAGAGGGGACAGGG - Intergenic
1068991658 10:63157183-63157205 TGGGAGACAGACATGGGGCAGGG - Intergenic
1069613966 10:69794502-69794524 TGGGACTCAGAGAAGGGAAGTGG - Intergenic
1069649608 10:70035868-70035890 TGGGAGACAGAAAAGGGAGAGGG + Intergenic
1069756340 10:70776297-70776319 TTGGACACAGAGAATGGAGAAGG - Intronic
1069888551 10:71638877-71638899 TGGGAGGCAGGGAGGGGGCAAGG + Intronic
1069914345 10:71778163-71778185 GGGGACACAGGGAAGGGACAAGG - Intronic
1070155381 10:73831183-73831205 TGGAAAACAGAGAAGGGGCATGG + Intronic
1070156748 10:73840037-73840059 TGGGATGTAGAGAGGGGAGAGGG - Intronic
1070746074 10:78934789-78934811 TGAGGCCCAGAGAGGGGCCAGGG - Intergenic
1071109784 10:82142431-82142453 TGAAACCCAGAGAGGGGATAAGG + Intronic
1071375955 10:85003569-85003591 TGAAACACAGAGGGGGGAAATGG + Intergenic
1073037494 10:100574591-100574613 GGGGGCAGAGAGAGGGGAGAGGG - Intergenic
1073122755 10:101132298-101132320 CGGGAGACAGAGAGGGGTCCAGG - Intronic
1073291128 10:102413869-102413891 TTGGACACAGAGAGGGGAGGAGG - Exonic
1073403843 10:103279469-103279491 TGGCACAGAGGCAGGGGACAGGG + Intronic
1073427185 10:103462447-103462469 TGGGCCACAGTGAGGGAACTAGG - Intergenic
1073446218 10:103582189-103582211 TGGGAGACAGAGAGGGGAAGGGG - Intronic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1074777416 10:116776198-116776220 TGGGACACAGGCAGGTGTCATGG + Intergenic
1074987792 10:118672848-118672870 TGGGACACATTGTGGGGAAAGGG - Intergenic
1075654739 10:124153363-124153385 TGGGAGCCAGAGGGGGGAAACGG + Intergenic
1075998199 10:126894964-126894986 TGAGAAGCAGGGAGGGGACATGG - Intergenic
1076143533 10:128098107-128098129 TGGGGAACACAGAGAGGACAGGG + Exonic
1076243066 10:128925004-128925026 CGGGACACAGAGAGAGCCCAAGG - Intergenic
1076404030 10:130200767-130200789 AGGTACACAGAGAAAGGACACGG + Intergenic
1076514283 10:131034431-131034453 GGGGACTCACAGAGGGGGCACGG - Intergenic
1076603479 10:131674385-131674407 GGGGCCACAGAGCGGGGAGACGG - Intergenic
1076838122 10:133031592-133031614 TGGGCCCCTCAGAGGGGACATGG - Intergenic
1076991953 11:280051-280073 CGGGAGACAGCGCGGGGACAAGG - Intronic
1077279008 11:1733550-1733572 TGGGACAAACGCAGGGGACAGGG - Exonic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077538970 11:3137821-3137843 TGGGACCCCAAGAGGGGAAACGG + Intronic
1077552264 11:3205994-3206016 GGGGAGAAAGGGAGGGGACAAGG - Intergenic
1078271411 11:9798405-9798427 TGGGACAGAAGAAGGGGACAGGG + Intronic
1078606896 11:12785040-12785062 TCTGACACAGAGAGAGGGCAGGG - Intronic
1078646608 11:13146724-13146746 TGAGAGACAGAGATGAGACATGG - Intergenic
1080656577 11:34263189-34263211 GGGGACACAGAGAGGAGCCATGG + Intronic
1080758175 11:35222212-35222234 TGGGCCTCAGAGAGGCTACAGGG - Intronic
1081563901 11:44244321-44244343 TGGGACAGAGGGAGAGAACAAGG + Exonic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1082779313 11:57274151-57274173 TGGAGCACAGAGAGAGGAGAGGG - Intergenic
1083315058 11:61809707-61809729 TGGGAGTCAGACGGGGGACAGGG + Intronic
1083579787 11:63817789-63817811 TGGGTCACTGCGAGGGGAGAGGG - Exonic
1083812143 11:65112072-65112094 TGGGGCAGAGAGATGGGACCTGG + Intronic
1084269841 11:68022931-68022953 TGGGGCCCAGACTGGGGACAGGG - Intronic
1084416504 11:69035780-69035802 GGGGGTACAGAGAGGGGAAAAGG - Intergenic
1085529812 11:77184564-77184586 TGGGCCAGAGGGAGAGGACAGGG - Intronic
1086384528 11:86293540-86293562 TGAGTCACAGAGAGGAGAGATGG + Intergenic
1086871221 11:92039219-92039241 TGAGACTCAAAGAGGGAACAAGG - Intergenic
1086899599 11:92352126-92352148 TGGGACACTGTGTGGGCACACGG + Intronic
1089111527 11:116061635-116061657 AGGGAAAGAGGGAGGGGACAAGG + Intergenic
1089183330 11:116597801-116597823 TGGGAAATACAGAGGGGACGGGG + Intergenic
1089255529 11:117192140-117192162 TGGGACTCTGAGAGGGGCCCAGG - Intronic
1089458583 11:118639842-118639864 CGGCCTACAGAGAGGGGACATGG - Intronic
1089554136 11:119306017-119306039 TGGGACACAGTGAAGGCACATGG - Exonic
1089867243 11:121642566-121642588 TGGGCCACAGAGAGAGGTCGGGG + Intergenic
1089999011 11:122937586-122937608 TGGTACAAGGACAGGGGACAGGG + Intronic
1090066811 11:123510445-123510467 TGGAACACAGACAGGAGACAGGG + Intergenic
1090159309 11:124475610-124475632 TTGGACAGGGAGAGGGGAAAAGG - Intergenic
1090226815 11:125076661-125076683 TGGGACTGCCAGAGGGGACACGG + Intronic
1091069161 11:132547096-132547118 TGGGACACAGCAAGATGACAAGG + Intronic
1091364016 11:135001854-135001876 TGGGACAGGGACAAGGGACATGG - Intergenic
1091375594 12:22866-22888 AGGGGCAGAAAGAGGGGACAGGG + Intergenic
1091446410 12:546279-546301 TGGGGCAGAGAGTGCGGACAGGG + Intronic
1091673122 12:2467212-2467234 TGAGACACATACAGCGGACAAGG - Intronic
1091795452 12:3295270-3295292 TGGGAGGCAGGGAGTGGACAGGG - Intergenic
1091874366 12:3921311-3921333 TGAGACACAGAGAGGGCAAGTGG + Intergenic
1092121561 12:6047808-6047830 TGGGACACTGAGTGGGTAAAAGG - Intronic
1092215196 12:6677138-6677160 TGAGGCCCAGAGAGGGGAAAAGG + Intronic
1092234229 12:6796127-6796149 TGAGACATAGAGAGAGGACTTGG - Intronic
1093017203 12:14166639-14166661 TGGGATAAAGGGAGGGGATAAGG - Intergenic
1095954625 12:47798975-47798997 AGGGACAGAGAGAGGGAGCAGGG + Intronic
1096155788 12:49340876-49340898 TGGGGCCCAGAAAGGGGAAATGG + Intergenic
1096537576 12:52285256-52285278 TGTGGCATAGAGGGGGGACACGG - Intronic
1096670498 12:53195723-53195745 TGGGACAGGGAGCAGGGACAAGG + Intronic
1096692707 12:53330884-53330906 TGGGACATTGAGAGGGAACAGGG + Intronic
1096780280 12:53987699-53987721 AAGGGCACAGAGAGGGTACAGGG - Intronic
1097191103 12:57220083-57220105 AGGGCAACAGAGAGGGGGCAGGG + Intronic
1097415047 12:59304728-59304750 TTGGACAGACAGTGGGGACAGGG - Intergenic
1097459559 12:59843994-59844016 TGGGACAGAGGAGGGGGACAGGG - Intergenic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1097823090 12:64147336-64147358 TGGGGCACAGAGCGGGGCAACGG - Exonic
1097997918 12:65910135-65910157 TGGAACACAAAGAGGGGAGGTGG - Intronic
1099185957 12:79515659-79515681 AGAGACAGAGAGAGGGGAGAAGG - Intergenic
1099357494 12:81657218-81657240 GGAGACCCAGAGAGGGGAAAGGG + Intronic
1100723175 12:97380273-97380295 TGGGAAAGAGAAAGGGGAAAAGG + Intergenic
