ID: 961381631

View in Genome Browser
Species Human (GRCh38)
Location 3:126499486-126499508
Sequence GCCCAGAGGGAGGCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1520
Summary {0: 1, 1: 0, 2: 20, 3: 139, 4: 1360}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961381622_961381631 1 Left 961381622 3:126499462-126499484 CCTAGATGGCAACTTAAACACAG 0: 1
1: 0
2: 0
3: 34
4: 227
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381619_961381631 11 Left 961381619 3:126499452-126499474 CCATGGCCACCCTAGATGGCAAC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381613_961381631 29 Left 961381613 3:126499434-126499456 CCACCCAAGGCAGGACACCCATG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381620_961381631 5 Left 961381620 3:126499458-126499480 CCACCCTAGATGGCAACTTAAAC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381618_961381631 12 Left 961381618 3:126499451-126499473 CCCATGGCCACCCTAGATGGCAA 0: 1
1: 0
2: 1
3: 24
4: 138
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381616_961381631 25 Left 961381616 3:126499438-126499460 CCAAGGCAGGACACCCATGGCCA 0: 1
1: 0
2: 3
3: 19
4: 220
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381615_961381631 26 Left 961381615 3:126499437-126499459 CCCAAGGCAGGACACCCATGGCC 0: 1
1: 0
2: 4
3: 32
4: 175
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360
961381621_961381631 2 Left 961381621 3:126499461-126499483 CCCTAGATGGCAACTTAAACACA 0: 1
1: 0
2: 0
3: 17
4: 146
Right 961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG 0: 1
1: 0
2: 20
3: 139
4: 1360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961381631 Original CRISPR GCCCAGAGGGAGGCTGGGGA AGG Intronic
900344892 1:2205825-2205847 GCGCAGGGGGAGGCTGGGAAGGG + Intronic
900403236 1:2481409-2481431 GCCCAAAATGTGGCTGGGGATGG - Intronic
900546269 1:3230955-3230977 TCCTGGAGAGAGGCTGGGGAAGG + Intronic
900552605 1:3264326-3264348 GCCAGAAGGGAGGCAGGGGAGGG + Intronic
900552672 1:3264532-3264554 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900552733 1:3264686-3264708 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900595261 1:3477480-3477502 GCCCCGAGGGAGGGTTGGCAGGG - Intronic
900611339 1:3545814-3545836 GGCCAGCGGGAGGCTGGGGGAGG - Intronic
900766596 1:4509979-4510001 GATCTGAGGAAGGCTGGGGAAGG - Intergenic
900779724 1:4610221-4610243 GCTGTGAGGGAGCCTGGGGAGGG + Intergenic
900780378 1:4614036-4614058 GCCCTGAGGGCAGCTGGGGAGGG + Intergenic
901099495 1:6708380-6708402 GGGAAGAGGCAGGCTGGGGAGGG + Intergenic
901126268 1:6930885-6930907 GCCCAGAGCCAGGCTGAGGGAGG - Intronic
901138125 1:7010728-7010750 GCACAAAGGAAGGCTGGGGCTGG - Intronic
901233370 1:7653507-7653529 GCACTTTGGGAGGCTGGGGAGGG - Intronic
901286414 1:8082756-8082778 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
901315393 1:8304040-8304062 GGACAGAGGGAGGCAGGTGATGG + Intergenic
901449704 1:9328630-9328652 GGCCAGAGGGAGGCAGTGGGTGG - Intronic
901459303 1:9382206-9382228 GGCCAGGGTGAGGATGGGGACGG + Intergenic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901654166 1:10759824-10759846 GCCTAGAGGATGTCTGGGGAGGG - Intronic
901872212 1:12144861-12144883 GCCCAGAGGGAGGAAGGCCATGG - Intergenic
901882666 1:12203319-12203341 GCCCAGAGGGAGCCTGGCCCTGG - Intronic
901956973 1:12793406-12793428 TCCCAGAGGGAGGCAGGTGAAGG - Exonic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901980369 1:13029542-13029564 TCCCAGAGGGAGGCAGGTGAAGG - Intronic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901989067 1:13097771-13097793 TCCCAGAGGGAGGCGGGTGAAGG + Intergenic
901992746 1:13128996-13129018 TCCCAGAGGGAGGCGGGTGAAGG - Intergenic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902001718 1:13199389-13199411 TCCCAGAGGGAGGCAGGTGAAGG + Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902007782 1:13246041-13246063 TCCCAGAGGGAGGTGGAGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902020946 1:13345114-13345136 TCCCAGAGGGAGGCAGGTGAAGG + Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902087433 1:13874319-13874341 GCACAGAGAGAGGCTGAGGGAGG - Intergenic
902321922 1:15673945-15673967 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
902375456 1:16028192-16028214 GCTCAGTGGGAGGATGGGGGTGG - Intronic
902609409 1:17588352-17588374 GCCCCTGGGGAGGCTGGGAAAGG + Intronic
902681587 1:18047615-18047637 GGCCATGGGGAGGGTGGGGAAGG + Intergenic
902683127 1:18057944-18057966 GCCAAGAAGGAGGCTGGAGCTGG - Intergenic
902830464 1:19009189-19009211 GGCCAGTGGGAGGGTGGGGGGGG - Intergenic
903000498 1:20262182-20262204 CCCCAGCGGGAGGGTGGAGAAGG - Intergenic
903039607 1:20518871-20518893 TCCCAGTGGGAGGCTGAGGCAGG + Intergenic
903063202 1:20684447-20684469 TCCCAGAGAGTGCCTGGGGATGG + Intronic
903233498 1:21935883-21935905 GCCCAGAGTGGGGATGGGGGAGG + Intronic
903258657 1:22119364-22119386 TCCCAGGGGCAGGCTGGGGCAGG + Exonic
903299510 1:22368671-22368693 GCCCAGAGGTTGGCCGGGTACGG + Intergenic
903845877 1:26279831-26279853 GCTCAGTGTGAGACTGGGGAGGG - Exonic
903848463 1:26292046-26292068 GCCCAGCTTGAGGGTGGGGATGG - Intronic
904231857 1:29080633-29080655 GCACTTTGGGAGGCTGGGGAGGG - Intronic
904468972 1:30724022-30724044 GGGCACAGTGAGGCTGGGGAAGG - Intergenic
904613738 1:31738867-31738889 GCTCAGCTGGAGGCTGGGTAGGG + Exonic
904686233 1:32262712-32262734 GACCAGAAGGAGTCTGGGCATGG - Intronic
904748944 1:32728923-32728945 ACCCATGGGGATGCTGGGGAGGG + Intergenic
904817658 1:33217538-33217560 GCCCAGTGGTAGGATGGGGGTGG - Intergenic
904901713 1:33862757-33862779 GCTCACAGGGAGGAAGGGGATGG + Intronic
904925335 1:34043168-34043190 GCACTTAGGGAGGCTGGGGCAGG - Intronic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905240867 1:36580687-36580709 GGGAGGAGGGAGGCTGGGGAGGG + Intergenic
905302583 1:36995882-36995904 GCCAAGAAGGCGGCTGGTGAAGG - Intronic
905309781 1:37041298-37041320 GCCCAGAATGGGGCTGGGGCTGG + Intergenic
905477964 1:38242183-38242205 GCTCTGAGGGATGCAGGGGAGGG - Intergenic
905914669 1:41676376-41676398 GGCCTGGGTGAGGCTGGGGATGG + Intronic
906090659 1:43176778-43176800 GTAGATAGGGAGGCTGGGGAGGG + Intronic
906094677 1:43214130-43214152 GCACATTGGGAGGCTGAGGAGGG - Intronic
906191328 1:43901254-43901276 GCCCTGAGGGAGGCTGTGACAGG - Intronic
906350276 1:45052873-45052895 GCCCTGTGGGAGGCTGAGGTGGG + Intronic
906438193 1:45815414-45815436 GCACTTAGGGAGGCTGAGGAGGG - Intronic
906962107 1:50425148-50425170 GCCCACCGGGAGGCTGAGGCTGG + Intergenic
907046579 1:51303448-51303470 GACTACAGGGAGGCTGGGGAAGG - Intronic
907048656 1:51315254-51315276 TCCAGGAGGTAGGCTGGGGAGGG - Intronic
907221104 1:52907474-52907496 GCTCAGAGGGTGGGTTGGGAAGG + Intronic
907722163 1:56982266-56982288 AGCCAGAGGGATGGTGGGGAGGG - Intergenic
908142966 1:61206808-61206830 GCCATGAGGTAGGCTTGGGAGGG - Intronic
908170318 1:61497829-61497851 GCCCAGTGGGAGGATGAGAAGGG + Intergenic
908677649 1:66623495-66623517 GCCCTGTGGGAGGCTGAGGCGGG - Intronic
910522861 1:88142787-88142809 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
911121287 1:94299748-94299770 AGCCAGAGGGAGGAAGGGGAGGG + Intergenic
911610139 1:99951370-99951392 GCCACGAGGGAGGCTGAGGCAGG + Intergenic
911634214 1:100215572-100215594 GCACTGTGGGAGGCTGAGGAGGG + Intronic
911687352 1:100792538-100792560 GTCCACTGGGAGGCTGGAGAGGG + Intergenic
912026193 1:105177213-105177235 GCACTTAGGGAGGCTGAGGAAGG - Intergenic
912530128 1:110314548-110314570 GCCCAGACGGAGGATGGGCTGGG + Intergenic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
912828535 1:112929249-112929271 CCCCAGATGGAGGCTGGGGCTGG - Exonic
913108856 1:115640605-115640627 GCCTACTGGGAGGCTGGGGGTGG + Intergenic
913371128 1:118101166-118101188 GCACTGTGGGAGGCTGAGGAGGG + Intronic
913521730 1:119650907-119650929 GGCCAGAGGAAGGCTTGGGAGGG + Intergenic
913971852 1:143422522-143422544 GCCCAGAGGTCGGCTGGAGAGGG + Intergenic
914066231 1:144248135-144248157 GCCCAGAGGTCGGCTGGAGAGGG + Intergenic
914112922 1:144718219-144718241 GCCCAGAGGTCGGCTGGAGAGGG - Intergenic
914428474 1:147599816-147599838 GCCCTGCGGGAAGCTGGGGGCGG + Intronic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914769178 1:150668336-150668358 GCCATGAGGCAGGCAGGGGAGGG - Intronic
915297118 1:154929259-154929281 GCCCTGGGGGAGGCAGGTGAGGG - Intronic
915532784 1:156513057-156513079 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
915580120 1:156808526-156808548 GCAAGGAGGGAGGATGGGGAAGG + Intronic
915597775 1:156905242-156905264 GGCCAGGGGGAGGCCAGGGAAGG - Intronic
915624674 1:157107329-157107351 GGGCAGAGGGAGGCAGGTGAGGG - Intergenic
915841336 1:159215881-159215903 GGGCAGAGGGAGCCTGGGAAAGG - Intergenic
915913656 1:159929006-159929028 GCCCAGAGCAGAGCTGGGGAAGG + Exonic
915916207 1:159942366-159942388 ACAGAGAGGGTGGCTGGGGAGGG - Intronic
916055683 1:161067818-161067840 GGACAGAGAGAGGCTGGTGATGG - Intronic
916752638 1:167737398-167737420 GGCCAGGATGAGGCTGGGGAGGG + Intronic
916961230 1:169892368-169892390 GCAACTAGGGAGGCTGGGGAGGG - Intronic
917450837 1:175146120-175146142 GCCCCCAGGGAAGCTGGGGAGGG + Intronic
917795552 1:178530313-178530335 GCCCAGAAGGTGGCTGAGGATGG + Intronic
918071962 1:181139749-181139771 GGCCAGAGGGAGGATGTGGCTGG + Intergenic
918237727 1:182596929-182596951 GCACAGGGAGAGGCTGGGGTAGG + Intergenic
918329390 1:183442893-183442915 GTCAAGTGAGAGGCTGGGGAAGG + Intergenic
918503568 1:185226443-185226465 TACCAGAGCGAGGCTGGGCATGG + Intronic
919467195 1:197936407-197936429 ATCCAGAAGGAGGCTGGGCATGG - Intergenic
919775982 1:201194278-201194300 GCCCAGAGGGGAGCTGCGGAGGG + Intronic
919808088 1:201392624-201392646 GCCCACAGGGAAGCTGGAGAGGG + Intronic
919937453 1:202264070-202264092 GGAAATAGGGAGGCTGGGGAGGG + Intronic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
920224934 1:204431624-204431646 GCACAGAGGGATGTCGGGGAGGG - Intronic
920262145 1:204695834-204695856 AGCCTGAGGGAGGCTGGGGCCGG + Intergenic
920300501 1:204985882-204985904 GGACAGAGGCAGGCTGGTGAGGG - Intronic
920311840 1:205053102-205053124 GCCCAGCTGGAGGCTGAGAAAGG - Exonic
920616890 1:207502418-207502440 GGCCATAGGCAGGCTGGGGAAGG + Intronic
920797485 1:209154577-209154599 GCACTGTGGGAGGCTGAGGAGGG + Intergenic
921043190 1:211453801-211453823 GGCCACAGTGAGGCTGGGGGAGG + Intergenic
921068837 1:211642488-211642510 GAACAGGGGGAGGCTGGGGTGGG + Intergenic
921094377 1:211874350-211874372 GCCCATGGGGGGGGTGGGGAGGG + Intergenic
921237117 1:213144497-213144519 GCACTGTGGGAGGCTGGGGCTGG - Intronic
921343338 1:214156166-214156188 GTCATGGGGGAGGCTGGGGAGGG - Intergenic
922242570 1:223765504-223765526 GCACAGATGGAGGGTGGGGCTGG + Intronic
922440607 1:225652887-225652909 GGCGAGAGAAAGGCTGGGGAGGG + Exonic
922480144 1:225934782-225934804 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
922668970 1:227494680-227494702 CCCAGGAGGGCGGCTGGGGAAGG + Intergenic
922670627 1:227506622-227506644 CCCAGGAGGGCGGCTGGGGAAGG - Intergenic
922719108 1:227891337-227891359 GCTCCGTGGGAGGCTGGGCAAGG + Intergenic
922801902 1:228368285-228368307 GTGGAGAGGGAGGCTGGGGCTGG + Intronic
922845954 1:228684281-228684303 GCACAGTGGGAGGCTGAGGCGGG - Intergenic
923236417 1:232037529-232037551 ACCCACAGTGAGGCTGTGGATGG + Intronic
923627527 1:235626424-235626446 GACTAGAGGGAGGCTAGTGAGGG + Intronic
923729716 1:236538629-236538651 GCTGCGAGGGAGGCTGGGAAAGG + Intronic
923778245 1:236998792-236998814 TCCCAGTGGGTGGCTAGGGAGGG + Intergenic
1062773447 10:124236-124258 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1062863059 10:825116-825138 GCCAAGAGAGAGGCTGGGCCTGG - Exonic
1062901356 10:1149072-1149094 CTCCAGAAGGAGGCTGGAGAGGG - Intergenic
1063307233 10:4915632-4915654 GCACATTGGGAGGCTGAGGAAGG - Intergenic
1063336788 10:5223098-5223120 GGCCACAGCGAGGCTGGGGGAGG + Intergenic
1063400322 10:5737514-5737536 GCACAGAGGGCCGCAGGGGAAGG - Intronic
1063541800 10:6941565-6941587 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1063938742 10:11106481-11106503 GCCCTTTGGGAGGCTGAGGAGGG - Intronic
1063963718 10:11328461-11328483 GCCAACAGGCAGGCTCGGGAAGG - Intronic
1064451755 10:15448459-15448481 GCCCAGAGTGATGCTAGTGAAGG + Intergenic
1065189798 10:23198843-23198865 GGCCGGGGGGAGGCGGGGGAAGG + Intergenic
1065190246 10:23201202-23201224 GCCCCAAGGGCGGCTGGGGGTGG + Intergenic
1065218119 10:23470356-23470378 GCACATTGGGAGGCTGAGGAGGG - Intergenic
1065420044 10:25533204-25533226 GCTCAGATTAAGGCTGGGGATGG - Intronic
1065667903 10:28082713-28082735 GCGCTGAGGGAGGCTGAGGCAGG - Intronic
1066392835 10:34992477-34992499 GCACTGAGGGAGGCTGAGGCAGG + Intergenic
1066677984 10:37908536-37908558 GCACATTGGGAGGCTGAGGAGGG - Intergenic
1066687053 10:37991386-37991408 GCCCTTTGGGAGGCTGAGGAAGG - Intergenic
1067089489 10:43259339-43259361 GCCCTGGGGGAGTCTGGGTAGGG - Intronic
1067279068 10:44857686-44857708 GTCTTGAGGGATGCTGGGGAAGG + Intergenic
1067432069 10:46251466-46251488 GCAGAGATGGAGGCTGGGGCGGG - Intergenic
1067658175 10:48212981-48213003 GCCCAGGGTTAGGCTGGGAAAGG - Intronic
1067696211 10:48537396-48537418 ACCCATAGTGAGGCTGGAGAGGG - Intronic
1067804328 10:49382676-49382698 GCCCAGAGGTAGGGTGAGGGTGG - Intronic
1068551849 10:58415800-58415822 GCCCAGAGGGCAGCTGAGGCTGG + Intergenic
1068630369 10:59291437-59291459 GAACAGAGGGAAGCTGGGGCGGG - Intronic
1068959216 10:62849873-62849895 CCACAGATGGGGGCTGGGGATGG - Intronic
1069250013 10:66256073-66256095 GCCCAGACAGAGGCAGGGGCAGG + Intronic
1069264657 10:66443089-66443111 GGCCACAGGGAGGCTGGGGGAGG + Intronic
1069574385 10:69516485-69516507 GCCTGGACTGAGGCTGGGGAGGG + Intergenic
1069610987 10:69772423-69772445 GACCAGAGGTAGGCTGGGAGAGG - Intergenic
1069620960 10:69836956-69836978 GGCCGGAGGGAGGGTGGGGCGGG + Intronic
1069630586 10:69894946-69894968 GCCCAGAAAGAGGCTGAAGAGGG - Intronic
1069641031 10:69955629-69955651 GCACCGTGGCAGGCTGGGGAAGG + Intronic
1069651604 10:70053441-70053463 GGCCCGAGGGAGCCCGGGGAGGG + Intronic
1069712028 10:70495756-70495778 GCACTGTGGGAGGCTGGGGCAGG + Intronic
1069717286 10:70529394-70529416 GGCCAGAGGGAGGTGAGGGAGGG - Intronic
1069751904 10:70750261-70750283 GCCTGGAGGGAGGTTGGGCAGGG + Intronic
1069872629 10:71542569-71542591 GCCCAGAGAGAGGCTGTACAGGG - Intronic
1069923790 10:71834072-71834094 GCCCAGAGGCAGCATGGGGCAGG + Intronic
1070193931 10:74139365-74139387 GCACTGTGGGAGGCTGAGGAAGG + Intronic
1070585756 10:77764725-77764747 CCCCAGAGGGAGGCTAGTGAGGG + Intergenic
1070664543 10:78333845-78333867 GCCCTGAGGAAGGCTGGAGTGGG + Intergenic
1070700423 10:78597951-78597973 GTCCAGAGGGAGGCCAGGCAAGG - Intergenic
1070984843 10:80679897-80679919 GCCCAAAGGGAGCCTCAGGATGG + Intergenic
1071609910 10:87022678-87022700 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1071840185 10:89462432-89462454 CTCCAGATGGAGGCTGGGGCTGG - Exonic
1072000939 10:91195067-91195089 GCTGAGAGTGAGGATGGGGAAGG + Intronic
1072525297 10:96265992-96266014 GTCTTGCGGGAGGCTGGGGAAGG + Intronic
1072583149 10:96757721-96757743 TCCCAGCGGGAGGCTGAGGCGGG + Intergenic
1072677466 10:97478965-97478987 GCCTATAGGGAGGCTGAGGTGGG + Intronic
1072749776 10:97969403-97969425 GCCCAAAGGAAGGCTCGGGCTGG - Intronic
1073204676 10:101762603-101762625 GCCCAGGGAGAGACTGGGCAGGG + Intergenic
1073204830 10:101763305-101763327 GCCAAGAGAGGGGCTAGGGAGGG + Intergenic
1073744123 10:106445938-106445960 GACAAGAGGGAGGCTGGGGGTGG - Intergenic
1074445029 10:113514519-113514541 CCCCAGATGGAGGCTGGGTGTGG - Intergenic
1074495637 10:113977930-113977952 GCCCAGAGAAAGGATGGGAAAGG - Intergenic
1075132290 10:119750013-119750035 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1075570187 10:123536107-123536129 GACTAGAGGGAGGCTGGAGGGGG + Intergenic
1075650016 10:124121610-124121632 GCCCAGAGTGAGTCTCGGGGTGG + Intergenic
1075752203 10:124782248-124782270 GCACAAAGGGAGGCTGAGGCGGG + Intronic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1075802216 10:125160597-125160619 GAGCGGAGGGAGGGTGGGGAGGG - Intronic
1075853280 10:125605846-125605868 GCCCTTTGGGAGGCTGAGGAAGG - Intronic
1075926263 10:126254063-126254085 GCCCAGGAGGGGACTGGGGAAGG - Intronic
1076187973 10:128463736-128463758 GGCAGGAGGGAGGCTGGGGGCGG + Intergenic
1076250245 10:128979312-128979334 GCCCACATGGAGTGTGGGGAGGG - Intergenic
1076377234 10:129999599-129999621 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1076570996 10:131432707-131432729 ACCCAGACAGAGGCTGAGGAGGG + Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1076687923 10:132206459-132206481 GGCCAGAGGGAGCCCCGGGAAGG - Intergenic
1076692476 10:132230823-132230845 GGGCAGAGGGAGCCTGGAGAGGG - Intronic
1076740447 10:132480363-132480385 GCCCTGAGGGAGACCGAGGAAGG + Intergenic
1076996226 11:298771-298793 GCCCAGGGTGTGGGTGGGGAAGG - Intronic
1077147099 11:1051222-1051244 GCCCGGAGGAGGGCTGGGCAAGG - Intergenic
1077213407 11:1383766-1383788 GCTACGAGGGAGGCTGGGGCAGG - Intergenic
1077219981 11:1411499-1411521 GCCCAGCGGTGGGCAGGGGAGGG + Exonic
1077259789 11:1610350-1610372 GCACATTGGGAGGCTGGGGCAGG - Intergenic
1077285317 11:1762973-1762995 GCCCAGAGCAAGGGTGGGGCAGG + Intronic
1077286561 11:1768549-1768571 GCACAGAGAGGGGCAGGGGAGGG + Intergenic
1077308013 11:1876514-1876536 GCCCAGAGGGCGGCTGGAGAGGG - Intronic
1077368598 11:2171293-2171315 GGGCAGAGGGAGGCAGGGGCAGG + Intronic
1077467019 11:2738242-2738264 GCCCAGGGGGAGGCAGGGTCTGG + Intronic
1077549315 11:3193082-3193104 GACCAGGGGGAGGCAGGGGCTGG - Intergenic
1077550338 11:3197390-3197412 CCCCAGGGTGAGGCTGGGGCGGG - Intergenic
1077717787 11:4599248-4599270 GCACTGTGGGAGGCTGAGGAGGG + Exonic
1077794557 11:5477915-5477937 GGCAGCAGGGAGGCTGGGGAGGG + Intronic
1077888396 11:6402476-6402498 GCCCACAAGCAGGCTGGGGAAGG - Intronic
1078023639 11:7674153-7674175 GCGGAGGGGGATGCTGGGGAAGG + Exonic
1078086104 11:8233756-8233778 TCCCAGAGCCAGGCTGGGGAAGG - Intronic
1078265737 11:9755360-9755382 GCACTTAGGGAGGCTGAGGAGGG - Intergenic
1078513370 11:12003287-12003309 CCCAAGAGGCAGGGTGGGGAAGG - Intronic
1078852447 11:15177235-15177257 TCCCAGAGGGAGAATGGGAATGG + Intronic
1079078320 11:17397110-17397132 GCCACAAGGGAGCCTGGGGATGG - Intronic
1079347619 11:19667004-19667026 GGTGGGAGGGAGGCTGGGGAGGG - Intronic
1079504012 11:21133514-21133536 GGCCAGAGGGATGCTGAGGATGG - Intronic
1079914683 11:26353812-26353834 GCCCTGTGGGAGGCTGAGGCAGG - Intronic
1080222930 11:29927368-29927390 TCTCACATGGAGGCTGGGGATGG - Intergenic
1080370258 11:31630573-31630595 GCACACTGGGAGGCTGAGGAGGG - Intronic
1080652591 11:34234483-34234505 TCCCAGGGTGAGGCTGGGCAAGG + Intronic
1081299896 11:41437924-41437946 GCCATGTGGGAGGCTGAGGAAGG + Intronic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1081873164 11:46392230-46392252 CCCCAGCGGGAGGCTGCGGGTGG + Intergenic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082005042 11:47414665-47414687 TCCCAGGGGAAGGGTGGGGAAGG + Intronic
1082034762 11:47636014-47636036 GCTCTTAGGGAGGCTGGGGCAGG + Intronic
1082854701 11:57796138-57796160 GCCCTGTGGGAGGCTGAGGTGGG + Intronic
1083033604 11:59615906-59615928 GCCCAGTGAGAGCCTGGGGTGGG + Exonic
1083264711 11:61541390-61541412 GTCCAGAGAGATGCTGGGGAGGG + Intronic
1083274250 11:61587892-61587914 GCCCAGAGGGAGGAGGGGGACGG + Intergenic
1083332192 11:61904114-61904136 GCCAAGAGCCTGGCTGGGGATGG - Intronic
1083442337 11:62685404-62685426 GCCGAGGAGGAGGCTGAGGAGGG - Intergenic
1083535949 11:63466789-63466811 GCCCAGAGGGAGGCGTGACATGG - Intronic
1083540225 11:63507105-63507127 GCCTGGAGGGAGCCTGGGAATGG + Intronic
1083592232 11:63902575-63902597 GGCCAGAGGGAGGATGGGAATGG - Intronic
1083596618 11:63920775-63920797 CCCCAGTGGGCGGCAGGGGAGGG - Intergenic
1083615890 11:64026269-64026291 GCCCTTAGGGAGGCTGAGGCAGG - Intronic
1083629763 11:64089486-64089508 GCCCTGGGGGAGTCAGGGGAGGG - Intronic
1083678269 11:64340040-64340062 GCCCAGAGGTTGGCGGCGGAAGG - Intergenic
1083721656 11:64606600-64606622 GCCCAGTGGGTGGGTGGGGTGGG - Exonic
1083733871 11:64668688-64668710 GGCCAGAGGGCAGCAGGGGAGGG + Intronic
1083738813 11:64696965-64696987 ACCCAGAGAGAGCCTGGGGAAGG + Intronic
1083746805 11:64741550-64741572 GCGTGGAGGGAGGCTGGGGGCGG + Intronic
1083757095 11:64797473-64797495 ACACAGAGGGAGGCTGGAGCTGG - Intronic
1083795005 11:65011224-65011246 GCCCTTTGGGAGGCTGAGGAAGG + Intergenic
1083904353 11:65660407-65660429 GCCCACAGGGAGGCTGGCAGGGG - Intronic