1101396944 12:104356716-104356738 TGGGAAGCAGAGAAGGCACACGG + Intergenic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102528420 12:113528634-113528656 AGGGAAACAGGGAGGGGGCAGGG - Intergenic
1102590036 12:113950045-113950067 TGTAACACAGAGAGAGCACATGG + Intronic
1102707754 12:114896655-114896677 TGGGACCCAGAGCGAGGCCAGGG + Intergenic
1102755695 12:115338169-115338191 TGGGACACAGAGGGTGAACTGGG + Intergenic
1103797037 12:123510244-123510266 TGGGGCATAGAGAGGAGAGAGGG - Intronic
1104526568 12:129529447-129529469 TTGGACACAGAGAGAGAGCATGG - Intronic
1104634084 12:130426912-130426934 TGGGGCACACAGAGGGGTCGTGG + Intronic
1104851585 12:131877821-131877843 TGGGACACAGAATGAGAACATGG - Intergenic
1104924820 12:132308634-132308656 TGAGACAAAGAGAGGGGCCCGGG + Intronic
1104962435 12:132494557-132494579 TGGGCCACAGGGAGGTGGCAGGG + Intronic
1105575799 13:21650537-21650559 AGGGAGAGAGAGAGGGGAAAAGG - Intergenic
1105717833 13:23084878-23084900 TGGAACACACAGAGGAGGCATGG + Intergenic
1106193580 13:27474979-27475001 AGGGACACAGAGAAGGAAGAGGG + Intergenic
1106728091 13:32506938-32506960 TCTGACAGAGAGAGGGCACAAGG + Intronic
1107494208 13:40909128-40909150 TATCACACAGAGAGGGGAAAAGG + Intergenic
1108107279 13:47024791-47024813 TGGGACACAGAGAGGGAGCAGGG - Intergenic
1108125067 13:47233659-47233681 TGGGTCTCAGACAGAGGACAGGG - Intergenic
1108145234 13:47469879-47469901 TGAGATGCAGAGAGGGGAAATGG + Intergenic
1108452873 13:50585017-50585039 TGGGAGACAGGCAGAGGACAGGG + Intronic
1108715488 13:53074247-53074269 TCGCAGATAGAGAGGGGACAGGG + Intergenic
1109478831 13:62920258-62920280 TGTGACACAGTGTGGGAACAGGG - Intergenic
1111209722 13:85062137-85062159 TGGCACACATGGAGAGGACATGG - Intergenic
1111806146 13:93042319-93042341 TGGGACACAGAGTCAGAACATGG + Intergenic
1112506463 13:99979224-99979246 TGGGACGGAGGGAGGGCACAGGG + Intergenic
1114083511 14:19220541-19220563 TGGGACACACAGGGTGGCCAGGG + Intergenic
1114527872 14:23377639-23377661 TGAGACATAGGGATGGGACAGGG + Intronic
1114527999 14:23378293-23378315 GGGGACACAGGCAGGGGCCAGGG - Intronic
1115630891 14:35244101-35244123 TGGGACACAGAAAGTGGAAATGG - Intronic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1117207943 14:53463824-53463846 TGGGGCAGAGAAAGGGGATAGGG - Intergenic
1117481676 14:56152039-56152061 TGGAACACAGACTGGAGACAGGG - Intronic
1118595674 14:67433330-67433352 TGGGACAGAGAGAAGAGAAAAGG + Intergenic
1118743532 14:68758190-68758212 TGGATCACAGAGGGGAGACAGGG + Intergenic
1118916628 14:70112871-70112893 AGGAACACAGACAGGGGAGAAGG - Intronic
1120322398 14:82981081-82981103 TGGGTCACAGAAAGAGGGCATGG + Intergenic
1120554271 14:85909196-85909218 TGGGAGACAGATGGGGGTCATGG - Intergenic
1120635006 14:86940372-86940394 GGGGACACAAAGAGGGTTCAGGG - Intergenic
1121466085 14:94116299-94116321 TGGGAAACAGAGAGGGGAACTGG + Intronic
1121519121 14:94573860-94573882 TGGTACACTGAGGGAGGACATGG - Intronic
1121645953 14:95516944-95516966 GGGGAGACAGACAGGGGCCAGGG - Intronic
1121770097 14:96526710-96526732 TGGGACAGAGTGATGGGAGATGG - Intronic
1121961801 14:98266761-98266783 TTGGACACAGAGAGATGAAATGG - Intergenic
1121994770 14:98593354-98593376 AGGGACACAGAGGAGGGGCAGGG - Intergenic
1122317468 14:100834670-100834692 TGGGACACCCTGAGGAGACACGG - Intergenic
1122353872 14:101112182-101112204 TGGCACTCAGAGAGGGAAGAAGG + Intergenic
1122442087 14:101738930-101738952 GAGAACACAGAGAGGGGAGAGGG + Intergenic
1122460353 14:101889419-101889441 GGGCACAAAGAGAGGGAACAGGG - Intronic
1122727487 14:103767690-103767712 GGAGACACTGAGAGGGGACACGG - Intronic
1202895119 14_GL000194v1_random:2310-2332 TGGGACACACAGCGTGGCCAGGG + Intergenic
1202904188 14_GL000194v1_random:59176-59198 TGGGACACAGAGGCTGGAGACGG - Intergenic
1202878077 14_KI270722v1_random:27047-27069 TGAGACACACAAAGGAGACAAGG - Intergenic
1124422859 15:29537797-29537819 TGGGAAACAATGATGGGACAGGG - Intronic
1124854908 15:33378317-33378339 TGGGACAGGCAGAGGGGACATGG - Intronic
1125401510 15:39309596-39309618 TGAGAATCAGAGAGGGGTCAAGG - Intergenic
1125492630 15:40159619-40159641 TGGGACTGAGAGAGGGGAAGGGG - Intergenic
1127024001 15:54782157-54782179 TGGGAGACGGAGACGGGAGATGG + Intergenic
1128088695 15:64904426-64904448 TGGGTCCCAGAGCAGGGACAGGG - Intronic
1128106490 15:65049428-65049450 TACGACACAGAGAGGAGAAAAGG - Intronic
1128144482 15:65325126-65325148 TGGGACTCTTAGAAGGGACAGGG + Intergenic
1129159943 15:73741588-73741610 AGAGACACAGGGATGGGACAGGG + Intronic
1129172378 15:73816183-73816205 AGGCACACAGAGAGAAGACAGGG + Intergenic
1129274137 15:74434186-74434208 TGAGGCCCAGAGAGGGGATAGGG - Exonic
1129776790 15:78242045-78242067 TGAGACTCAGAGAGGTGACTTGG - Intronic
1130107643 15:80941034-80941056 TTGGACTCACAGAGGGGCCATGG - Intronic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1130735050 15:86539111-86539133 TGAGGCACAGAGAGGGGAATTGG + Intronic
1130879355 15:88041889-88041911 TGGGACAGAGAGTGGGGAGGAGG - Intronic
1131109848 15:89758402-89758424 GGGGAGACAGGCAGGGGACAGGG - Intergenic
1131955277 15:97728943-97728965 TGAGAGAGAGAGAGGGGCCAAGG - Intergenic
1132351223 15:101140906-101140928 TGGGAGACAGTGAACGGACATGG + Intergenic
1132460044 16:48331-48353 TGGGACTCAGGGAGGGGAGGGGG - Intronic
1132954576 16:2584883-2584905 TGGCACACAGGGTGGGGGCAAGG - Intronic
1133255570 16:4513927-4513949 TGGGACACAGATGGGGCCCAGGG + Intronic
1133376420 16:5291155-5291177 TGGGACACAGAGTAGTTACATGG - Intergenic
1134193451 16:12140189-12140211 AGGGAAAGAGAGAGGAGACATGG - Intronic
1134750310 16:16619836-16619858 TGGGAGACGGAGACGGGAGAGGG + Intergenic
1134815004 16:17198481-17198503 GAAGACACAGAGAGGGGACAGGG - Intronic
1134907636 16:17994476-17994498 TGGGACACAGAGAAGGGGTGTGG + Intergenic
1134995148 16:18733762-18733784 TGGGAGACGGAGACGGGAGAGGG - Intergenic
1135185129 16:20309194-20309216 TGAGCCTCAGAGAGGGGAGAAGG + Intergenic
1135565555 16:23508928-23508950 TGGAATGCAGACAGGGGACAAGG - Intronic
1135568360 16:23529444-23529466 TGGGACAGAGAGAGGGAAGGAGG + Intronic
1135807199 16:25553676-25553698 TTTGCCACAGAGAGGGGACATGG + Intergenic
1137560912 16:49501882-49501904 TGGGAGGGAGGGAGGGGACAAGG + Intronic