1084002648 11:66305475-66305497 ACCCTGAGTGAGGATGGGGAAGG + Intergenic
1084263545 11:67993564-67993586 GCCCAGAGACTGGCTTGGGAAGG + Intronic
1084308051 11:68299317-68299339 GCTCAGGGGGAGGCTGGAGGTGG + Intergenic
1084377165 11:68785272-68785294 GCGCAGTGGGAGGCTGGGAGTGG + Intronic
1084556574 11:69879478-69879500 GCCCAGGGGGAGGTGGGGGTGGG + Intergenic
1084564585 11:69921794-69921816 ACCCCGAGGAAGGCTGGGGCAGG + Intergenic
1084575461 11:69985712-69985734 GCGCAGCGGGAGGCCGGGGGCGG + Intergenic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1084706908 11:70820873-70820895 GCAGAGAGACAGGCTGGGGACGG + Intronic
1084809859 11:71605557-71605579 GCCCAGAGACTGGCTTGGGAAGG - Intergenic
1084877636 11:72145072-72145094 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1084907332 11:72358137-72358159 GCCCAGCCTGAGTCTGGGGATGG + Intronic
1085388143 11:76168845-76168867 GGCTAGAAGGAGTCTGGGGAGGG + Intergenic
1085402945 11:76245461-76245483 GCCCAGAGGGTAGGAGGGGAGGG + Intergenic
1085411120 11:76291329-76291351 GGCCAGAGGGGAGCAGGGGAAGG - Intergenic
1085507717 11:77069650-77069672 GCCCAGGAGGCTGCTGGGGAGGG - Intronic
1085574397 11:77589659-77589681 GCCCTGAGGGAGACTGCGGAGGG + Exonic
1085608572 11:77925194-77925216 GCTAAGAGAGAGGCTGGGAATGG + Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087027184 11:93661490-93661512 GCCCCTAGGCAGGCTGGGGCTGG + Intergenic
1087045973 11:93844302-93844324 TCCCAGAGTGAGTCTGGGGCAGG + Intronic
1087709714 11:101534380-101534402 GCACAGTGGGAGGCTGAGGTGGG - Intronic
1088843163 11:113643637-113643659 GCCCTGAGGCAGCCTAGGGAAGG + Intergenic
1088875866 11:113935803-113935825 GCCCAGCGGGAGGTTGGGGACGG + Intronic
1088963573 11:114695432-114695454 GGCCAGATGGAGGCTGGGTTTGG + Intronic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089545208 11:119219129-119219151 GCACTGAGGGAGGCTGAGGCTGG + Intronic
1089647471 11:119889681-119889703 TCCCAGAGGGAGGATGGGTATGG - Intergenic
1090326203 11:125888075-125888097 GACCAGGCGGAGGCCGGGGACGG + Intronic
1090422990 11:126588509-126588531 GCCCTGAGGCAGGGAGGGGAAGG + Intronic
1090449318 11:126792025-126792047 CCCAAAAGGGAGGCTGGGGTTGG - Intronic
1090459909 11:126881792-126881814 GCACTTAGGGAGGCTGAGGAAGG - Intronic
1090797699 11:130149292-130149314 GCCACGAGGGAGGCTGAGGCAGG - Intergenic
1090851031 11:130570750-130570772 GCATAGAGGGGGGCTGGTGAGGG + Intergenic
1090854175 11:130597801-130597823 GAACAGAGGGAGGCAAGGGATGG + Intergenic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091224403 11:133949031-133949053 GCCCAGGGGCTGGCTGGGGCTGG - Intronic
1091545504 12:1499034-1499056 GCACTTAGGGAGGCTGAGGAGGG - Intergenic
1091546232 12:1503110-1503132 GCCCAGAGCAAGGCAGGGGGAGG + Intergenic
1091601076 12:1918134-1918156 GCCCAGAGGGAGGGCAGGGGCGG + Intronic
1091686689 12:2567500-2567522 GCAGAGAGGGAGGCAGGGAAAGG - Intronic
1091727400 12:2855456-2855478 GACAAAAGGGAGCCTGGGGAAGG + Intronic
1092124487 12:6065796-6065818 GCCCAGAGGCAGGATGAGGTGGG + Intronic
1092217625 12:6694134-6694156 GCCCAAAGGGAGGCTGGGAAGGG + Exonic
1092230795 12:6774245-6774267 GCCCAGAGGGAGGGGGAGGGGGG + Intronic
1092722920 12:11459392-11459414 GCCCCTAGGGAGGCTGAGGTGGG + Intronic
1093055830 12:14554797-14554819 GCACAGGAGGAGACTGGGGAGGG - Intronic
1093057019 12:14566151-14566173 TACCTGGGGGAGGCTGGGGAGGG - Intronic
1093325907 12:17773956-17773978 GGCGGCAGGGAGGCTGGGGAAGG - Intergenic
1093941214 12:25056892-25056914 ACCCAGAGTGACTCTGGGGAGGG - Intronic
1094106548 12:26817857-26817879 GGGCAGAGGGAGGGTGGGGGAGG + Intronic
1094191806 12:27705806-27705828 GCCGAGAGGGGAGCTGGAGATGG + Intergenic
1095732231 12:45518746-45518768 ACCCACAGGGAGGCTGATGAAGG - Intergenic
1095890252 12:47229165-47229187 GCACTGTGGGAGGCTGAGGAGGG + Intronic
1095986786 12:48004552-48004574 GCCCAGCGGGGGGCAGGGGGCGG - Intergenic
1096165169 12:49416597-49416619 TCCCAGTGGGAGGCTGAGGCAGG - Intronic
1096261028 12:50091686-50091708 GCGACGTGGGAGGCTGGGGAGGG - Intronic
1096446701 12:51699498-51699520 GCTAAGAGGGAGGCTTGGGGAGG + Intronic
1096666461 12:53169739-53169761 GCGCAGGGAGAGGCTGAGGAGGG - Intronic
1096782136 12:53997608-53997630 GCAGAGAGGGAGGCGGAGGAAGG - Intronic
1097046147 12:56189173-56189195 GGGGAGAGGGAGGCTGGGGGAGG + Intronic
1097178447 12:57156946-57156968 GCCCATTGGGAGGCTGCGGGAGG + Intronic
1097195559 12:57240805-57240827 ACCCAGATGGGAGCTGGGGACGG + Intergenic
1097293706 12:57941638-57941660 GGCCAGAGCGAGACTGGGAAAGG - Exonic
1097961142 12:65532952-65532974 ACCTAGAGGCAGGCTGGGGGAGG - Intergenic
1098431093 12:70420939-70420961 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1098722824 12:73924562-73924584 GGCAACAGCGAGGCTGGGGAGGG + Intergenic
1098953900 12:76669082-76669104 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
1099858562 12:88202008-88202030 GCACTTTGGGAGGCTGGGGAAGG + Intergenic
1100306540 12:93355062-93355084 GCACATAGGGAGGCTGTGGCAGG + Intergenic
1100542617 12:95572297-95572319 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1100937607 12:99688191-99688213 GCACACAGTGAGGCTGGGGAAGG - Intronic
1101335895 12:103796590-103796612 GGCCAAAGGGATGATGGGGATGG - Intronic
1101384198 12:104241785-104241807 CCCAACAGGGAGGCTGAGGAAGG - Intronic
1101674789 12:106907952-106907974 GCTCAGAGGGCCTCTGGGGAAGG + Intergenic
1101909171 12:108849892-108849914 GCCCAGAAGGGAGCTGGGGGAGG + Intronic
1102026809 12:109718377-109718399 GGCTGGAGGGAGGTTGGGGAGGG - Intronic
1102236054 12:111295430-111295452 GCCTAGAGGGAGGACTGGGAGGG + Intronic
1102511716 12:113420632-113420654 CCCCATAGGGTAGCTGGGGATGG - Intronic
1102550104 12:113685419-113685441 ACATAGAGGGGGGCTGGGGAGGG + Intergenic
1102567911 12:113809079-113809101 GTCCAAAGGAAGGGTGGGGAGGG - Intergenic
1102959855 12:117085400-117085422 GCCCAGGGTGAGGGTCGGGAAGG + Intronic
1103186645 12:118963721-118963743 CCCCAGAAGGAGGCTGGGTGAGG - Intergenic
1103255838 12:119540704-119540726 GCCCTGAGGTAGGCTGGGCCTGG + Exonic
1103568025 12:121826837-121826859 GCCCAGGGTGTGGCTGGGGTCGG + Intronic
1103856406 12:123973391-123973413 TCCCGGAGGGAGGCGGGGGCCGG + Exonic
1103862259 12:124024779-124024801 GCCCTCAGGGAGGCTGGCAAGGG + Intronic
1103951589 12:124554434-124554456 GCACCGAGGGAACCTGGGGAGGG - Intronic
1104004314 12:124881471-124881493 GCGGAGAGGGAGGCAGAGGAGGG - Intronic
1104067813 12:125319766-125319788 GCCCTGTGGGAGGCTGAGGTGGG + Intronic
1104083922 12:125457603-125457625 TCCCACTGGGAGGCTGGGGCAGG + Intronic
1104652816 12:130548875-130548897 TCCAAGAGGTAGGCTGGGCACGG - Intronic
1104675576 12:130709902-130709924 GGCAGGAGGGAGGCAGGGGAAGG + Intronic
1104733290 12:131120935-131120957 GCGCAGAGCGGGGCTGGGGAGGG + Intronic
1104908493 12:132228277-132228299 GGTCAGAGGGACGCTGGGGAGGG - Intronic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1104963262 12:132498082-132498104 GCCCACAGGGCCTCTGGGGAGGG + Intronic
1104974396 12:132545995-132546017 GCACATGGGGAGCCTGGGGAGGG - Intronic
1104988792 12:132612775-132612797 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1105378953 13:19868995-19869017 GCACTTAGGGAGGCTGAGGAGGG - Intergenic
1105859259 13:24394945-24394967 CTCCTGAGTGAGGCTGGGGAAGG + Intergenic
1105933482 13:25075098-25075120 ACAAAGAGGGAGGCTGGGCACGG + Intergenic
1105962672 13:25356192-25356214 GCCCAGAGTGGGGCAGGAGAAGG + Intergenic
1106076525 13:26465546-26465568 GCCAGGAGGGATGCAGGGGAAGG + Intergenic
1106784047 13:33089602-33089624 TCCCAGTGGGGTGCTGGGGAGGG + Intergenic
1107228699 13:38082626-38082648 GCCTAGTGGGAAGGTGGGGATGG + Intergenic
1107383980 13:39888494-39888516 GAGCAGAGGGTGGCTGGGCATGG - Intergenic
1107414315 13:40187175-40187197 GGCCAGTGGGTGGCTTGGGAAGG - Intergenic
1107528991 13:41263780-41263802 GCCCAGAGCGGGGATGGAGATGG + Intergenic
1107968181 13:45615850-45615872 GCCAGGAGAGAGGCTGGGAAAGG - Intergenic
1108290583 13:48956109-48956131 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
1108526649 13:51291324-51291346 GGCAAGAGGGAGGCATGGGATGG - Intergenic
1108977255 13:56462894-56462916 GTCCAGAGGGAGTCAGGGGAAGG + Intergenic
1109136416 13:58656789-58656811 GCAGAGAGGGAAGCTGGAGAGGG + Intergenic
1109855990 13:68128831-68128853 GCCAAGAGGGCAGCTGGAGAGGG + Intergenic
1110128611 13:71979027-71979049 GCCCAGAGGGTGCCTAGGCATGG - Intergenic
1112197003 13:97236003-97236025 GCCCTGGCGGAGGCTGGGGAGGG + Intronic
1112415532 13:99200867-99200889 CCCCAGAGGGCGCCGGGGGAGGG - Exonic
1112867601 13:103925675-103925697 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1113449679 13:110398793-110398815 GCCCAGAGGCAGGGTGGAGTTGG + Intronic
1113681912 13:112250472-112250494 GCCTGGAGGGAGCCTGGGGAGGG - Intergenic
1113737848 13:112690593-112690615 GACGAGCGGGATGCTGGGGAGGG + Intronic
1113773803 13:112930688-112930710 GCACTGTGGGAGGCTGAGGAGGG + Intronic
1114195050 14:20469609-20469631 GCCCAGAGGGAGCTGGCGGAGGG + Intronic
1114527380 14:23375370-23375392 ACCGTGAGGGAGGCAGGGGAGGG - Intronic
1114611330 14:24042932-24042954 GCCGGGAAGAAGGCTGGGGAGGG - Intergenic
1114670881 14:24410290-24410312 GCCCATAGGAAGGTTGGGAAGGG - Intronic
1115819739 14:37201149-37201171 GCATTTAGGGAGGCTGGGGAAGG - Intronic
1115994442 14:39181191-39181213 GCTGAGAGGGAGGCTGGGACTGG - Exonic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1117362682 14:54992666-54992688 GCACTTTGGGAGGCTGGGGAGGG + Intronic
1117368088 14:55051317-55051339 GCCTCGAAGGAGGCTGGGTATGG - Intergenic
1117571419 14:57052631-57052653 GCCCTTTGGGAGGCTGAGGAAGG - Intergenic
1117772000 14:59142955-59142977 TCCCAAAGGCAGGCTGGGCACGG + Intergenic
1117999340 14:61508624-61508646 ACCCAGATGGAAACTGGGGAGGG - Intronic
1118278929 14:64411176-64411198 ACCCAGGTGGAGGTTGGGGAGGG - Intronic
1118300189 14:64608274-64608296 GCTCATAGGGAGGCTGAGGTGGG - Intergenic
1118311428 14:64696395-64696417 GGCCACAGGGATGCAGGGGAGGG + Intergenic
1118900402 14:69981069-69981091 GAGCAGAAGGAGGCTGGGGGAGG + Intronic
1119026172 14:71154655-71154677 GCACATTGGGAGGCTGAGGAGGG + Intergenic
1119033555 14:71211200-71211222 GCCCAGGAGGAGGATGGGGCTGG - Intergenic
1119324898 14:73753980-73754002 GGCCAGAGGGAGGCTGAGGAAGG + Intronic
1119387811 14:74268767-74268789 GCCCACTGGGAGGCTGAGGTGGG + Intergenic
1120308599 14:82802085-82802107 GCCAAGAGGGAGGGCAGGGAAGG - Intergenic
1120879923 14:89407583-89407605 GCACTGTGGGAGGCTGGGGCAGG + Intronic
1121078787 14:91090809-91090831 GTGCACAGGGAGGGTGGGGATGG + Intronic
1121087105 14:91155018-91155040 GACTAGAAGCAGGCTGGGGAGGG - Intronic
1121408545 14:93733983-93734005 ACCTAGAAGGAGGCTGGGGAGGG - Intronic
1121478111 14:94232810-94232832 GCCCTGTGGGAGGCTGAGGCGGG + Intronic
1121481394 14:94278574-94278596 GAAGAGAGGGAGGGTGGGGAAGG - Intronic
1121482807 14:94291607-94291629 GCCCAGAGAGAGGATGAGGGAGG - Intronic
1121915343 14:97832948-97832970 GCCCGGGTGGAGGCTGGGGGTGG - Intergenic
1122097812 14:99384237-99384259 GCCCAGAGGGAGGCGGGGATGGG + Intergenic
1122123211 14:99565597-99565619 GCCAGGAGGGAGGCTGGGAGCGG + Intronic
1122195523 14:100082174-100082196 GCCTGGAGGGATGCGGGGGAGGG - Intronic
1122263682 14:100537061-100537083 GCAGAGAGCAAGGCTGGGGAGGG + Intergenic
1122271987 14:100572447-100572469 GCCCTGAGGGAGGGTGGGGCTGG - Intronic
1122347706 14:101070792-101070814 GACCAGAGGGGGACTGGGAATGG + Intergenic
1122352483 14:101104083-101104105 GCCCAGAGGTAGGATGGCTATGG + Intergenic
1122459675 14:101884645-101884667 GAGCAGAGGCTGGCTGGGGAGGG - Intronic
1122469545 14:101956810-101956832 GCACTTAGGGAGGCTGAGGAGGG - Intergenic
1122504140 14:102221011-102221033 GCCCTGTGGGAGGCTGAGGTGGG - Intronic
1122634283 14:103122993-103123015 GGCCACAAGGAGGCAGGGGACGG - Intergenic
1122847083 14:104505981-104506003 CCCCTGAGTGAGGCTGGGGAAGG + Intronic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1122904376 14:104795240-104795262 GTCATGAGGGAGGCTGGGGCCGG + Intronic
1123135164 14:106021444-106021466 GCCAAGAGAGAGGCTGGGCCAGG - Intergenic
1202921833 14_KI270723v1_random:34700-34722 TCCCAGCGGAAGCCTGGGGACGG + Intergenic
1202923083 14_KI270724v1_random:2881-2903 TCCCAGCGGAAGCCTGGGGACGG - Intergenic
1123397175 15:19948636-19948658 GGCAACAGCGAGGCTGGGGAAGG + Intergenic
1123585710 15:21759314-21759336 GCCAAGAGAGAGGCTGGGCCAGG - Intergenic
1123622352 15:22201902-22201924 GCCAAGAGAGAGGCTGGGCCAGG - Intergenic
1123910233 15:24958589-24958611 GGCCAGAGAGAGACTGAGGAGGG - Intronic
1124183257 15:27498605-27498627 TCCCAGCAGGAGGCTGGGGCGGG - Intronic
1124485133 15:30107595-30107617 GCACTGTGGGAGGCTGAGGAGGG + Intergenic
1124518445 15:30389674-30389696 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1124540209 15:30576575-30576597 GCACTGTGGGAGGCTGAGGAGGG + Intergenic
1124758444 15:32431002-32431024 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1124842387 15:33255051-33255073 GCCCTTTGGGAGGCTGAGGAGGG + Intergenic
1124899339 15:33807822-33807844 GCCGAGAGGGCAGCTGGAGAAGG - Intronic
1124909573 15:33905706-33905728 TCCCAGAGGGAGGCTGAAGTGGG + Intronic
1125007779 15:34837464-34837486 GCCAAGAGGGAGGCTCAGGCAGG - Intergenic
1125032537 15:35086940-35086962 GCCCTTTGGGAGGCTGAGGAGGG + Intergenic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1125306291 15:38319622-38319644 GCCCTGTGGGAGGCTGAGGCGGG - Intronic
1125597852 15:40899078-40899100 GGCCAGGAGGAGGCTGAGGATGG + Intronic
1125637133 15:41198398-41198420 CCCCAAAGGGAGGCTGGGCAAGG + Intronic
1125684970 15:41558821-41558843 GGCCAGGGGGCGGCTGGGGCCGG + Intronic
1125724565 15:41861700-41861722 GGCAAGATGCAGGCTGGGGATGG + Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126837892 15:52685975-52685997 TCCCAGGGGGAGGCTGAGGTGGG - Intronic
1127006591 15:54577566-54577588 GTCCAGAGGGAGCCTGGAGAAGG - Intronic
1127264277 15:57348968-57348990 GCCAACAGGATGGCTGGGGAGGG - Intergenic
1127270055 15:57392329-57392351 GCCTAGAGGGAGGTTGGGGAAGG + Intronic
1127918978 15:63478313-63478335 GCCCATTGGGAGGCTAAGGAGGG - Intergenic
1127989706 15:64104517-64104539 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1128138516 15:65282253-65282275 GCCCTCTGGGAGGCTGGGGCGGG - Intronic
1128219900 15:65961701-65961723 GACCAGAGAGAGGCTGGAGCTGG + Intronic
1128281532 15:66398538-66398560 GCCCTTTGGGAGGCTGGGGCAGG + Intronic
1128295005 15:66511237-66511259 GCACATTGGGAGGCTGGGGTGGG + Intronic
1128343946 15:66842280-66842302 CACCCGCGGGAGGCTGGGGAGGG + Intergenic
1128357252 15:66936771-66936793 GTGCAGAGGGACGCTGGGGAAGG - Intergenic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1128430805 15:67591484-67591506 TCCCAGCTGGAGGCTGGGGCAGG - Intronic
1128715832 15:69907450-69907472 GCACTGAGGGAGGCTGAGGCAGG - Intergenic
1128731676 15:70025584-70025606 GCCAAGAGGGTGTCTGGGAAGGG + Intergenic
1128778834 15:70344668-70344690 GCCAAGGTGGGGGCTGGGGATGG - Intergenic
1128834111 15:70795231-70795253 GGGCTGAGGGAGGGTGGGGATGG + Intergenic
1128860157 15:71063487-71063509 GCCCTGAAGGGGGCTGTGGATGG - Intergenic
1128891278 15:71333896-71333918 GACCAGAGGGAGGTTGAGAAAGG - Intronic
1129105579 15:73305060-73305082 GCCCAGAGGGCTGCTGGGACTGG + Exonic
1129254672 15:74327282-74327304 GCCCAGAGCGAGGAAGGAGATGG - Intronic
1129322369 15:74782298-74782320 GGCCAGAGGCTGGCTGGGGCGGG - Exonic
1129325125 15:74795969-74795991 GCACATTGGGAGGCTGGGGCAGG + Intronic
1129382549 15:75177348-75177370 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
1129452839 15:75660245-75660267 CCACAGATGGGGGCTGGGGATGG + Exonic
1129607250 15:77030949-77030971 GCCTGAAGGGAGGCTGGGGCAGG + Intronic
1129771963 15:78208308-78208330 GCCTGGAGGGAGGCTGGGTGGGG - Intronic
1129816754 15:78561971-78561993 ACCCAGTGAGAGGCTGGGGCAGG + Intergenic
1129841867 15:78748585-78748607 TCCTATAGGGAGGCTGGGCATGG + Intergenic
1129937506 15:79463157-79463179 GCCTTGAGGGAGGCAGGGTAGGG - Exonic
1130014339 15:80175370-80175392 GCCCCTGGAGAGGCTGGGGAGGG - Intronic
1130306262 15:82713989-82714011 GCCCAGAGAGAGGAAGGGGCTGG - Intergenic
1130520622 15:84658299-84658321 ACCTAGCGGGAGGGTGGGGACGG - Exonic
1130547505 15:84867831-84867853 GCACTTTGGGAGGCTGGGGAGGG + Intronic
1131470630 15:92693693-92693715 GGCCAGAGAGAGGCTGAGGGTGG + Intronic
1131592999 15:93769310-93769332 GCCCAGGGGAAGGGTGGGCAGGG + Intergenic
1132067957 15:98748419-98748441 GCACTTTGGGAGGCTGGGGAAGG - Intronic
1132352608 15:101149139-101149161 GCCCAGAGGGTGCCCTGGGAAGG - Intergenic
1132496063 16:264062-264084 ACCCCCAGGGAGGCTCGGGAGGG - Exonic
1132830773 16:1926988-1927010 GGCCAGGAGGCGGCTGGGGAGGG - Intergenic
1132832404 16:1935009-1935031 ACCCAGAGTTAGGCTGGGCATGG - Intergenic
1132864907 16:2088468-2088490 CACCAGAGGTAGGCTGGGGTTGG - Exonic
1132928279 16:2444841-2444863 GCACTGTGGGAGGCTGGGGCAGG - Intronic
1132942384 16:2514494-2514516 GGCGAGAGGGAGGCTGGGGTGGG + Intronic
1132982424 16:2745300-2745322 GCCTGGAGGGAAGCTGGGGAGGG + Intergenic
1133215912 16:4292452-4292474 ACCCAGAGGGACACTGGAGATGG - Intergenic
1133460454 16:5982520-5982542 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
1133757803 16:8775826-8775848 GCCATAAGGGAGGCTGGGAAGGG + Intronic
1134005909 16:10818681-10818703 GCGCAGTCGCAGGCTGGGGAGGG + Exonic
1134386606 16:13779373-13779395 GCCCAGTGGGAGGCTGAGGCGGG - Intergenic
1135416835 16:22274853-22274875 TCCCATTGGGAGGCTGAGGAGGG - Intronic
1135688254 16:24515549-24515571 GCCCTTTGGGAGGCTGAGGAGGG + Intergenic
1136019434 16:27430567-27430589 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1136056071 16:27690639-27690661 GCCAAGAGGGAGGTGGGGAAGGG - Intronic
1136224988 16:28854179-28854201 GCTCTGTGGGAGGCTGGGGTGGG + Intronic
1136347347 16:29684675-29684697 GCCCAGAGGGTGGTAGGGAATGG - Intronic
1136375257 16:29861629-29861651 GCTTAGAGGGAGGATGGAGAGGG - Intronic
1136684445 16:31985964-31985986 GCCACTCGGGAGGCTGGGGAGGG + Intergenic
1136785072 16:32929507-32929529 GCCACTCGGGAGGCTGGGGAGGG + Intergenic
1136884711 16:33924297-33924319 GCCACTCGGGAGGCTGGGGAGGG - Intergenic
1137279776 16:46965975-46965997 GCCCTTTGGGAGGCTGGGGCAGG + Intronic
1137326035 16:47438115-47438137 GGCCACAGCGAGGCTGGGGTAGG + Intronic
1137446825 16:48537013-48537035 GGGCACAGGGAGGCTGCGGAAGG - Intergenic
1137662424 16:50220232-50220254 GCACTGCGGGAGGCTGAGGAGGG - Intronic
1137716192 16:50599765-50599787 GCCCAGAGCCAGGCAGGGCACGG - Intronic
1137901657 16:52275153-52275175 GCTACTAGGGAGGCTGGGGAAGG + Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1138460858 16:57146844-57146866 GCCCACAAGGAGGCCGGGGTTGG + Intronic
1138514645 16:57529275-57529297 GCCCAGAGGGAAGCGGGGCACGG - Exonic
1138583971 16:57958644-57958666 GCACCGAGGGAGGGTGGAGAGGG - Intronic
1139119727 16:64001283-64001305 GACCAGAAGTAGGCTGGGCACGG + Intergenic
1139428477 16:66898013-66898035 GCACTTTGGGAGGCTGGGGAAGG + Intergenic
1139517222 16:67459243-67459265 GCCCATAGAGAGGCTGGGTTGGG + Intronic
1139527701 16:67526999-67527021 GCACAGAGGGAAGTTTGGGATGG + Intronic
1139933752 16:70551788-70551810 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1140049593 16:71468348-71468370 AGCCAGAGGGAGGCTGGGCATGG - Intronic
1140442290 16:74997637-74997659 GCACTGTGGGAGGCTGGGGGTGG - Intronic
1140473980 16:75229478-75229500 CCCAGGAGGGAGGCAGGGGAGGG - Exonic
1140822972 16:78680161-78680183 GCACTGAGGGAGGCTGAGGCTGG + Intronic
1141216392 16:82028240-82028262 GACCAGAGGAAGGCTGTTGAAGG - Intergenic
1141332117 16:83120310-83120332 CACCAGAGGTAGGATGGGGATGG + Intronic
1141332397 16:83123523-83123545 GCCCTTTGGGAGGCTGAGGAGGG - Intronic
1141424093 16:83934405-83934427 GCCCCGAGGGGGGCTGGGGCTGG - Intronic
1141432213 16:83976119-83976141 AGCCAGAGGGAGGCTGGGATTGG + Intronic
1141659132 16:85432240-85432262 GCCCAGATGGAGGAGGGAGAGGG + Intergenic
1141822249 16:86454617-86454639 GCTAAGAGGAAGGCTGGGAAAGG + Intergenic
1142034200 16:87853763-87853785 GCCCGGAGGGAGGCGGGGAGTGG + Intronic
1142124343 16:88402724-88402746 GTCCAGAGGCAGGCGGGGGCCGG - Intergenic
1142203022 16:88770118-88770140 GCCTGGAGAGAGGGTGGGGAGGG - Intronic
1142319227 16:89370371-89370393 GCCCAGGGTGTGGCTGGGGCAGG - Intronic
1203087732 16_KI270728v1_random:1193516-1193538 GCCACTCGGGAGGCTGGGGAGGG + Intergenic
1142542676 17:672864-672886 GCACTGTGGGAGGCTGAGGAAGG + Intronic
1142695162 17:1629237-1629259 GCGCAGGGGGCAGCTGGGGACGG - Intergenic