1137725241 16:50652458-50652480 TGAGACTCACAGAGGGGAAACGG - Intergenic
1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG + Intergenic
1138298561 16:55907922-55907944 TGGGACAGAAAGAGGGAAGATGG - Intronic
1138388907 16:56655861-56655883 TGAGACACAGAGAGGTTGCAAGG - Intronic
1138473873 16:57259219-57259241 TGGTACAAAGAGATGGGTCATGG - Intronic
1139295240 16:65895016-65895038 AGTGATACAGAGAGGAGACAGGG + Intergenic
1139310796 16:66026452-66026474 TGGGAGACAGAGCAGGGACAAGG + Intergenic
1140322072 16:73962471-73962493 TGGGGGAGAGAGAGGGGACTTGG + Intergenic
1141031639 16:80594319-80594341 TCAGACAGAGAGAGGGGTCAAGG - Intergenic
1141035025 16:80619148-80619170 GGGGACACAGAGACAGGAGAAGG - Intronic
1141139577 16:81488605-81488627 GGGCACACAGAGAGGGGATGGGG - Intronic
1141166672 16:81665467-81665489 TGGGACCCAGAGAGGTGGGACGG + Intronic
1141259975 16:82443863-82443885 TGAGCCTCAGAGAGGGGACGGGG - Intergenic
1141519131 16:84566075-84566097 TGTGACACAGAGAAGGGCAAAGG - Exonic
1141796038 16:86274936-86274958 ACATACACAGAGAGGGGACATGG - Intergenic
1141830371 16:86506968-86506990 TTGGACGTAGAGAGGGGAGATGG + Intergenic
1142090872 16:88208521-88208543 TGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1142202931 16:88769774-88769796 TGGGAAACAGGGAGGGGCCAGGG + Intronic
1142466920 17:141491-141513 GGGGACATGGTGAGGGGACATGG + Intergenic
1142704086 17:1683471-1683493 TGGGACAGGGAGAAGGGAAAAGG + Intronic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143001118 17:3795609-3795631 TGGTAAACAGAGAGAGGCCAGGG + Intronic
1143323402 17:6082438-6082460 TGGGAGACATGGAAGGGACACGG + Intronic
1143337807 17:6186632-6186654 TGAGACCCAGAGAGGGGAAGAGG + Intergenic
1143597801 17:7925756-7925778 TGTGACAAAGATAGGGGACCGGG + Intronic
1143628346 17:8123361-8123383 AGAGACACAGAGAGGGGAGGAGG - Intronic
1144262125 17:13531967-13531989 TAGGAAAGAGAGAGGGGACAGGG + Intronic
1144476292 17:15591968-15591990 GGGGGCACAGGAAGGGGACAGGG - Intronic
1144686560 17:17229823-17229845 TGGGACACCTGGTGGGGACATGG + Intronic
1144702030 17:17346420-17346442 TGGGGCACAGAGAGGGAAGTTGG + Intronic
1144761044 17:17707563-17707585 GGGGACTGAGAGAGGGGAGAGGG + Intronic
1144921961 17:18771433-18771455 GGGGGCACAGGAAGGGGACAGGG + Intronic
1145985364 17:29042540-29042562 TCAGCCACAGAGAGGGGACCAGG - Intronic
1146063701 17:29619968-29619990 TGTGACACAGAGAGGTAAGATGG + Intronic
1146124225 17:30219235-30219257 TGGGGCTCAGAGAGGGGAAGTGG - Intronic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1147140274 17:38456728-38456750 TGGGACACAGAGAGGGAAGGTGG - Intronic
1147928885 17:43964060-43964082 TGGGGCAGTGTGAGGGGACAGGG + Intronic
1148206664 17:45784076-45784098 CGGGACACAGAGAGCGGGCCGGG + Intergenic
1148331595 17:46817111-46817133 TGGGAGAGAGGGTGGGGACATGG - Intronic
1148355037 17:46969864-46969886 TGGGCACCAGAGAGGGGGCAAGG - Intronic
1149053570 17:52335756-52335778 GGGGAGAGAGAGAGGGGAGAGGG - Intergenic
1149382058 17:56104399-56104421 TGAGACCCAGAGAGGGGAGCTGG + Intergenic
1149559941 17:57601423-57601445 TGGGGCACACAGAGTGGCCAGGG - Intronic
1149660996 17:58333758-58333780 TGGGACAGAGAAAGGGGGAATGG + Intergenic
1150662084 17:67091166-67091188 TTGGTCAAAGATAGGGGACAAGG + Intronic
1150725729 17:67649925-67649947 TGGCACACCCAGAGGGGGCACGG - Intronic
1150972486 17:70044367-70044389 TGGGAGAGAGAGAGAGGAGAAGG - Intergenic
1151074234 17:71252865-71252887 TGGGGCACAGAGAAAGAACAGGG + Intergenic
1151148014 17:72059105-72059127 TGGGAAACAAAAAGGGAACAAGG + Intergenic
1151384278 17:73745649-73745671 AGGGACACACAGAGCGGGCAGGG - Intergenic
1151652280 17:75477407-75477429 GGGGACCCAGAGAGGGGGCCAGG + Intronic
1151732898 17:75921601-75921623 TGGGACACGGGGACGGGGCAGGG + Intronic
1151732925 17:75921677-75921699 TGGGACACGGGGATGGGGCAGGG + Intronic
1151732938 17:75921714-75921736 TGGGACACGGGGACGGGGCAGGG + Intronic
1151732952 17:75921752-75921774 TGGGACACGGGGATGGGGCAGGG + Intronic
1151732975 17:75921828-75921850 TGGGACACGGGGACGGGGCAGGG + Intronic
1151781340 17:76248100-76248122 TGGGAAGCAGAGAGAGGAAAGGG - Intergenic
1152276892 17:79363225-79363247 TGATGCACAGAGAGGGGACATGG + Intronic
1152334315 17:79691707-79691729 TGGGACACAGAGCTGGGCCAGGG + Intergenic
1154500190 18:14992203-14992225 TGGGACACACAGGGTGGCCAGGG + Intergenic
1154501841 18:15001244-15001266 TGGGACACAGAGGGGGGACCCGG - Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1155998016 18:32352598-32352620 TGGAACAGAAAGAGGGGACAGGG + Intronic
1156841770 18:41617448-41617470 GGGGACAGAGGGAGGGGAGAGGG + Intergenic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1157384605 18:47250616-47250638 AGGGGCCCAGAGAGAGGACACGG - Intergenic
1157420468 18:47543642-47543664 TGGGACCCTGAGAAGGGACGTGG + Intergenic
1157497294 18:48165430-48165452 TTGGGCAGAGAGAGGGGACCTGG + Exonic
1157638688 18:49189157-49189179 GGGGACAGAGGAAGGGGACAAGG + Intronic
1158441619 18:57479822-57479844 TGGCACACCCAGATGGGACAGGG - Exonic
1158575953 18:58638032-58638054 TGGAACACAGACAGCGGAAAGGG - Intergenic
1158835268 18:61324038-61324060 TGAGATACACAGAGGGGAGAGGG - Intergenic
1159483861 18:69027932-69027954 TGGGACACAGTAAGGGCTCAGGG - Intronic
1160011302 18:75108762-75108784 TGGGAGCCAGAGAGAAGACATGG - Intergenic
1160686761 19:440516-440538 TGGAAAACAGAGCAGGGACACGG + Intronic
1161035153 19:2080262-2080284 GGGGAGTCAGAGAGGGGAGAGGG + Intronic
1161226024 19:3146323-3146345 TGAGACACAGAGAGGGGGAAGGG + Intronic
1161244674 19:3243033-3243055 GGGGGCACAGAGAGGGGAAGTGG - Intronic
1161253105 19:3291766-3291788 GGGAACATGGAGAGGGGACAGGG + Intronic
1161303853 19:3556446-3556468 AGGGACAGACAGAGGGGATACGG + Intronic
1161352586 19:3802099-3802121 GGGGACAGAGGGAAGGGACAGGG - Intronic
1161451163 19:4346138-4346160 TGGGGCGGAGAGAGGGGACATGG + Intronic
1161607042 19:5220911-5220933 TGAGGCACAGAGAGGGCACGTGG + Intronic
1161842910 19:6693560-6693582 CGGGGTGCAGAGAGGGGACAGGG + Intronic
1161905378 19:7152618-7152640 TGGGACCCAGAGACGGCAGAAGG - Intronic
1161990116 19:7679984-7680006 TGGGACACAGGGAAGACACAGGG - Intronic
1162531523 19:11238802-11238824 TGAGGCCCAGAGAGGGGTCAAGG - Intronic