1142737981 17:1913649-1913671 CTCAGGAGGGAGGCTGGGGAGGG + Intergenic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1143109340 17:4544684-4544706 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143109349 17:4544706-4544728 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143116466 17:4584399-4584421 GCCCAGCGGGACGGTGCGGAGGG - Intronic
1143311718 17:5997504-5997526 GCCCAGGGTGAGGCTCGTGATGG + Intronic
1143450954 17:7036402-7036424 CCCCCGACGGGGGCTGGGGATGG + Exonic
1143579656 17:7818120-7818142 GCCAAGTGGGATGCTAGGGAGGG + Intronic
1143608431 17:8003732-8003754 GCCCTGAGGAAGGTTCGGGACGG + Exonic
1143913776 17:10274095-10274117 GCAGAGAGGGAGGCTGAGGAAGG - Intergenic
1144270643 17:13612276-13612298 GACCAGAGGGATGATGAGGAAGG + Intergenic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1144835039 17:18152193-18152215 GCCAGGAGGGAGGGAGGGGAGGG + Intronic
1144967919 17:19089434-19089456 GGCCGGAAGGAGGCGGGGGAGGG - Intergenic
1144979998 17:19162629-19162651 GGCCGGAAGGAGGCGGGGGAGGG + Intergenic
1144988224 17:19215603-19215625 GGCCGGAAGGAGGCGGGGGAGGG - Intronic
1145189035 17:20822384-20822406 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1145709024 17:26951749-26951771 GCCCTTTGGGAGGCTGGGGTGGG - Intergenic
1145744298 17:27302669-27302691 GCACTTAGGGAGGCTGAGGAGGG - Intronic
1145796995 17:27661260-27661282 GCTCAGAGGGCTGCTGGGAAGGG - Intergenic
1145897555 17:28469252-28469274 GCCCTGTTGGAGGCTGGGCAGGG - Intronic
1146692857 17:34888534-34888556 GCACATTGGGAGGCTGAGGAGGG + Intergenic
1146763259 17:35496508-35496530 GGCCGGAGGGACGGTGGGGAGGG - Intronic
1146799845 17:35809676-35809698 GCCCTGAGGGAGGCTTGGGGTGG + Intronic
1146807326 17:35875406-35875428 GCTCTGAGTGAGGCTGGGAAAGG - Intronic
1146842110 17:36163461-36163483 GCTCAGAGGGCTGCTGGGAAGGG + Intergenic
1146844591 17:36174822-36174844 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1146854418 17:36251420-36251442 GCTCAGAGGGCTGCTGGGAAGGG + Intronic
1146856895 17:36262757-36262779 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1146863722 17:36325618-36325640 GCCCAGAGGGAGCCTTGGTGAGG - Intronic
1146870321 17:36375312-36375334 GCTCAGAGGGCTGCTGGGAAGGG + Intronic
1146872805 17:36386667-36386689 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1146877678 17:36426393-36426415 GCTCAGAGGGCTGCTGGGAAGGG + Intronic
1146936116 17:36813629-36813651 GCACAGCGTGGGGCTGGGGATGG - Intergenic
1146970509 17:37068042-37068064 GCCCGGCGGGATGCTGTGGAAGG - Intergenic
1147001727 17:37368158-37368180 GCTATGAGGGAGGCTGAGGAAGG + Intronic
1147066583 17:37926206-37926228 GCCCAGAGGGAGCCTTGGTGAGG - Intronic
1147073202 17:37975936-37975958 GCTCAGAGGGCTGCTGGGAAGGG + Intergenic
1147075688 17:37987292-37987314 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1147078115 17:38005767-38005789 GCCCAGAGGGAGCCTTGGTGAGG - Intronic
1147084724 17:38055474-38055496 GCTCAGAGGGCTGCTGGGAAGGG + Intronic
1147087213 17:38066838-38066860 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1147094051 17:38129702-38129724 GCCCAGAGGGAGCCTTGGTGAGG - Intergenic
1147100671 17:38179440-38179462 GCTCAGAGGGCTGCTGGGAAGGG + Intergenic
1147103158 17:38190801-38190823 GCCCAGAGGGAGCCTTGGTGAGG + Intergenic
1147145379 17:38481645-38481667 GCCACTCGGGAGGCTGGGGAGGG + Intronic
1147185327 17:38710279-38710301 GTCCAGGGGGAGGCTGGAAAGGG + Intronic
1147214319 17:38890533-38890555 GCAGGGAGGGATGCTGGGGAGGG + Intronic
1147239410 17:39080696-39080718 GCCCATGGGGCGCCTGGGGATGG + Intronic
1147298981 17:39508746-39508768 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1147341085 17:39753767-39753789 GGCCAGGGGGTGGCTGGGTAAGG + Intergenic
1147389973 17:40103183-40103205 GCCCAGAGGGTGGAGGGAGAGGG - Intergenic
1147433708 17:40392958-40392980 GCACTTAGGGAGGCTGGGGCGGG + Intronic
1147604234 17:41764888-41764910 GCCTTGAGGGCGGCTGGGGTGGG - Intronic
1147634610 17:41955996-41956018 GCACATTGGGAGGCTGAGGAGGG - Intronic
1147701553 17:42399176-42399198 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1147806852 17:43137938-43137960 GCCCTTTGGGAGGCTGGGGCGGG + Intergenic
1147988435 17:44319572-44319594 GCTGGGAGGGAGGCTTGGGAGGG - Intergenic
1147996597 17:44363245-44363267 GCCCAGGGGCGGGCTGGGGCGGG - Intronic
1148054311 17:44784747-44784769 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1148109745 17:45137712-45137734 GCCCAGAGGGAAGCTGTGGAGGG - Exonic
1148201359 17:45752097-45752119 GCCCAGATGGAGGTGGAGGATGG - Intergenic
1148321453 17:46757745-46757767 TCCGAGAGGGAGGCTGAGGTGGG + Intergenic
1148374218 17:47127645-47127667 GCCCTTTGGGAGGCTGGGGCGGG - Intronic
1148550048 17:48544735-48544757 GCCGGGCTGGAGGCTGGGGAAGG + Exonic
1148561697 17:48610242-48610264 GCCGAGAGGAAGGGTGGGGGCGG + Intronic
1148624606 17:49059431-49059453 TCCCAGCGGGAGGCTGAGGTGGG + Intergenic
1148809084 17:50279012-50279034 GGCCAGAGGCAAGGTGGGGATGG - Intronic
1148850814 17:50554223-50554245 GCACATAGGGAGGCAGGGGGTGG - Intronic
1148870936 17:50658521-50658543 GGCCAGAGGGAGGGGAGGGATGG + Intronic
1149230937 17:54533104-54533126 ACCTAGAGGCAGGCTGGGCATGG - Intergenic
1149847734 17:60017270-60017292 GCCCAGAGGGAGCCTTGGTGAGG + Intergenic
1150083608 17:62262487-62262509 GCTCAGAGGGCTGCTGGGAAGGG + Intergenic
1150086093 17:62273887-62273909 GCCCAGAGGGAGCCTTGGTGAGG + Intronic
1150258989 17:63773457-63773479 GCCGAGAGGCAGGCCGGGCAGGG - Exonic
1150284304 17:63946653-63946675 GCTCAGTCTGAGGCTGGGGAGGG + Intronic
1150355877 17:64484197-64484219 GGCAAGAGGCAGGCTGGGGGAGG + Intronic
1150441884 17:65197915-65197937 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1150449767 17:65257157-65257179 GCCAGGTAGGAGGCTGGGGAAGG - Intergenic
1150719362 17:67601502-67601524 GCACTGTGGGAGGCTGGAGAAGG + Intronic
1150905059 17:69327710-69327732 GCCAATGAGGAGGCTGGGGAGGG - Intergenic
1151280970 17:73073713-73073735 GGCCTGAGTGATGCTGGGGACGG + Intronic
1151293456 17:73166291-73166313 GCCCTGAGGGAGGCGGGGGGTGG + Intronic
1151345811 17:73500556-73500578 GAACAGAGGGAGGATGGAGAAGG - Intronic
1151354206 17:73548867-73548889 GGCCAGAAGGAGGCTGGGCTGGG - Intronic
1151392018 17:73793690-73793712 GCACAGAGGGAGGCCAGGCATGG - Intergenic
1151551551 17:74825233-74825255 GCCCAGTTGGAGGGTGGGCAGGG - Intronic
1151626270 17:75277796-75277818 GGGCAGGGGGAGGCTGGGGAGGG - Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1151834399 17:76573485-76573507 GCACAGAGGGTGGGAGGGGAAGG + Intronic
1151898094 17:76993960-76993982 GCCCTGGGGGAGGGTGGGGTGGG - Intergenic
1151898574 17:76996873-76996895 GCCCAGAAGGATGCTCGGGGGGG - Intergenic
1151966681 17:77435163-77435185 GCTCAGAGGGAGGCTTGGGCAGG - Intronic
1151974977 17:77479670-77479692 GCCCAGAGCGAGGGAGGGGCCGG - Intronic
1152092874 17:78256768-78256790 GCCCAGAAGGGCTCTGGGGAGGG - Intergenic
1152244896 17:79180219-79180241 GACCCTAGGTAGGCTGGGGATGG - Intronic
1152273807 17:79342016-79342038 GCTCACAGGGAGGCTGGGAGGGG - Intronic
1152323857 17:79624357-79624379 GAAGGGAGGGAGGCTGGGGAAGG + Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152599518 17:81254896-81254918 GAAGAAAGGGAGGCTGGGGAGGG + Intronic
1152699667 17:81812711-81812733 GGCCAGAGGGCAGCTGGGGGTGG + Intronic
1152784983 17:82243055-82243077 GTACAGAGGGAGGTTGGGGTGGG - Exonic
1152806144 17:82357294-82357316 GGCCAGAAGGGGGCCGGGGAGGG - Intergenic
1152839944 17:82560995-82561017 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1153993510 18:10420400-10420422 AGCCAAAGGGAAGCTGGGGAGGG + Intergenic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1155073850 18:22338447-22338469 GCACAGAGACAGGGTGGGGATGG + Intergenic
1155164112 18:23218859-23218881 GCCCTGATGGAGGCTGGGGAAGG + Intronic
1155197233 18:23486493-23486515 GCACTGTGGGAGGCTGAGGAGGG + Intronic
1155261828 18:24050623-24050645 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1156866486 18:41894419-41894441 ACACAGAGGTAGGCTGGGCACGG - Intergenic
1157074787 18:44453637-44453659 GCCCAGAGGGATGGAGTGGATGG - Intergenic
1157165236 18:45352704-45352726 GCCCAGATTGAGGCTGTGGTGGG + Intronic
1157209477 18:45729299-45729321 TCCCAGAGGCAGGCTGAGGGAGG - Intronic
1157506177 18:48228354-48228376 GGCCAGAGGCAGGCTTGGGAAGG - Intronic
1157604769 18:48919193-48919215 CACCAGAGCTAGGCTGGGGAAGG + Intergenic
1157680723 18:49603357-49603379 GGCCAGAGGGCGGATGGGCAGGG - Intergenic
1157726210 18:49966056-49966078 GCCCTGATGGGGGCTGAGGATGG + Intronic
1157843405 18:50980196-50980218 TCCCAGTGGGAGGCTGAGGCAGG + Intronic
1158544822 18:58387034-58387056 ACACAGAGGGAGGCAGGTGATGG - Intronic
1158682471 18:59581194-59581216 GCCCACTGGGAGGCTGAGGTAGG + Intronic
1159125330 18:64217450-64217472 GGCTAGAAGGAGGCTGGGAATGG + Intergenic
1159743991 18:72209402-72209424 GCCCACGGCGAGGCGGGGGAGGG - Intergenic
1160050865 18:75431851-75431873 GACCAGAGGGAGGCTGTATAAGG - Intergenic
1160054680 18:75467302-75467324 GCCTAGAGAGAGTCTGGGGGAGG - Intergenic
1160367057 18:78335441-78335463 GGCCAGAGGGAGGAGGAGGAGGG + Intergenic
1160539814 18:79614372-79614394 ACCGGGAGGGAGGCTGTGGATGG - Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160587955 18:79923078-79923100 GGCCAGAGGAAGGATGGGCATGG + Intronic
1160788249 19:911917-911939 GCCCAGAGGGCGAGTGGGGCCGG + Intronic
1160789029 19:914294-914316 AGCAAGAGGGAGGCTGGGCACGG + Intergenic
1160814177 19:1027735-1027757 GCCCAGTGGGCGTCGGGGGAGGG - Intronic
1160846009 19:1166251-1166273 GCCCAGAGGGAGGCCCGGTGAGG + Intronic
1160864990 19:1252492-1252514 GCCAGGAGGGAGGCTGGGGCTGG + Intronic
1160927008 19:1551347-1551369 GCACTGTGGGAGGCTGGGGCGGG + Intergenic
1160973578 19:1781123-1781145 GCCCACCTCGAGGCTGGGGAGGG + Intergenic
1161005279 19:1932645-1932667 GCCCAGAGGCAGCCAGGTGAGGG - Intergenic
1161014613 19:1977504-1977526 GCCCTGTGGGAGGCTGAGGCAGG + Intronic
1161237497 19:3205129-3205151 GCCCAGAGGGAGGCGGGGCGAGG - Intronic
1161245478 19:3249451-3249473 GCCCAGAGTGAGGCTGTGATTGG - Intronic
1161245501 19:3249528-3249550 GCCCAGAGTGAGGCTGTGATTGG - Intronic
1161245520 19:3249598-3249620 GCCCAGAGTGAGGCTGGGATTGG - Intronic
1161308644 19:3581370-3581392 GCCCTTTGGGAGGCTGGGGCAGG - Intergenic
1161379206 19:3955841-3955863 GCCCAGAGGAAGGCCAGAGACGG + Intergenic