1162582367 19:11539091-11539113 TTGGAAACTGAGAGGGGAAAAGG + Intronic
1163008016 19:14408352-14408374 TGTGACCCAGGGTGGGGACAGGG + Exonic
1163281295 19:16319658-16319680 GGGGACACAGAGATGAGTCAAGG + Intergenic
1164400895 19:27901489-27901511 TTGTACACAGAGAAGTGACAGGG + Intergenic
1164464170 19:28473436-28473458 CGGGCCACAGCGAGGGGAGAGGG + Intergenic
1164630109 19:29756374-29756396 GGGAGCACAGAGAGGAGACAGGG + Intergenic
1164735717 19:30539663-30539685 TAGTGCACAGGGAGGGGACATGG - Intronic
1164840299 19:31388065-31388087 AGGGGGACAAAGAGGGGACAGGG + Intergenic
1165108810 19:33489325-33489347 TGGGACTAAGAGAGGGGGCTTGG + Intronic
1165215882 19:34272196-34272218 TGGGAAATAGAAAGGTGACAGGG + Intronic
1165381889 19:35487628-35487650 TGGGAGAGAGAGTGGGGACAGGG - Intronic
1165785742 19:38460636-38460658 TAGGAGTCAGAGAGGGGGCAGGG + Intronic
1165790524 19:38488973-38488995 TGGGACACAGGGTGTGGACCTGG + Intronic
1166301865 19:41915608-41915630 TGAGACAGAGATGGGGGACATGG - Intronic
1166343460 19:42151632-42151654 TGAGGCCCAGAGAGGGGAGACGG + Intronic
1166434826 19:42758552-42758574 AGGGACTCAGAGAGGCAACAGGG - Intronic
1166678043 19:44751196-44751218 TGGAGGACAGAGAAGGGACATGG - Intronic
1167035613 19:46993567-46993589 GGGGACAGACAGAGGGCACAGGG - Intronic
1167511777 19:49898973-49898995 TGGGGCACAGAGAGGGGAAAAGG + Intronic
1167690287 19:50980790-50980812 AGAGACACAGAGAGAGGAGAGGG + Intronic
1167733241 19:51274511-51274533 TGGGACTCAGAGAGGAGAAGAGG + Intergenic
1167889609 19:52528741-52528763 GGTGACACAGAGTGGGGACAGGG + Intronic
1167915031 19:52733937-52733959 GGAGACACAGAGTGGGGACAAGG - Intronic
1168059812 19:53884447-53884469 TGGGGCACAGAGAGGAGGCCGGG + Intronic
1168148640 19:54433217-54433239 TGGCACACTGACAGGGGAGATGG - Intronic
925067938 2:943628-943650 TGGGACAGAGAAAGGCCACATGG - Intergenic
925278050 2:2664243-2664265 TCAGACACACAGAGAGGACATGG + Intergenic
925395002 2:3527084-3527106 CGGGACACAGGGAGGGCGCAGGG + Intergenic
925903054 2:8522456-8522478 GGGGACAAAGACAGGGGCCAGGG - Intergenic
925919076 2:8627079-8627101 AGGGAGAGAGAGAGGGGAAAGGG + Intergenic
926350662 2:11991271-11991293 AGGGAGACAGAGAGGAGTCAGGG - Intergenic
927261441 2:21095191-21095213 TGGGTCATAAAGTGGGGACAAGG + Intergenic
927745217 2:25613384-25613406 GGGGACAGAGGGAGGGGGCAAGG - Intronic
927944888 2:27129680-27129702 TGGGACAGAGGAAGGGGACATGG - Intronic
928003412 2:27541403-27541425 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
928066206 2:28166847-28166869 TGGCACACTGAAAGGGGAGATGG - Intronic
928199920 2:29241320-29241342 TGGGGCTCAGAGAGGGCACAGGG - Intronic
928211804 2:29329064-29329086 GGCCACACAGAGAAGGGACATGG - Intronic
928548863 2:32352693-32352715 TGAAACACAGAGAGGTGAAATGG - Intergenic
929290788 2:40188784-40188806 AGGGACACAGAGAGGGAAGGAGG - Intronic
929562002 2:42961946-42961968 TGGGCCTCAGTGAGGGGACAGGG + Intergenic
931120528 2:59213545-59213567 TGGGACAAAGATTGGGGTCATGG - Intergenic
931582542 2:63792686-63792708 TGGAATACAGACAGAGGACAGGG + Intronic
931704110 2:64932716-64932738 TGAGACCCAGAGAGGTGAAAGGG - Intergenic
932343035 2:70978691-70978713 TGGCACTCAGAAAGGGGAGAAGG + Exonic
932664514 2:73686061-73686083 GGGGAGACAGAGAGAGGAGATGG - Intergenic
933856397 2:86418435-86418457 TGGGGCACAGAGAAAGGAGAAGG + Intergenic
934699383 2:96427668-96427690 TGGGAAAGAGAGAGGGGAGAGGG - Intergenic
934892891 2:98086533-98086555 TGAGACAGACAGAAGGGACAGGG - Intergenic
935070726 2:99691418-99691440 TTGGACACCAAGCGGGGACAAGG - Intronic
935132591 2:100271687-100271709 GGGGACACAGAGGTGGGCCACGG + Intergenic
935506457 2:103910632-103910654 TTGGACACAGAGAGAGGAACAGG - Intergenic
935515905 2:104038341-104038363 TGGGGCACAGAGAGGCAAGATGG - Intergenic
935960215 2:108418538-108418560 AGGGACAAAGATATGGGACAAGG - Intergenic
936918655 2:117665150-117665172 TGGGAGAGAGAGAGGAGAGAGGG + Intergenic
936965999 2:118128109-118128131 AGGGACAGAGAGAAGGGGCAGGG - Intergenic
937162027 2:119772924-119772946 TGGGACACAGACAGGTGATACGG - Intronic
937235887 2:120431798-120431820 TTGGACACAGAGACGGGACAAGG - Intergenic
937287615 2:120763073-120763095 TGGGAAACAGAGAGGGAGCAGGG - Intronic
937682936 2:124664160-124664182 TGAGACACAAAAAGGTGACAGGG + Intronic
937699690 2:124850382-124850404 AGGGACACACAGAGGGAAGAGGG + Intronic
938383461 2:130849141-130849163 TGGGACACTGAGAGGGGTCACGG - Intronic
938501022 2:131831413-131831435 TGGGACACAGAGGGGGGACCCGG - Intergenic
939180999 2:138802761-138802783 TAGGACAGAGAGGGAGGACAGGG - Intergenic
939298080 2:140295862-140295884 TGGGGCAAAGAGAGGGAGCATGG + Intronic
939388483 2:141534056-141534078 TGAGAGAGAGAGAGGGGAGAAGG + Intronic
941745450 2:169081920-169081942 TGGGACAGGGATAGGGGATAGGG + Intronic
942146346 2:173031029-173031051 TGGGACACAGAAAGAGGGCAAGG + Intronic
942205438 2:173615651-173615673 TGGGACACGGAGAGTGGTGAGGG + Intergenic
942855725 2:180544842-180544864 TGGGACACGGAGGGTGGGCAAGG + Intergenic
944584644 2:201162688-201162710 AGGCACACAGGGAGAGGACAAGG + Intronic
945493679 2:210484307-210484329 TGGAGCACAGAGAGGGGTCAAGG + Intronic
945908818 2:215623425-215623447 TGGGACAGAAAGAGTGAACAGGG - Intergenic
946758808 2:222973019-222973041 TGAGAGGCAGAGAGGGGTCACGG + Intergenic
946800755 2:223413767-223413789 TGAGACACAGAGAGGTGAAATGG + Intergenic
947461227 2:230306375-230306397 GGAGACACAGAGAGGGGGCATGG + Intronic
947745694 2:232506291-232506313 AGGGACACAGAGACAGGCCACGG + Intergenic
948095341 2:235329020-235329042 TGGGACCAAGGGAGAGGACATGG - Intergenic
948295470 2:236857190-236857212 AGGGAGACAGAGAGGAGACAGGG - Intergenic
948587126 2:239026493-239026515 AGCGACACAGAGAGGGGGCCGGG + Intergenic
948587140 2:239026544-239026566 AGCGACACAGAGAGGGGCCCAGG + Intergenic
948587152 2:239026596-239026618 AGAGACACAGAGAGGGGCCCAGG + Intergenic
948785180 2:240348488-240348510 TGGGACCCAGAGAGGTCACCGGG + Intergenic
949037519 2:241822953-241822975 AGAGACACAGAGAAGAGACACGG - Intergenic
1169127558 20:3140867-3140889 TGGGAGAGAGGGAGGGGAGAGGG - Intronic
1170737841 20:19026588-19026610 TGGGGAAGAGAGAGGGGAAATGG + Intergenic