1161394620 19:4038481-4038503 GTACAGTGGGCGGCTGGGGAGGG + Exonic
1161395230 19:4042011-4042033 GCACATTGGGAGGCTGAGGAGGG - Intergenic
1161407399 19:4098259-4098281 GTCCAGAGGCAGGAAGGGGATGG + Intronic
1161456125 19:4370517-4370539 GCCCTGTGGGAGAGTGGGGAGGG - Intronic
1161583173 19:5091721-5091743 GCCCAGGGGGAGGCGGCAGAAGG + Intronic
1161925106 19:7294046-7294068 GCCCAGAGGCAGCCCCGGGAAGG + Intergenic
1161950457 19:7464897-7464919 CCCAAGAGGAAGGCTGGGGAGGG + Intronic
1161959440 19:7515905-7515927 GCCCAGGAGGAGACTAGGGATGG + Intronic
1161993184 19:7696997-7697019 TCCCAGGGTGAGGCTTGGGAGGG - Exonic
1162065182 19:8121182-8121204 GAGGAGAGGGAGGGTGGGGACGG - Intronic
1162101822 19:8343352-8343374 GCCCAGTGGGACGGTGGGGTGGG + Intronic
1162137547 19:8565017-8565039 GCACAGTGGGAGGCTGAGGTGGG - Intronic
1162148929 19:8631350-8631372 GCTCACAGGGAGGCTGGAGGGGG + Intergenic
1162199129 19:9008617-9008639 GGCCAGAGGGGTGATGGGGATGG + Intergenic
1162417605 19:10547357-10547379 GGGCAGAGGGACACTGGGGAAGG + Intronic
1162477776 19:10911391-10911413 GGCCAGGAGGAGGCTCGGGATGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162735558 19:12745256-12745278 GGCCAGAGGGAGCCTGTGGTGGG - Intronic
1162753173 19:12841107-12841129 GCCCAGACAGTGGTTGGGGAGGG - Intronic
1162798408 19:13098268-13098290 GCCCCGAGGGTGGGTGGGGTGGG - Intronic
1162805420 19:13135772-13135794 GGCCAGAAGGAGGCTGGGGGCGG + Exonic
1163092915 19:15033682-15033704 GCACAGAGGGAGGAGGGGTAAGG - Intergenic
1163108264 19:15140613-15140635 GCCATGTGGGAGGCTGAGGAGGG + Intergenic
1163148976 19:15400084-15400106 TCCCAGGCGGAGGCTGTGGATGG - Intronic
1163234776 19:16023889-16023911 CCCCAGAGGGTGACTTGGGAGGG - Intergenic
1163333966 19:16659829-16659851 GCCCAGAGGGCGGATAGGGCGGG + Intronic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1163455321 19:17403105-17403127 GTCCGGAGGGAGGCTCTGGAGGG + Exonic
1163520425 19:17788392-17788414 GGCCTCAGGGAGGCTGGGGTGGG - Exonic
1163584518 19:18156545-18156567 GACCAGAGGGAGGAAGGGGAGGG + Intronic
1163600893 19:18248402-18248424 GCCAAGAGGGTGGCCGGGCATGG + Intronic
1163633422 19:18428069-18428091 AGCCAGAGGAGGGCTGGGGATGG + Intronic
1163634478 19:18431783-18431805 GGCCTGCGGGAGGCTGCGGAGGG - Exonic
1163689507 19:18730884-18730906 GTCCAGAGGGAGCTTGGAGAGGG + Intronic
1163723628 19:18910257-18910279 GCCCAGTGGGAGGGTGGGTGAGG - Intronic
1163779843 19:19240373-19240395 GCCCACAGAGAGGCTGAGGGAGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1164411439 19:28009189-28009211 GCAAAGAGGGAGGCTGGGAGAGG + Intergenic
1164476457 19:28579390-28579412 GCCCACAGGGATTCTGGGGCTGG - Intergenic
1165005914 19:32806586-32806608 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1165015100 19:32874993-32875015 GCCGAGCCTGAGGCTGGGGATGG + Intergenic
1165096230 19:33411357-33411379 GCCTGGACAGAGGCTGGGGATGG + Intronic
1165326670 19:35118107-35118129 GCACTGAGGGAGGCCGGGGTGGG + Intronic
1165383134 19:35495048-35495070 GCCCAGAGGGACGTTAGAGAGGG + Intronic
1165432784 19:35781938-35781960 GCCAAGAGGGAGGCAGGAGGTGG + Intronic
1165717551 19:38056199-38056221 GCCCAGAAGGAGGGTGGTGCTGG - Intronic
1165767222 19:38359188-38359210 GTCGAGAGGGTGGCTGGGGTGGG - Intronic
1165779908 19:38426227-38426249 GGCCTGAGGGTGGGTGGGGAGGG - Exonic
1165810307 19:38607961-38607983 GACCCCAGGGAGGATGGGGAGGG - Intronic
1165819511 19:38665669-38665691 GCCCAGATGGATGCAGGGGCTGG - Intronic
1165859243 19:38898559-38898581 GAGCAGAGGGAGGGAGGGGACGG + Intronic
1165911919 19:39234437-39234459 GTCCAGAGGGAGGCTGTGCCTGG - Intergenic
1165928722 19:39342761-39342783 CCCAGGAGGGAGACTGGGGACGG - Intronic
1166070547 19:40384856-40384878 GCACTTAGGGAGGCTGAGGAGGG - Intronic
1166284718 19:41817742-41817764 GCCACGAGGGAGGCTGAGGCAGG - Intergenic
1166296538 19:41892752-41892774 GCCCAGCTGGAGGCTTGGGTTGG + Exonic
1166299452 19:41905832-41905854 GACCAGAGGGATGCTGGGTGAGG + Intronic
1166322817 19:42029310-42029332 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1166336943 19:42114049-42114071 GAGCTGAGGGAAGCTGGGGAAGG + Intronic
1166432610 19:42740196-42740218 GCACTTAGGGAGGCTGAGGAGGG - Intronic
1166685271 19:44792854-44792876 GGCCACAGTGAGGCTGGGCACGG + Intronic
1166852582 19:45767638-45767660 GCCCGGAGGGAGTGTGGGGGCGG + Intronic
1167167816 19:47811248-47811270 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1167240603 19:48340976-48340998 GCCAACAGAGGGGCTGGGGAGGG - Intronic
1167249021 19:48391019-48391041 GCCCAGATTGGGGCTGGGGGTGG + Intronic
1167466077 19:49651682-49651704 GCGGAGCGGGAGGCTGAGGAAGG - Exonic
1167467718 19:49658866-49658888 GCTCACAGGGAGGCAGGGGCCGG + Intergenic
1167741478 19:51326996-51327018 GGCCTGAGGGAGGCGGGGGCTGG + Intronic
1168122247 19:54257988-54258010 GCACCTAGGGAGGCTGAGGATGG + Intronic
1168149825 19:54439775-54439797 GCACTGTGGGAGGCTGGGGCAGG + Intergenic
1168584685 19:57583274-57583296 GCCCTGAGGGCGGTTGGAGATGG + Intronic
1168678590 19:58296983-58297005 GCACTGTGGGAGGCTGAGGAGGG + Exonic
1168687469 19:58357475-58357497 GTTCCGAGGGAGGCAGGGGACGG - Exonic
924958401 2:11300-11322 GCACAGAGGGTCGCTGGGCAGGG + Intergenic
925035258 2:680166-680188 ACCCAGAGGCAGCCTTGGGAGGG + Intergenic
925188052 2:1863034-1863056 GCCCAGATGGACACTGGGAATGG + Intronic
925656973 2:6159524-6159546 GCCCAGAGGGAGATGGGGGTAGG - Intergenic
925986168 2:9216887-9216909 GACAAGGGGGAGGCTGGGCACGG - Intronic
926121991 2:10246380-10246402 GCCCTTTGGGAGGCTGAGGAAGG + Intergenic
926127695 2:10282066-10282088 CAGCAGAGGGAAGCTGGGGAGGG + Intergenic
926136032 2:10337188-10337210 TCCCATAGGGAGGCCAGGGAGGG + Intronic
926152446 2:10432612-10432634 GCCCAGAGTGGGGCGGGGTAGGG + Intergenic
926239705 2:11075590-11075612 GTTTTGAGGGAGGCTGGGGAAGG - Intergenic
926294599 2:11559824-11559846 ACCCAGAGGTGGGGTGGGGAGGG - Intronic
926341825 2:11910196-11910218 GAGCAGGGGGAGGGTGGGGATGG + Intergenic
926686746 2:15704096-15704118 TTCCCCAGGGAGGCTGGGGAGGG + Intronic
927214190 2:20657526-20657548 GCTCAGATGGAGACTGGTGATGG + Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927511506 2:23647001-23647023 GCAGAGAAGGAGGCTAGGGAAGG + Intronic
927517284 2:23679868-23679890 GGCCAGATGGAGGAAGGGGAGGG + Intronic
927590544 2:24353458-24353480 TCCCAGCGGGAGGCTGAGGTGGG + Intronic
927598424 2:24418736-24418758 GCTGGGAGGGAGTCTGGGGAAGG - Intergenic
927687218 2:25179447-25179469 GCCTAGGGGGATGCTGGGAAAGG - Intergenic
927754519 2:25698059-25698081 GAGGAGAGGGAGGCTGGGGCCGG + Intergenic
927875841 2:26654711-26654733 GCCCAGATGCAGTCTGGGGTGGG + Intergenic
927925536 2:27010872-27010894 GCCCAGGAGGAAGCTGGAGAGGG - Intronic
928136923 2:28694774-28694796 GCCCTGTGGGAGGCTGAGGCGGG + Intergenic
928157043 2:28886303-28886325 GCACATTGGGAGGCTGAGGAGGG + Intergenic
928242990 2:29602638-29602660 CCCCTGAGGGAGGCAGGTGAGGG - Intronic
928278344 2:29921811-29921833 GAACAGAGGGAGGGTGGGGCGGG - Intergenic
929032905 2:37665291-37665313 GCAGAGTGGGAGGGTGGGGATGG - Intronic
929542232 2:42831267-42831289 GCCAATAGGGAACCTGGGGAAGG + Intergenic
929589045 2:43133450-43133472 GACCAGCCTGAGGCTGGGGAAGG + Intergenic
929660977 2:43784549-43784571 TCCCAGCGGGAGGCTGAGGCAGG - Intronic
929808557 2:45169527-45169549 GCCCAGAGGGTGGCGGGGTTCGG - Intergenic
929829366 2:45334756-45334778 GCACAGAATGGGGCTGGGGAGGG - Intergenic
930036451 2:47088476-47088498 GCTCAGTGGGAGCCTGGGCATGG + Intronic
930313714 2:49772359-49772381 GCACTGAGGGAGGCTTGGCATGG - Intergenic
930421409 2:51157684-51157706 TCCCAGAAGGAGGTAGGGGAAGG - Intergenic
930813815 2:55571062-55571084 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
930882856 2:56291894-56291916 GCCCAGTGGGAGGCTGGTGCAGG + Intronic
932090325 2:68800229-68800251 GGCTAGAGGCAGGGTGGGGAGGG + Intronic
932421203 2:71602522-71602544 GTGCAGAGGGACGCTGGGAAAGG - Intronic
932555991 2:72825570-72825592 GCCCCGAGGGAGGCAGCGGGAGG + Intronic
932582984 2:73004634-73004656 GACCAGAGGGAGTGTGGAGAGGG + Intronic
932620893 2:73264494-73264516 GCCCCGAGGGAGGCAGTGGGCGG - Exonic
932657044 2:73619213-73619235 GCCGAGAGGGAGATTGGTGAAGG - Intergenic
932663709 2:73679473-73679495 GCCAAGAGGGAGATTGGTGAAGG - Intergenic
932765261 2:74465171-74465193 GCCGAGAGGGCGGCTCGGGGAGG - Exonic
933544706 2:83695441-83695463 GCCGAAAGGGAGGCTGGAAAGGG + Intergenic
933647083 2:84821564-84821586 GCCTAGGGGGAGGCAGTGGAAGG + Intergenic
933895581 2:86807723-86807745 GCGCGGAGGAGGGCTGGGGAGGG + Exonic
933949912 2:87320070-87320092 GCCAAGAGGCAAGTTGGGGAGGG - Intergenic
934176542 2:89583454-89583476 GCCCAGAGGTCGGCTGGAGAGGG + Intergenic
934286852 2:91657815-91657837 GCCCAGAGGTCGGCTGGAGAGGG + Intergenic
934523530 2:95034609-95034631 GCCAGGATGGAGGCTGGGGGAGG - Intronic
934558556 2:95300407-95300429 GCCCAGGGGTGGGCTGGGGAGGG - Intronic
934687550 2:96332967-96332989 GCCCAGAGAGACACTGGGCATGG + Intergenic
934758046 2:96838498-96838520 GCCCACAGGGAAGCAGAGGAAGG - Exonic
935171168 2:100612474-100612496 GCTGGGAGGGAGGCTGGGGCTGG + Intergenic
935286018 2:101564341-101564363 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
935708521 2:105877224-105877246 GGCCAGGGGGAGGGAGGGGAAGG - Intronic
935763639 2:106343603-106343625 GCTCCCAGGGAGGCTGGGCAGGG - Intergenic
935956853 2:108385556-108385578 GAGCAGAGGGCGGGTGGGGAAGG - Intronic
936010365 2:108921566-108921588 GCCCAGAGTGGGGCTGCTGATGG + Intronic
936013707 2:108942359-108942381 GCCAAGAGAAAGGCTGGCGATGG + Intronic
936276588 2:111103042-111103064 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
936330280 2:111541527-111541549 GCCAAGAGGCAAGTTGGGGAGGG + Intergenic
936428288 2:112437086-112437108 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
936535137 2:113305748-113305770 GCCCAGAGGGAGGCATGTGGAGG - Intergenic
936904923 2:117525802-117525824 GGCCACAGCGAGGCTGGGGGAGG + Intergenic
937039188 2:118807861-118807883 GCCCAGCGGGCTGCGGGGGAGGG + Intergenic
937366935 2:121269512-121269534 GCACTTAGGGAGGCTGGGGCAGG + Intronic
937420991 2:121755428-121755450 GGCCTGAGGGAGGGCGGGGACGG - Intronic
937851396 2:126639440-126639462 GCACAGAGGGAGGTTGGGGCAGG - Intergenic
938115501 2:128600542-128600564 GCCCTCAGGGAGGCATGGGAGGG + Intergenic
938137725 2:128772921-128772943 GCTCAGTGGAAGGCTGGGCAGGG + Intergenic
938261825 2:129902216-129902238 ACCCAGAGTGGGGCTGGGGCTGG + Intergenic
938288980 2:130139678-130139700 GCTCAGAAGCAGGCTGGGGGCGG + Exonic
938293455 2:130162451-130162473 GCACAGAGGAAGGCTGTGGAGGG - Intronic
938319796 2:130355530-130355552 GGCCCAAGGGAGGCCGGGGAGGG - Intergenic
938463098 2:131510510-131510532 GCACAGAGGAAGGCTGTGGAGGG + Intergenic
939149792 2:138459582-138459604 GCACACTGGGAGGCTGCGGAGGG - Intergenic
939163062 2:138611740-138611762 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
940321814 2:152385332-152385354 GTAGGGAGGGAGGCTGGGGATGG + Intronic
940974391 2:159926999-159927021 GCCCAGTGTGGGGCTGGGAAAGG - Intergenic
941898085 2:170650926-170650948 GCGCAGTGGGAGGCTGAGGCGGG - Intronic
942107607 2:172648765-172648787 GGCCACAGCGAGGCTGGGGGAGG + Intergenic
942247837 2:174023938-174023960 GGCCAGTGGGAGGCCAGGGAGGG + Intergenic
943459855 2:188158867-188158889 GCCCTTAGGGAGGCTGAGGGGGG - Intergenic
943547665 2:189300938-189300960 GCCCTTTGGGAGGCTGGGGCAGG + Intergenic
944391222 2:199221848-199221870 GCACAATGGGAGGCTGAGGAGGG - Intergenic
944877280 2:203975118-203975140 GCACTGTGGGAGGCTGAGGATGG + Intergenic
945270205 2:207930774-207930796 GCCCAGAGAGAGGCTGGCAGTGG + Intronic
945348837 2:208752203-208752225 GGCCACAGTGAGGCTGGGGGAGG - Intronic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946382040 2:219355330-219355352 GCAAAGAGGCAGGCTGTGGAGGG + Intergenic
946846827 2:223866643-223866665 GCACTTTGGGAGGCTGGGGAGGG - Intronic
946921491 2:224585407-224585429 GCCCAGAGGGTGGAGGGGGGAGG + Intergenic
947227296 2:227852778-227852800 GCAGAGAGGGAAGCTGGAGATGG + Intergenic
947523630 2:230865857-230865879 GCCCAGCGAGAGGCTGGGAATGG - Intronic
947524082 2:230868065-230868087 GCCCAGAGTGAGGGCGGGGTGGG + Intronic
947528389 2:230893443-230893465 GCCCAGGCTGAGGCTGGGGCTGG - Intergenic
947624552 2:231611626-231611648 GGGCAGAGAGAGGCTGGGGCAGG + Intergenic
947676829 2:231989588-231989610 GCACTGAGGGAGGCTGAGGCCGG + Intronic
947879099 2:233489425-233489447 GCTCTGAGGTGGGCTGGGGACGG + Exonic
948027127 2:234787222-234787244 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
948073099 2:235143467-235143489 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
948079281 2:235192142-235192164 GCTCCCAGGGAGGCTGGGAAGGG - Intergenic
948115787 2:235493870-235493892 GCCCAGAGGCAGGCGCGGGGCGG + Intergenic
948123440 2:235547737-235547759 GCACTGTGGGAGGCTGAGGAGGG - Intronic
948130793 2:235599332-235599354 GCCCAGGAGGAGTCTGGTGATGG + Intronic
948258535 2:236585728-236585750 GCCCTGAGGATGGCTGAGGACGG + Intergenic
948405880 2:237718493-237718515 CCACATAGGGAGGCTGCGGAAGG + Intronic
948427673 2:237898043-237898065 GCACTGTGGGAGGCTGAGGAGGG - Intronic
948586110 2:239020768-239020790 CCCCAGAGGGAGGCAGGAGGGGG - Intergenic
948706082 2:239793301-239793323 GGCCAGGTGGAGGCTGGGGAGGG - Intronic
948795312 2:240399545-240399567 GCCCAGCGGGGGGCAGGGCAGGG - Intergenic
948800550 2:240431493-240431515 GCCAAGAGTCAGGGTGGGGAGGG + Intergenic
948946667 2:241224010-241224032 GCACAGTGGGCGGCTGGGCAGGG - Intronic
948970558 2:241422289-241422311 GCACAGCGGTAGGCTGAGGAGGG + Intronic
948993773 2:241568087-241568109 GCTCTGAGGCAGGCTGGGCATGG - Intronic
949001830 2:241619161-241619183 GCCCAGGCGCAGGCTGTGGAAGG + Intronic
949020745 2:241739896-241739918 GCCCTTAGGGAGGCTGAGGTGGG + Intronic
949032216 2:241802555-241802577 GGCCAGAGGGAGGCCGGGTGGGG + Intronic
1168775064 20:440428-440450 GCCCAGAGAGAGGGAAGGGATGG - Intronic
1168800339 20:640661-640683 GGCCACAGTGAGGCTGGGCAGGG - Intergenic
1168848045 20:958777-958799 GCCCAGGGGTGGCCTGGGGAAGG - Exonic
1168938478 20:1688492-1688514 CCCCACAGTGAGGCTGGGGCAGG + Intergenic
1169043052 20:2511504-2511526 GCACAGAGGGATGCTGAGGGAGG - Intronic
1169120955 20:3095287-3095309 GGCCAGGGGCAGGCTGGGGCAGG - Intergenic
1169201602 20:3712859-3712881 CCCCTTAGGGAGGCTGGGGGAGG + Intergenic
1169215267 20:3790038-3790060 GCTCCTAGGGAGGCTGGGGTGGG + Intronic
1169226515 20:3860337-3860359 GACTATAGGGAGGCTGAGGAAGG - Intronic
1169405385 20:5317189-5317211 CCCCAGGAGGAAGCTGGGGATGG + Intergenic
1169422394 20:5471069-5471091 GCCAAGAGGGAGGCCGGGCCAGG - Intergenic
1170080274 20:12467443-12467465 GGCCAAAGGGAGACTGGTGAAGG - Intergenic
1170219968 20:13931274-13931296 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1170534538 20:17326924-17326946 GCCCAAAGGGAGGCTGCATAGGG - Intronic
1170561642 20:17563585-17563607 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1170827336 20:19808322-19808344 GCCCAGTAGGAGTCAGGGGAAGG + Intergenic
1171145132 20:22774788-22774810 GAGCAGAGGGAGGCCGGTGAGGG + Intergenic
1171211347 20:23319420-23319442 GCCCAGAGGTGGGGTGTGGAGGG + Intergenic
1171446045 20:25205604-25205626 GCCCAGAATAGGGCTGGGGAGGG + Intronic
1171456730 20:25276559-25276581 GCCCAGGAGGAGGCTGGGCCGGG + Intronic
1172205004 20:33157047-33157069 GCCCAGAGAGAGGGTGGGGCTGG - Intergenic
1172442606 20:34976738-34976760 CCCCAGAAAGAGGATGGGGAGGG + Intronic
1172525074 20:35595845-35595867 GCTATGAGGGAGGCTGGGGGTGG - Intergenic
1172556438 20:35846009-35846031 GCACTTTGGGAGGCTGGGGAAGG - Intronic
1172568490 20:35950757-35950779 GCACTTAGGGAGGCTGAGGATGG + Intergenic
1172590048 20:36111493-36111515 ACCCCGAGGGAGGCCGGGCATGG + Intronic
1172619617 20:36310351-36310373 GGCCACAGGGAGGCTGGTGGTGG + Intronic
1172624038 20:36337310-36337332 GCCCAGCGGCAGGCTGTGGAGGG + Intronic
1173261242 20:41438341-41438363 GCCCTTAGGGAGGCTGAGGTGGG + Intronic
1173275773 20:41580413-41580435 GCACTTAGGGAGGCTGAGGATGG + Intronic
1173324956 20:42024799-42024821 GCCTAGAATGAGCCTGGGGAAGG - Intergenic
1173396324 20:42683522-42683544 GCCCTTTGGGAGGCTGAGGAGGG - Intronic
1173529779 20:43760414-43760436 GCACAGTGGGAGGCTGAGGCGGG + Intergenic
1173579599 20:44137617-44137639 GTCCAGAGGAAGGCTGGGTTCGG - Intronic
1173801795 20:45898749-45898771 GCCCACAGGGAGGTGGTGGACGG + Exonic
1173909072 20:46650939-46650961 GCCACTAGGGAGGCTGCGGAAGG + Intronic
1174032563 20:47641902-47641924 GGCCAGGGGGAGGGTAGGGAAGG - Intronic
1174094042 20:48073834-48073856 GGACAGAAGGAGGATGGGGAAGG - Intergenic
1174354622 20:49989678-49989700 CCCCAGAGTCAGGCTGGGGGTGG + Intergenic
1174526138 20:51173019-51173041 GTCCAGAGGGAGGCAGTGTAGGG + Intergenic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175114796 20:56674405-56674427 GCTCTGTGGGAGGCTGAGGAGGG + Intergenic
1175173765 20:57097416-57097438 GACCAGAGGGAGGACGGGCAGGG - Intergenic
1175196627 20:57248324-57248346 GCACAGTGGGAGGCAGGGGAGGG - Intronic
1175239366 20:57535456-57535478 GGTCAGAGGGAGGCTGGAGAAGG + Intergenic
1175279051 20:57790568-57790590 GGCCTGATGGGGGCTGGGGAAGG - Intergenic
1175389875 20:58620295-58620317 GCCCAGGATGAGGCTGGGGTGGG + Intergenic
1175642502 20:60642789-60642811 CCACAGAGGGAGGCTGGCAAGGG - Intergenic
1175786145 20:61712773-61712795 GCCCAGCATGAGGCTGGGCATGG - Intronic
1175831445 20:61967164-61967186 ACCCAGAGGGCTGCTGGTGAGGG + Intronic
1175941398 20:62539059-62539081 GCCCAGAGCGGGGCAGGGGTGGG - Intergenic
1175968234 20:62670627-62670649 GCAAAGAGAGAGTCTGGGGACGG - Intronic
1175977605 20:62719433-62719455 ACCGAGAGGGAGGGTGGAGATGG - Intronic
1175989940 20:62783610-62783632 GCCCAGGGGGAGCCGGGGCATGG - Intergenic
1176048155 20:63103183-63103205 GCCCTGAGCGAGGCTGGGGCTGG - Intergenic
1176167301 20:63680935-63680957 GCCCAGGGTGATGCTGGTGAGGG + Intronic
1176232386 20:64039005-64039027 GCCCACAGAGAGGCAGGCGAAGG - Intronic
1176373964 21:6078125-6078147 GGCCACAGGGAGGGTGGGGAGGG - Intergenic
1176414725 21:6467818-6467840 GCGAAGAGGAAGGCGGGGGAGGG - Intergenic
1176743688 21:10631507-10631529 GGCAACAGCGAGGCTGGGGAAGG + Intergenic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1177732898 21:25051943-25051965 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
1177804189 21:25857668-25857690 GGCCAGTGGGAGGCTGAGGATGG - Intergenic
1178383984 21:32134711-32134733 GCTCAGAGAGGGGATGGGGAGGG - Intergenic
1178459246 21:32787048-32787070 GCACTGCGGGAGGCTGGGGCGGG + Intergenic
1178537658 21:33423744-33423766 GCCCATTGGGAGGCTGAGGTGGG + Intronic
1178796152 21:35746262-35746284 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1178971624 21:37183423-37183445 GAGCAGAGGGAGGTTAGGGATGG - Intronic
1179110347 21:38440528-38440550 GCCCATAGTGAGGCCGGGCATGG + Intronic
1179356493 21:40665187-40665209 ACACAGAGGCAGGCTGGGCATGG + Intronic
1179381976 21:40908300-40908322 CCCCAGTGAGAGGCAGGGGAGGG - Intergenic
1179639567 21:42738438-42738460 GAGCACAGTGAGGCTGGGGAAGG + Intronic
1179641732 21:42752163-42752185 GCCTACATGGAGGCTGTGGAAGG - Intronic
1179690225 21:43076140-43076162 GCGAAGAGGAAGGCGGGGGAGGG - Intronic
1179749513 21:43460118-43460140 GGCCACAGGGAGGGTGGGGAGGG + Intergenic
1179934474 21:44593304-44593326 GCCCAGCAGGAGGCTGGGTGGGG - Intronic
1179934991 21:44597676-44597698 GCACTGTGGGAGGCTGGGGCAGG - Intronic
1179967479 21:44815744-44815766 GCCCCGGGAGAGGCTGGGGCAGG + Intronic
1180082396 21:45492951-45492973 GTCCAGAGTGAGGCTGGGGCCGG + Intronic
1180127572 21:45802696-45802718 GCCCTGAGGGAGGCAGGAGCAGG + Intronic
1180149692 21:45941201-45941223 ACCCAGGGCGAGCCTGGGGATGG + Intronic
1180212239 21:46301942-46301964 GCCCTGAGGAAGCCTGGGGGTGG + Exonic
1180856031 22:19045972-19045994 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1180869616 22:19138804-19138826 CCCCAGGGGGTGGCTGGGGTGGG - Intronic
1181014307 22:20060509-20060531 GCACATCGGGAGGCTGGGGCAGG - Intronic
1181038586 22:20181537-20181559 GCCATGGGGGAGGCTGGGGGAGG + Intergenic
1181043345 22:20203270-20203292 GCCCAGAGGGAGGGAGGGGTCGG + Intergenic
1181112819 22:20611883-20611905 GCACAGAGGAAGGCTGTGAAGGG - Intergenic
1181323314 22:22025445-22025467 GCCCATATGGAGGCTGGGGAGGG + Intergenic
1181349174 22:22243310-22243332 GCCCAGGTGAGGGCTGGGGAGGG - Intergenic
1181386669 22:22550859-22550881 TCCCAGAGGGAGGCAGGTGAAGG + Exonic
1181473479 22:23154688-23154710 GCCCGTAGGGAGGCTGGCAAAGG - Intronic
1181492575 22:23269680-23269702 GTCCAGAGGGAGGCTGGCAGTGG - Intronic