1171508831 20:25662865-25662887 TGGGAGACAGAGCGGGGCGACGG - Intergenic
1172182648 20:33012958-33012980 AGGGATACAGTGAGGGGACGGGG + Intronic
1172194857 20:33084864-33084886 CGGGACACAGAGTGGTGAGAAGG - Intronic
1172223652 20:33290167-33290189 GGGGAAAGAGAGAGGGGGCATGG + Intronic
1172328687 20:34058397-34058419 TGGGAGTGAGAGAGGGGTCAGGG + Intronic
1172536927 20:35681044-35681066 TGAGACACAGAGAGGGAGGAAGG - Intronic
1172620259 20:36313862-36313884 TGAGACCCAGAGAGGGCACAGGG - Intronic
1172774979 20:37402083-37402105 TGAGGCTCAGAGAGGGGACTTGG + Intronic
1172896461 20:38303909-38303931 GGGGACACAGAGCGGGGAATGGG + Intronic
1173201830 20:40960351-40960373 GTGCACACAGAGTGGGGACAAGG + Intergenic
1173542671 20:43866476-43866498 GGAGCCACAGAGAGAGGACATGG - Intergenic
1174076740 20:47942671-47942693 TGGGGCAGTGAGATGGGACAGGG + Intergenic
1174382974 20:50169236-50169258 TGAGACCCAGAGAGGGCACATGG - Intergenic
1174706672 20:52663542-52663564 AGGGTCACAGAGCGGGAACATGG + Intergenic
1174812590 20:53659914-53659936 AGGGAAACGGAGAGGGGAGAGGG + Intergenic
1174860635 20:54087823-54087845 TGGGAAACAGAGAGCAGAGATGG + Intergenic
1175168474 20:57063023-57063045 TGTGACACAGACAAGAGACAGGG - Intergenic
1175674750 20:60936926-60936948 TGGAGCACAGAGAGAGGAAAAGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175915083 20:62422521-62422543 TGGGACCCCGAGAGAGGCCATGG + Intronic
1176032182 20:63017898-63017920 AGGGCCACAGAGAGGGAACCTGG - Intergenic
1176072325 20:63233819-63233841 TGGGGCTCGGAGAGGAGACAAGG - Intergenic
1176169132 20:63689225-63689247 TGGGACCCAAGGAGGGGACCGGG - Intronic
1176614823 21:9018297-9018319 TGGGACACACAGGGTGGCCAGGG + Intergenic
1176623555 21:9073943-9073965 TGGGACACAGAGGCTGGAGACGG - Intergenic
1176710385 21:10145574-10145596 TGGGACACACAGGGTGGCCAGGG - Intergenic
1177291671 21:19120858-19120880 TGGGGCAGTGAGAGGGGAGAGGG - Intergenic
1178261278 21:31101881-31101903 TGATACACAGACAGGAGACAGGG - Intergenic
1178495748 21:33084679-33084701 TGGAAGACGGAGAGAGGACAGGG - Intergenic
1179396553 21:41045552-41045574 AGGGAGACAGAAAGAGGACAGGG + Intergenic
1179473124 21:41625521-41625543 CTGCACACAGAGTGGGGACAGGG + Intergenic
1179731428 21:43369913-43369935 GGGGACACTGAGAGGCCACAGGG - Intergenic
1180067494 21:45419915-45419937 CGGGCCACAGAGCGGGGACACGG - Intronic
1180294464 22:10872726-10872748 TGGGACACACAGGGTGGCCAGGG - Intergenic
1180497270 22:15902140-15902162 TGGGACACACAGGGTGGCCAGGG - Intergenic
1181029188 22:20141745-20141767 TGGGACCCACAGAGGGGAGCAGG + Intronic
1181479610 22:23190139-23190161 TTGGACACAGAGAGATGCCAGGG - Intronic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181609655 22:24004071-24004093 TGGGACACAGGTAGGAGGCACGG - Intergenic
1181961328 22:26623817-26623839 TGAGACACAGAGAGGTGTTAAGG + Intronic
1182087866 22:27573820-27573842 TGGGACTCAGAGAGGGGCTGGGG + Intergenic
1182317711 22:29459044-29459066 TGGGGCACAGACAGAGCACAGGG - Intergenic
1182575761 22:31271905-31271927 TGGAACTCAGAGGTGGGACAGGG - Intronic
1182740844 22:32566375-32566397 TGAGAAAGAGAGAGGGGGCAAGG + Intronic
1183058338 22:35320384-35320406 TGGGAATCACAGAGGGGACAGGG + Intronic
1183101544 22:35587282-35587304 TAGCACACAGAGAGGGCTCAGGG - Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1183361903 22:37387181-37387203 TGGACATCAGAGAGGGGACAGGG - Intronic
1183440937 22:37822809-37822831 TGAGGCCCAGAGAGGGGACATGG - Intergenic
1183520741 22:38294873-38294895 TGGTACACAGAGGGGGGCCAGGG - Intronic
1183546900 22:38459168-38459190 TGACACACAGAGAGGGGAAGTGG + Intergenic
1183547952 22:38465428-38465450 TGAGGCCCAGAGAGGGGACGTGG + Intergenic
1183578345 22:38706469-38706491 AGGGGCACTGAGCGGGGACAGGG - Intronic
1183632535 22:39041994-39042016 GGTGACACAGAGACTGGACAGGG + Intronic
1183719996 22:39557231-39557253 TGGATCTCAGAGAGGAGACAGGG + Intergenic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
1184021825 22:41826310-41826332 GGGGACACTGTGAGGGGACCAGG + Intergenic
1184247389 22:43242522-43242544 TGGGACCCAGAGAAGGCCCATGG - Intronic
1184250208 22:43255826-43255848 TGGGACACAGAGGGGACTCAGGG + Intronic
1184401763 22:44278644-44278666 GGGGGTACAGAGAGGGGTCAAGG + Intronic
1184454150 22:44599514-44599536 TGAGGCCCAGGGAGGGGACATGG + Intergenic
1184483884 22:44764857-44764879 TAGGACTGAGAGAGGGGAGAGGG + Intronic
1184571776 22:45329595-45329617 TTGTACACAGAGCGGGGCCAGGG - Intronic
1184616538 22:45641657-45641679 TGGGACACAGAGGGAACACACGG + Intergenic
1184993038 22:48183375-48183397 TGGGAAACTGAGAGGTGACTGGG + Intergenic
949687918 3:6599274-6599296 TGGGAGAGAGAGAGAGGAAATGG - Intergenic
950158860 3:10743842-10743864 TGGGATAGAGACAGGGGCCAGGG + Intergenic
950261484 3:11545622-11545644 CGAGGCCCAGAGAGGGGACAGGG - Intronic
950416732 3:12873142-12873164 TGGCACTCCCAGAGGGGACACGG - Intergenic
950435154 3:12974925-12974947 TGGGGCACAGAGAGTGGACACGG - Intronic
950575246 3:13828313-13828335 TGAGAAATAGAGAGGGGGCAAGG + Intronic
950961686 3:17114744-17114766 TGGGTCCCAGAGAGGTGACTTGG + Intergenic
951837836 3:27002400-27002422 TGGGACACAGAATCGGAACATGG + Intergenic
952069697 3:29619107-29619129 ATGGACACAGGGAGGGGAAAGGG + Intronic
952820938 3:37485078-37485100 GGGAAAACAGAGAGGGGACAGGG + Intronic
952951355 3:38528094-38528116 GGGGACACAGGTAGGTGACATGG - Intronic
952953343 3:38541944-38541966 TGAGAAACAGAGAGGAGGCAAGG + Intronic
953097320 3:39791340-39791362 TGGGACACAGAGAATGTAAATGG + Intergenic
953546013 3:43864041-43864063 GGGGACTCAGGGAGTGGACATGG - Intergenic
954320093 3:49826713-49826735 TGGGATAGAGGGAGGGGGCAGGG - Intergenic
954467243 3:50662958-50662980 TAATACACAGAGACGGGACATGG - Intergenic
955087033 3:55712852-55712874 TGGGGTACAGAGAGAGGACTAGG - Intronic
955988749 3:64602342-64602364 TGGGAAAAAAAGAGGAGACAAGG - Intronic
957323649 3:78664401-78664423 TGATACACAGACAGGGCACATGG + Intronic
957670962 3:83302260-83302282 AGAGACAGAGACAGGGGACAGGG + Intergenic
957834707 3:85572460-85572482 AGAGACAGAGAGAGGGGAGACGG + Intronic
957959891 3:87236046-87236068 TGGCACACACAGAGAGGGCATGG - Intronic
958449696 3:94258676-94258698 TGGAACAAAGAAAGAGGACAAGG + Intergenic
958794658 3:98694025-98694047 TGGGTTAAAGAGAGGGGAAAGGG - Intergenic
959826838 3:110807249-110807271 TGGGAAAGAGAGAGAGCACATGG - Intergenic
960954642 3:123023573-123023595 TGAGGCACAGAGAGGGAACTTGG + Intronic
961005783 3:123404505-123404527 TCAGACACAGGCAGGGGACATGG - Intronic
961332935 3:126153663-126153685 TGGGAGAGGGAGAGGGGCCAGGG + Intronic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961564605 3:127754563-127754585 TGAGGCACAGAGAGGAGAGAGGG + Intronic
961648341 3:128404661-128404683 TGGGGCACAGAGTGTGGGCATGG - Intronic
962370478 3:134817219-134817241 GGGGCCACAGAGAGGGGAATGGG - Intronic
962970795 3:140400217-140400239 TGGGACTCAGAGTGAGAACAAGG - Intronic
962991453 3:140581058-140581080 TGAGACACAGCCAGGGTACAGGG + Intergenic
963596954 3:147340025-147340047 GGGCACACAGAGCGGGGATAAGG + Intergenic
964608389 3:158583592-158583614 TGAGAGACAGAGATGGGAAATGG + Intronic
964763261 3:160154330-160154352 TGGGAAACAGAGGGAGCACATGG + Intergenic
965355441 3:167667338-167667360 AGGGAGGGAGAGAGGGGACAGGG + Intergenic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
966438568 3:179918051-179918073 TGAGACACAGAGAGGTTACCTGG + Intronic
966919544 3:184602774-184602796 AGGAACACAGAGAGGGAACAAGG - Intronic
966921145 3:184612260-184612282 TGGGCCAAAGAAAGGGGATAAGG - Intronic
967417561 3:189235551-189235573 GGGGACACTGAAAGGGGACAAGG + Intronic
968664736 4:1814904-1814926 TGGGTGGCAGAGTGGGGACAAGG - Intronic
968923229 4:3533213-3533235 TTGGGCTCAGAGAAGGGACAAGG + Intergenic
969329143 4:6462996-6463018 TGGGACAGAGGGAGGGGGGAAGG + Intronic
969497078 4:7532326-7532348 TGGGGCACAGAGAGGGGAGCTGG - Intronic
971626206 4:28923250-28923272 AGGGAGAAAGAGAGGGGAGATGG - Intergenic
971650953 4:29273543-29273565 GCGGAGGCAGAGAGGGGACATGG - Intergenic
972774057 4:42225218-42225240 TGTGACAGAGAGATGGGAAAGGG - Intergenic
973991230 4:56409506-56409528 TGAGACACAGACATGGGAAAGGG - Intronic
974663049 4:64919934-64919956 TGGGTCACAGAGAAGGCACATGG + Intergenic
975044557 4:69785305-69785327 TGGAACATAGAGAGGTGAGAGGG - Intronic
975809131 4:78147441-78147463 TGAGACTCAGAGAGGATACATGG - Intronic
976225688 4:82794353-82794375 TGGGACACATTTAGGGGACTCGG + Intronic
977615205 4:99080675-99080697 TTTGACACAGAGAGGGTACCTGG - Intronic
977772012 4:100870893-100870915 TGGGTCACAGAGAAGTGGCATGG + Intronic
978406097 4:108380448-108380470 TGTGAGACAGAGAGAGAACAGGG + Intergenic
978521978 4:109625779-109625801 TGGGAGAAAGAGAGGATACAGGG + Intronic
978901997 4:113962624-113962646 TGGGACAGAGGGAGGGGTGATGG - Intronic
978914829 4:114111681-114111703 TGGTACACAGACAGTGGGCAAGG + Intergenic
979532307 4:121781668-121781690 TGGGGCACTAAGAGGAGACAGGG - Intergenic
980319438 4:131250215-131250237 TAGGAGAGAGAGAGGGGAAAAGG - Intergenic
981295093 4:143122602-143122624 TGGTACAAAGAGTGGGGAAAAGG + Intergenic
981754497 4:148126932-148126954 TGGCACACAGAGAAAGGAGAAGG - Intronic
981761616 4:148201273-148201295 TGTGGCACAGGGAGGGGAGATGG + Intronic
981927937 4:150159793-150159815 TGGGACAGTGAGAGGGGAGGTGG + Intronic
982145060 4:152378388-152378410 TGGAGCACAGATAAGGGACAAGG - Intronic
982753769 4:159194178-159194200 TGGGACGCAGAGAGGTGACGGGG + Intronic
983284565 4:165723176-165723198 TGGGCAACTGAGAGGGGAAAAGG + Intergenic
984102098 4:175499253-175499275 TGGGCCTCAGAGAGGAGAAAGGG + Intergenic
984620718 4:181949431-181949453 TGTGACAAAGAGAGAAGACAAGG - Intergenic
984814716 4:183825604-183825626 TGGGACACAGAGGACGGGCAGGG - Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986003248 5:3646881-3646903 AGGGAGAGAGAGAGGGGGCAAGG + Intergenic
987182613 5:15384251-15384273 AGGGACATGGAGAGGCGACAAGG - Intergenic
987251691 5:16107544-16107566 TGTGATACAGACAGGAGACAGGG + Intronic
988563363 5:32300578-32300600 TGGCAGACAGAGAGGGGGTATGG - Intronic
988672689 5:33398939-33398961 TGGGAGACAGAGAAGTGAGAAGG + Intergenic
990364621 5:55057723-55057745 TGGGAGACAGAGGGTGGACGGGG + Intergenic
992155376 5:73950373-73950395 TGCTACACAGAGAAGGGACTGGG - Intergenic
992159673 5:73989098-73989120 TGGGATACAGAGAGCAGACCTGG - Intergenic
993781022 5:92065471-92065493 TGGAAGACAGAGAGGGAGCATGG - Intergenic
994670031 5:102754115-102754137 TGGGAGAAAGAGAGGGGGCTGGG + Intronic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
995658865 5:114458736-114458758 TGGGATACAGAGAGGGAACCAGG + Intronic
997338857 5:133126848-133126870 TGGGAAAGAGAGAGAGGAAATGG + Intergenic
997362269 5:133302677-133302699 TGAGGGGCAGAGAGGGGACATGG - Intronic
997926278 5:138033310-138033332 TGGGAAACAGAGAGGACACTGGG + Intronic
998353599 5:141516553-141516575 TGAGTAACAGAGAGGAGACAGGG + Exonic
998784962 5:145699217-145699239 TGGGACCCAGAGATGGAGCAGGG + Intronic
998938933 5:147260263-147260285 AGAGAGACAGAGAGGGGAGAGGG - Intronic
1000019448 5:157306448-157306470 TGGGGAACAGAGAGGGAAGAAGG - Intronic
1001023674 5:168205479-168205501 TGGGCGACAGGGAGGGTACATGG + Intronic
1001084440 5:168690568-168690590 TGGGATACTGTGAGGGGACAGGG - Intronic
1001151017 5:169227103-169227125 TGGAAGACACAGAGGAGACAGGG + Intronic
1001396127 5:171420514-171420536 TGGGGCACAGGGAGGGGGCGCGG - Intronic
1001519121 5:172378209-172378231 TTAGACACACAGAGGGGAGAGGG - Intronic
1001865943 5:175105489-175105511 TGAGGCACAGAGAGGGGAAGTGG - Intergenic
1002100644 5:176855925-176855947 AGGAACACAGCGAGGGGCCAGGG - Intronic
1002180619 5:177429274-177429296 AGGGACACTGAAAGGGGACAGGG + Intronic
1002337618 5:178491101-178491123 GGGGAAAGAGAGAGGAGACACGG + Intronic
1002345527 5:178545509-178545531 TGGGAAACTGCAAGGGGACACGG + Intronic
1002434669 5:179223905-179223927 GGGGACTTAGAGAGGGGTCAAGG - Intronic
1002879379 6:1238005-1238027 TGGGACAGAAGGAGGAGACAAGG + Intergenic
1003119967 6:3311211-3311233 GGGGACACAGAGCAGGGACTGGG + Intronic
1003366024 6:5475820-5475842 TGGGACACAGAGAGGGGAATTGG - Intronic
1003551300 6:7104474-7104496 TGGGAGACAGGGAGGGGGAAGGG + Intergenic
1003716231 6:8649417-8649439 TGGGACACAGAGAGATACCAGGG - Intergenic
1004130321 6:12913275-12913297 TGGGACACAGTGAGAGCTCACGG - Intronic
1005413835 6:25580515-25580537 TGTGACACAGAAAGAGGTCAGGG + Intronic
1005506928 6:26477584-26477606 TGGAACACAGAGAGGGGCTTTGG + Intergenic
1006358516 6:33574449-33574471 CGGGGCACAGAGAGGGCAGAGGG + Intronic
1006480370 6:34288082-34288104 TGGGAAATAGAGAAAGGACAGGG + Exonic
1006839446 6:37019118-37019140 TGGGTCAGGGAGAGGGGAAAGGG - Intronic
1007246816 6:40469125-40469147 AGACACACAGAGAGGGGAAAAGG + Intronic
1007251784 6:40500226-40500248 TGGGACACAGAGCTGGGTGAAGG - Intronic
1007671814 6:43561326-43561348 TGGGACACAGAGATGTGAATAGG - Intronic
1007725947 6:43915677-43915699 TGGGACACAGAAACAGGACGTGG - Intergenic
1007836575 6:44678591-44678613 GAGGAGACAGAGAGGGGATAAGG - Intergenic
1008624986 6:53306353-53306375 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1008624994 6:53306379-53306401 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1008764670 6:54897117-54897139 AGGGTCTCAGAGAGAGGACAAGG - Intronic
1009593673 6:65708605-65708627 AGGGACACAGGGAGGGGGAAGGG - Intergenic
1011620510 6:89237885-89237907 TGGGACCCAGAGAGCCCACAGGG + Intergenic
1012090213 6:94883437-94883459 AGGGGCAGAGAGGGGGGACAGGG - Intergenic
1012506274 6:99949853-99949875 TGGGAAATGGAGAGGGGACAGGG + Intronic
1013347577 6:109276972-109276994 TGGGAGACAGAAAGGGCAAATGG + Intergenic
1013485796 6:110594945-110594967 TGAGACAGAGAGAGGAAACAGGG - Intergenic
1013770301 6:113620929-113620951 TGGGACAGAGAGACAAGACAGGG - Intergenic
1014302956 6:119706452-119706474 GGGGGCACAGAGAGAGGTCAGGG - Intergenic
1014754487 6:125288260-125288282 TGGGGCACAGACAGGGGAGGGGG + Intronic
1014961969 6:127697238-127697260 TGGGAAATAGAGAGGAGTCAAGG - Intergenic
1015390829 6:132679832-132679854 TGGGAAACAGGGAGGGGGAAAGG + Intergenic
1015441892 6:133258194-133258216 TGGGGCATAGAGTGGGGACGAGG + Intronic
1015767574 6:136735025-136735047 TGGAAAACAGAAAGAGGACAGGG + Intronic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1017266478 6:152451879-152451901 AGGGACACATACAGGGGAAAGGG - Intronic
1017374159 6:153748141-153748163 TGAGACTCAGAGAGGTTACATGG - Intergenic
1018869300 6:167769083-167769105 TGGGAGGCAGTGAGGGGCCAAGG - Intergenic
1019015070 6:168874098-168874120 TGGGAGACAGAGGGGAGAGAGGG + Intergenic
1019410680 7:905274-905296 GGGGACACGGACGGGGGACACGG + Intronic
1019410972 7:906667-906689 GGGGACATGGACAGGGGACACGG + Intronic
1019410999 7:906748-906770 GGGGACATGGACAGGGGACATGG + Intronic
1020074525 7:5248846-5248868 AGGGACACAGTGAGGGGCCTGGG + Intergenic
1020937845 7:14489918-14489940 TGGGACAGAGAGAAGGGAGCTGG + Intronic
1021206899 7:17792253-17792275 TGGGGCTCAGGGAGGGGCCAAGG + Exonic
1021980436 7:26048922-26048944 TGGGACAGAGAGAGAGGGCTTGG + Intergenic
1022444415 7:30457969-30457991 TGGGACAGAGGGAGGGCAGAGGG + Intronic
1022739569 7:33108734-33108756 TGGGAGACAAAGAAGGGCCAGGG - Intronic
1023320369 7:38990752-38990774 TGAATCACAGGGAGGGGACATGG + Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1023928472 7:44688770-44688792 TGGGCCACAGAGAGGAGAGTAGG - Intronic
1024256067 7:47540811-47540833 TGGGACACTGAGGGTAGACAGGG + Intronic
1025014219 7:55425913-55425935 AGAGACACAGAGAGGGGCCAAGG - Intronic
1025204578 7:56984961-56984983 GGGGACACAGTGAGGGGCCTGGG - Intergenic
1025667359 7:63591974-63591996 GGGGACACAGTGAGGGGCCTGGG + Intergenic
1026837225 7:73647272-73647294 TGGGACAGAAAGAAGGGAGATGG - Intergenic
1026977075 7:74505489-74505511 AGGGACACAGAGAGGGAAGAGGG - Intronic
1027353264 7:77333218-77333240 TGGAAAACAGAGATGGAACAGGG + Intronic
1027488000 7:78786170-78786192 TGAGAGACAGAGAGGAGGCAAGG - Intronic
1027538471 7:79437197-79437219 TGGGAGTGGGAGAGGGGACAAGG + Intronic
1029532911 7:101137260-101137282 TGAGTCACAGAGCGGGGACCCGG - Intronic
1029657571 7:101937061-101937083 AGGGACACAGAGGGAGGCCATGG - Intronic
1030084335 7:105803994-105804016 TGAGAGTCAGGGAGGGGACAGGG - Intronic
1030820224 7:114085112-114085134 TGGGACCCAGGGCGGTGACAGGG - Intergenic
1031352617 7:120753626-120753648 TGGGACACAGAGGGAGGCCTGGG + Intergenic
1032015610 7:128378737-128378759 TGGGACCCAGAAAGATGACAGGG - Intergenic
1032223055 7:130008742-130008764 TGGGGCACAGAGAGTGGCTACGG + Intergenic
1034020903 7:147641184-147641206 TTAGACACATAGAGGGGAAAAGG - Intronic
1034051467 7:147988649-147988671 AGGCACCCAGAGAGAGGACATGG - Intronic
1034200514 7:149280684-149280706 AGGGACACAGACTGTGGACACGG - Intronic
1035579751 8:732056-732078 TGGGACACAGGGAGTGGTCAGGG + Intronic
1035771015 8:2147083-2147105 TGGGACAGAGAGAGGGCACTGGG - Intronic
1035849414 8:2900440-2900462 TAGGACAGAGAGTGGGGAAAGGG + Intergenic
1037618243 8:20540538-20540560 TGGAAGTCAGAGAGGGGTCATGG + Intergenic
1037817243 8:22118748-22118770 TGGGGCTCAGAGAAGGGGCAGGG - Intronic
1037961890 8:23103721-23103743 TGGGATACAGAGGGGACACACGG - Intronic
1037969579 8:23162718-23162740 TGGGATACAGAGGGGACACACGG + Intronic
1038426294 8:27466069-27466091 TGGGGCACAGAGATACGACAGGG + Intronic
1039069234 8:33634612-33634634 GGGGGCAGAGAGAGGGGAAAAGG + Intergenic
1039213040 8:35236843-35236865 TGGAACACAGAGAAGGAAAAAGG - Intronic
1039431469 8:37528522-37528544 TGGGACCCAGAGAGGAGACAGGG - Intergenic
1040303767 8:46201615-46201637 AGGCAAGCAGAGAGGGGACACGG + Intergenic
1040319836 8:46286959-46286981 TGGGACAGGCAGAGGGGAGAAGG - Intergenic
1040496167 8:47967316-47967338 TGGGCCACAAAGAGAGGGCAGGG - Intronic
1040933567 8:52760572-52760594 TGGGCCACTGTGTGGGGACAGGG + Intergenic
1041267668 8:56081044-56081066 CAGGACAAAGAGAGGAGACAGGG - Intergenic
1041500984 8:58538476-58538498 TGGGAGACAGAGAGGGAGAAGGG + Intergenic
1041719364 8:60962183-60962205 TGTTACACAGAGAGAGGAGAGGG - Intergenic
1041780257 8:61570532-61570554 GGGGCACCAGAGAGGGGACAAGG - Intronic
1042175531 8:66034285-66034307 TGGGACACACAGAGGGTGCTGGG + Intronic
1042761800 8:72279608-72279630 TGGGTGAAAGAGAGGGGAAAGGG + Intergenic
1043142671 8:76609307-76609329 TGAGACTCAGAGAAGGGAAAGGG + Intergenic
1043925083 8:86027695-86027717 GGGGAGACAGGGAGGGGTCAGGG - Intronic
1044250797 8:90001904-90001926 TGGGGCACAAAGAGAGGACCCGG + Intronic
1044477053 8:92639349-92639371 TGAGGCACAGAGAAGGGAAAGGG - Intergenic
1046298936 8:112259974-112259996 TGACACACAGAGAGGGTACTGGG - Intronic
1047676373 8:127207323-127207345 TGGGAAAGAGAGAGGGGAGCGGG + Intergenic
1048088943 8:131217887-131217909 TGGGACACAGAGTGAGAAGATGG + Intergenic
1049030837 8:140036257-140036279 TGGAAGACAGACTGGGGACAAGG + Intronic
1049149192 8:141023452-141023474 AGGGAGACAGGGAGGGGACGGGG - Intergenic
1049184613 8:141243177-141243199 TGGGACACAGAAGGCAGACATGG - Intronic
1049239035 8:141527556-141527578 CCTGACACAGAGAGGGGGCAAGG - Intergenic
1049258791 8:141627826-141627848 TGAGGCCCAGAGAGGGGATACGG - Intergenic
1049282674 8:141758460-141758482 TGGGAGCCAGAGACGGGACTGGG - Intergenic
1049319438 8:141988160-141988182 AGGAACACAGAGAGGGGTCCAGG - Intergenic
1049575484 8:143387891-143387913 GCGCACACAGAGAGGGGCCAGGG - Intergenic
1049673302 8:143879051-143879073 TGGGCTTCAGAGAGGGGACCAGG - Intergenic
1050009557 9:1171972-1171994 AGGGACAAGGAGTGGGGACAGGG + Intergenic
1050101480 9:2124489-2124511 TGAGGCCCAGAGAGGTGACATGG + Intronic
1050146175 9:2570046-2570068 TGGGGCAGAGAGAGGGAAAAAGG - Intergenic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1050769766 9:9183258-9183280 TAGGACCCAGAGAAGGGAAAGGG + Intronic
1051812140 9:21061336-21061358 AGGGCCACAGAGAGGGGAAGTGG - Intergenic
1052727298 9:32244712-32244734 TGGGACCCAGAGATGGTGCAGGG - Intergenic
1053114910 9:35491613-35491635 TGGGAGACAGAAAGCGGAAAAGG - Intronic
1053315345 9:37046411-37046433 TGGGACACAGCCAGGGGAATGGG - Intergenic
1053448844 9:38175956-38175978 TGGGGCAAAGAGAGGGAAGATGG - Intergenic
1053647365 9:40131272-40131294 TGGGACACACAGGGTGGCCAGGG - Intergenic
1053758362 9:41332571-41332593 TGGGACACACAGGGTGGCCAGGG + Intergenic
1054537214 9:66244898-66244920 TGGGACACACAGGGTGGCCAGGG + Intergenic
1054818373 9:69497437-69497459 TGGGCCACACAGAGGGGACCTGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056689033 9:88790244-88790266 TGAGAGACAGAGAAGGGGCAAGG + Intergenic
1056927367 9:90846314-90846336 AGGGACACTGAGAGGTGACCAGG - Intronic
1056956516 9:91086086-91086108 TGGCACACTCAGAGGGGGCATGG + Intergenic
1057416061 9:94863240-94863262 AGGGAAACAGAGAGAGGAGAGGG - Intronic
1057693480 9:97307566-97307588 TGGGACACAGGGAGGAGAATTGG - Intronic
1057849717 9:98555997-98556019 TGGGAGACATGGAGGGGAAAGGG + Intronic
1057973502 9:99579664-99579686 TGGGACAGAGAGTGGGGGGAAGG + Intergenic
1058723371 9:107778938-107778960 TGGGACATAAAGAGAGGCCATGG + Intergenic
1059908158 9:119011715-119011737 AGGGACACAGCAGGGGGACAGGG + Intergenic
1060066237 9:120503764-120503786 GGGGACAGAGAGAGGTGACACGG - Intronic
1060134319 9:121136958-121136980 TTGGCCACGCAGAGGGGACAGGG + Intronic
1060203129 9:121663769-121663791 GGGGACATAGAGAGAGGCCAAGG + Intronic
1060686876 9:125622815-125622837 GGGGAGACGGAGAGGGGAGAGGG - Intronic
1060815416 9:126632649-126632671 CGGGAACCAGAGAGGGAACAGGG + Intronic
1060998996 9:127891764-127891786 GGGGACAGAGAGGGGGGAGAGGG + Intronic
1061130231 9:128704116-128704138 TGGAACACAGAGAGGTAAGATGG + Intronic
1061419090 9:130463647-130463669 TGAGGCTCAGAGAGGTGACAGGG + Intronic
1062167180 9:135113712-135113734 TGGGTCACAGTGAGGCGGCAAGG + Intronic
1062268922 9:135699918-135699940 AGGGACACAGGGAGGGGGAAGGG + Intergenic
1062291607 9:135797778-135797800 GGGGACACTGAGGGAGGACATGG - Intergenic
1062484029 9:136765261-136765283 GGGGACACAGAGAGGTCACTTGG - Intronic
1062498647 9:136843106-136843128 TGGGACACAGAGGGGGGACCCGG + Intronic
1062694282 9:137865211-137865233 CTGGACACAGAGAGGGGGCTGGG + Intronic
1202795149 9_KI270719v1_random:114569-114591 TGGGACACACAGGGTGGCCAGGG - Intergenic
1203746739 Un_GL000218v1:44371-44393 TGGGACACAGAGGCTGGAGACGG - Intergenic
1203451051 Un_GL000219v1:117140-117162 AGGGACATAGAGAAGGGATAGGG - Intergenic
1203563365 Un_KI270744v1:75109-75131 TGGGACACAGAGGCTGGAGACGG + Intergenic
1185606595 X:1370569-1370591 TGGGACACAGGGAGAAGACGGGG + Intronic
1185606807 X:1371734-1371756 TGGGACACAGGGAGAAGACGGGG + Intronic
1185606852 X:1371968-1371990 TGGGACACAGGGAGAAGACGGGG + Intronic
1185607023 X:1372901-1372923 TGGGACACAGGGAGAAGACGGGG + Intronic
1185607068 X:1373135-1373157 TGGGACACAGGGAGAAGACGGGG + Intronic
1185607447 X:1375232-1375254 TGGGACACAGGGAGAAGACGGGG + Intronic
1185607535 X:1375698-1375720 TGGGACACAGGGAGAAGACGGGG + Intronic
1185607580 X:1375932-1375954 TGGGACACAGGGAGAAGACGGGG + Intronic
1187501293 X:19841176-19841198 TGGGTCACAGAGCAGGGCCACGG - Intronic
1188507170 X:30895099-30895121 GGTGACACAGTGAGTGGACAGGG + Intronic
1188544842 X:31293726-31293748 TGAGACACAGAGCGGGGCTATGG + Intronic
1189075953 X:37914579-37914601 GGGGAGACAGAGATGGGATAAGG + Intronic
1189084703 X:38009809-38009831 TGGTTCACAGAGAGTGCACAGGG - Intronic
1189206147 X:39240778-39240800 TGGGACACAGCGAGAGGAAATGG + Intergenic
1189313990 X:40040828-40040850 AGAGAGAAAGAGAGGGGACAAGG - Intergenic
1189436581 X:40998174-40998196 TGGGGCACGGACAGGGGCCAGGG + Intergenic
1189732334 X:44034270-44034292 AGTTTCACAGAGAGGGGACATGG + Intergenic
1190007334 X:46753272-46753294 TGGGAGAGAGAGAGGGGAGGTGG - Intronic
1190322950 X:49189011-49189033 GGGTAAACAGAGAGGGGCCAAGG + Exonic
1192151353 X:68714817-68714839 TGGGACTTAGGGAGGGGAGAGGG - Intronic
1192212967 X:69139432-69139454 TGAGGCCCAGAGAGGGGGCAGGG + Intergenic
1192215794 X:69157209-69157231 TGGGAGACACAGAGAGGAAAGGG + Intergenic
1194564916 X:95473457-95473479 TGAGTCACAGAGAGGTCACACGG + Intergenic
1195105639 X:101599710-101599732 TGGGAGACCGAGAGGGCACCGGG - Intergenic
1195107243 X:101614057-101614079 TGGGAGACCGAGAGGGCACCGGG + Intergenic
1196435929 X:115674655-115674677 TTTGGCACAGAGAGGGGAGATGG + Intergenic
1196505587 X:116437114-116437136 TGGGAGGGAGAGAAGGGACAGGG - Intronic
1197776072 X:130119504-130119526 GGGGACAGAAAGAGGGGGCAGGG + Intergenic
1197814412 X:130482013-130482035 TGGGTCAGAGAGAGGAGACTAGG + Intergenic
1198298545 X:135310669-135310691 GGGGACACAGGAAGGGGACTTGG - Intronic
1200022727 X:153225736-153225758 TGGGATACAGAGAGGAGGCTCGG + Intergenic
1200053941 X:153448899-153448921 TGGCACACAGTGAGGAGGCAGGG + Intronic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic
1201160068 Y:11159385-11159407 TGGGACACAGAGGCTGGAGACGG - Intergenic