1181534149 22:23533100-23533122 GTCCAGGGGGAGGCTGCCGAGGG + Intergenic
1181761890 22:25064540-25064562 GCCCAGGGGAAGGGTGTGGATGG - Intronic
1181845211 22:25701578-25701600 GACCACAGGGAGGCTTGCGAGGG - Intronic
1182003597 22:26940895-26940917 GCACAGAGGGAGGGAGGAGAGGG + Intergenic
1182004937 22:26952097-26952119 GCCCAGGGGGAGTCTTGGGGAGG - Intergenic
1182118616 22:27772939-27772961 GCCCAGTTTGAGGCTGGGGTGGG + Intronic
1182222900 22:28772869-28772891 GCTCAGAGGGAGGCCGCTGAAGG - Exonic
1182469859 22:30542085-30542107 GCCCAGGTCCAGGCTGGGGACGG - Intronic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1183017126 22:34998004-34998026 GCCCAGAGGGAAGATGGACATGG + Intergenic
1183265763 22:36824173-36824195 GCCCAGAGGAACCCTGGGAAGGG + Intergenic
1183328820 22:37208528-37208550 CCCCAGAGGCCGGCTGGGGTTGG + Intronic
1183350721 22:37333228-37333250 TCCCAGAAAGGGGCTGGGGAGGG + Intergenic
1183395632 22:37569283-37569305 GGTAAGAGGGAGGCTGGGGCGGG - Exonic
1183428877 22:37753919-37753941 GCCCAGAGGTGGGCTGGGCTTGG + Intronic
1183482098 22:38070762-38070784 GCCCAGGGCCATGCTGGGGAGGG - Intronic
1183484738 22:38082817-38082839 CCCCAGACGGCGGCTGGGGCTGG - Exonic
1183490195 22:38111816-38111838 GCCCTCAGGGAGGCTGGGGCTGG + Exonic
1183539838 22:38423570-38423592 GCCCGGATGCAGGGTGGGGAAGG - Intergenic
1183546167 22:38455682-38455704 GGGCAGAGGGAGGCGGGGGGAGG - Intergenic
1183565393 22:38610813-38610835 GCACTTTGGGAGGCTGGGGAGGG + Intronic
1183729227 22:39608001-39608023 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1184001464 22:41677276-41677298 GCCCACTGGGAGGCTGAGGCAGG + Intronic
1184223241 22:43114052-43114074 GCCCCGAGGCAGGCAGGAGAGGG + Intronic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1184437196 22:44486464-44486486 CCACAGAGCGAGGCTGGTGATGG + Intergenic
1184489083 22:44799054-44799076 CCCCAGGTGGGGGCTGGGGATGG - Intronic
1184606659 22:45578365-45578387 GCGCAGGAGGAGGCTGGGGTGGG - Intronic
1184717312 22:46289463-46289485 GCCCTGGTGGAGGCTGAGGACGG + Exonic
1184761894 22:46549617-46549639 GGCCAGAGGTAGGCAGGGGTGGG + Intergenic
1184770557 22:46594481-46594503 GGCCAGAGGAGGGCTGGGGTAGG + Intronic
1184894006 22:47396664-47396686 GGCCAGAGGTGGGCTGGGGCAGG - Intergenic
1185091561 22:48778527-48778549 GCCCTGAGTGCAGCTGGGGAAGG + Intronic
1185161668 22:49233672-49233694 GAGCAGAGGGAGGTGGGGGATGG + Intergenic
1185222426 22:49635851-49635873 TTCCGGAGGGAGCCTGGGGACGG + Intronic
1185276716 22:49953087-49953109 GCCCAGTGGGAGGAGGGGGCTGG + Intergenic
1185375586 22:50481473-50481495 GCCCCGAGGGTGGCTGGGCCCGG + Intergenic
949447673 3:4152537-4152559 GCACTGTGGGAGGCTGAGGAGGG - Intronic
949994074 3:9602541-9602563 GGCAAGAGGGAGGCTGGGGGTGG - Intergenic
950430759 3:12949665-12949687 ACCCAGAGGAAGGAAGGGGATGG + Intronic
950668631 3:14512145-14512167 GCCCAGAGGCAGGAAGGGGCAGG + Intronic
950703005 3:14762944-14762966 GCCCAGGAGGAGCCTGTGGATGG + Intronic
951722081 3:25710651-25710673 GCCCAAAGGGAGACTGGGTGCGG - Intergenic
951870647 3:27357866-27357888 GGCGAGAGTGAGGCTGGGAAAGG + Intronic
951906837 3:27714830-27714852 CCCCAGAGGGACGGAGGGGAAGG + Intergenic
952066906 3:29581519-29581541 GCCCAAATGGAAGGTGGGGAAGG + Intronic
952273252 3:31852823-31852845 GCCCTTAGGGAGGCTGAGGCAGG - Intronic
952951407 3:38528382-38528404 TCCCAGATGGAGGCTAGGCATGG - Intronic
953110911 3:39937170-39937192 GCCTATAGGAAGGCAGGGGATGG - Intronic
953247237 3:41205446-41205468 GCACTTTGGGAGGCTGGGGAGGG + Intronic
953252093 3:41254633-41254655 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
953301661 3:41783288-41783310 GCACTTTGGGAGGCTGGGGAGGG + Intronic
953385804 3:42505059-42505081 GCCCAGTACGAGGCTGGGGGAGG + Intronic
953436649 3:42882500-42882522 GCCCCTTGGGAGGGTGGGGAGGG + Intronic
953755049 3:45639114-45639136 GCCCTGTGGGAGGCTGAGGTGGG - Intronic
953822670 3:46221944-46221966 GGCAAGAGAGGGGCTGGGGAGGG - Intronic
953917221 3:46927747-46927769 TCCAAGAGTGAGTCTGGGGAGGG - Intronic
954018572 3:47718050-47718072 GCCCCCAGGGAGGCTGAGGTTGG + Intronic
954065760 3:48104655-48104677 ACCCCGAGGGAGGCTGGGCACGG - Intergenic
954396872 3:50297700-50297722 GCCAGGAGGGAGGGTGGGGTTGG + Intronic
954479866 3:50788785-50788807 GCAGGGAGGGAGGCAGGGGAGGG + Intronic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
954699931 3:52445796-52445818 GGCCTGAGGGAGGCAGGGCAAGG - Intergenic
954709855 3:52500162-52500184 GCCCGAGGGGAGGCTGGAGAGGG - Intronic
954714106 3:52518623-52518645 CCCCAGAGCGAGGCTGGGCAGGG + Intronic
954849603 3:53589421-53589443 GCCAAGAGGAAGCCTGGGCATGG + Intronic
955736819 3:62047506-62047528 GCACTTTGGGAGGCTGGGGAGGG - Intronic
955924255 3:63990248-63990270 GCTCAGTGGCAGGCAGGGGAGGG - Exonic
956328133 3:68075806-68075828 GCCAGTAGGGAGGCTGAGGAAGG - Intronic
956417733 3:69051361-69051383 GCTACTAGGGAGGCTGGGGAAGG + Intronic
956749538 3:72335200-72335222 GCCCGGAGGCAGGATGAGGATGG + Intergenic
957053673 3:75428668-75428690 GCACATAGGGAGGCTGAGGCAGG - Intergenic
957078986 3:75621515-75621537 GCCCAGAGACTGGCTTGGGAAGG + Intergenic
958531346 3:95335439-95335461 TCCCAGAGGGAGGCTGAAGCGGG - Intergenic
958783076 3:98566224-98566246 GCACAGGGAGAGGGTGGGGAAGG + Intronic
959286965 3:104427136-104427158 GCACTGTGGGAGGCTGAGGAGGG + Intergenic
959540490 3:107531944-107531966 GCCCTTTGGGAGGCTGAGGAAGG + Intronic
959701191 3:109300573-109300595 GCACTGTGGGAGGCTGAGGAGGG + Intronic
959817947 3:110698087-110698109 GCTAAGAGGGAGGCGGGGGGAGG - Intergenic
960033767 3:113082653-113082675 GCACATTGGGAGGCTGAGGAGGG - Intergenic
960155665 3:114295174-114295196 GCCCACAGGGAGGCTTGTCAAGG - Intronic
960662736 3:120078796-120078818 TCCCAGAGGGAGGCTGAGGCTGG - Intronic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960694395 3:120381903-120381925 GCTGAGTGTGAGGCTGGGGATGG + Intergenic
961031933 3:123613702-123613724 GCCCAGAGGGTTCCTGGGGATGG - Exonic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961432164 3:126890997-126891019 GGCCAGAGGGTGGATTGGGATGG + Intronic
961787028 3:129353467-129353489 TATCAGAGGGAAGCTGGGGATGG - Intergenic
961797845 3:129422569-129422591 GCCCAGGGTGTGGATGGGGAGGG - Intronic
962201633 3:133404947-133404969 GCACAGAGCAAGGCTGGAGAGGG - Intronic
962937164 3:140091661-140091683 GCCCAGAGTGGAGCTGTGGATGG - Intronic
963133017 3:141876164-141876186 GCCCAGAGAACGCCTGGGGACGG + Intronic
963402771 3:144822222-144822244 GCTAATAGGGAGGCTGAGGAAGG + Intergenic
964216500 3:154290522-154290544 TCCCAGTGGGAGGCTGAGGCAGG + Intronic
964338240 3:155680136-155680158 GCACATTGGGAGGCTGAGGAGGG + Intronic
964381639 3:156103621-156103643 GCACTGGAGGAGGCTGGGGAAGG - Intronic
964479933 3:157130279-157130301 GCCCCGAGGGAGGCTGGGGTAGG + Intergenic
965248610 3:166310368-166310390 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
965646510 3:170887638-170887660 ACCCAGAGGGAGGCATAGGAGGG - Intergenic
965698621 3:171436883-171436905 GCTCTGTGTGAGGCTGGGGATGG - Intronic
965968409 3:174524654-174524676 GCCCAGTAGGAGGCTGAGGTGGG - Intronic
966155962 3:176916850-176916872 GCCATGAGGAAGGCTGGGGTGGG + Intergenic
966237053 3:177713469-177713491 GCACATAGGGAGGCTGAGGTGGG - Intergenic
966253837 3:177895691-177895713 GCACACAGGGAGGCTGAGGTGGG - Intergenic
966522131 3:180885338-180885360 GCCCTTTGGGAGGCTGGGGTGGG + Intronic
966661235 3:182417351-182417373 GCCCTGAGGTAGGATGGTGAAGG - Intergenic
966861066 3:184230994-184231016 GCCCGGAGGAAGGCGGGGGACGG - Intronic
968153503 3:196358487-196358509 GCACTTTGGGAGGCTGGGGAAGG + Intronic
968200825 3:196753438-196753460 GCACTTAGGGAGGCTGGGGCAGG - Intronic
968392898 4:207356-207378 GGCCAGAGGCAGGGAGGGGAGGG - Intergenic
968460289 4:721417-721439 CCCCAGAGGAAGGCTGGGCTGGG + Intronic
968519281 4:1028422-1028444 CCCCTGAGGAAGGCTAGGGAAGG - Intergenic
968545206 4:1194685-1194707 GCCACCAGCGAGGCTGGGGAGGG - Intronic
968549427 4:1214581-1214603 GCCCAGGGTGGGGCTGGGAAGGG - Intronic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
968705613 4:2076072-2076094 TCCATGAAGGAGGCTGGGGAAGG - Intronic
968813442 4:2810205-2810227 TCCCAGAGGGAAGCTGGAGCTGG - Intronic
968868479 4:3228439-3228461 GCCCACAGAGAGGGTGGGGCAGG - Intronic
969022063 4:4145471-4145493 GCCCAGAGACTGGCTTGGGAAGG + Intergenic
969184444 4:5465026-5465048 GCCCAGTGCCAGGCAGGGGAAGG + Intronic
969225183 4:5791886-5791908 GCCCAGGTGTGGGCTGGGGAGGG - Intronic
969480593 4:7445013-7445035 GAGCAGAGGGAGGGCGGGGAGGG + Intronic
969493953 4:7515330-7515352 GCCCAGTGGGAGACTGGGTCAGG + Intronic
969499615 4:7544783-7544805 GCCATGGGGGAGACTGGGGATGG - Intronic
969643449 4:8412792-8412814 GCAGCGAGGGAGGATGGGGAGGG - Intronic
969658841 4:8514521-8514543 GCACATAGGGAGGCTGAGGCGGG - Intergenic
969731802 4:8961922-8961944 GCCCAGAGACTGGCTTGGGAAGG - Intergenic
969791399 4:9496029-9496051 GCCCAGAGACTGGCTTGGGAAGG - Intergenic
970251626 4:14122370-14122392 ACCCAGAGGGGTGCTGGGGTGGG - Intergenic
971021311 4:22538812-22538834 GCTAATAGGGAGGCTGGGGTGGG + Intergenic
971320705 4:25603651-25603673 GCCATGAGGGAGGCTGAGGTGGG - Intergenic
971364649 4:25968051-25968073 TCCCTGTGGGAGGCTGGGGAGGG + Intergenic
972242422 4:37207648-37207670 TACCAGAGAGAGGCTGGGAAGGG - Intergenic
972562151 4:40238321-40238343 GCACAGAGCGAGCCTGTGGAGGG + Intronic
972563687 4:40250802-40250824 GCCCAGAGGAGGGCAGGGAAAGG - Intergenic
972598683 4:40552674-40552696 TCCTAGAGGGAACCTGGGGAAGG - Intronic
974019242 4:56678259-56678281 GGCCAAAGAGAGGATGGGGATGG - Intronic
974611487 4:64223977-64223999 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
975147528 4:70985764-70985786 GCACTTTGGGAGGCTGGGGAGGG - Intronic
975181740 4:71353827-71353849 TCTCAGAGGCAGGCTGGTGAGGG - Intronic
975529512 4:75386071-75386093 GGCCCCAGGGAGGCTGGAGAGGG - Intergenic
976036129 4:80823270-80823292 GCAAAGAGGGAGGCAGGTGAAGG - Intronic
976413458 4:84744480-84744502 GCCACTAGGGAGGCTGGGGTGGG + Intronic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
977269447 4:94898196-94898218 GCCCCTTGGGAGGCTGAGGAAGG - Intronic
977900075 4:102412298-102412320 GCACATTGGGAGGCTGAGGAGGG + Intronic
978577905 4:110204070-110204092 GCCATTTGGGAGGCTGGGGAAGG + Intergenic
978658968 4:111100348-111100370 GGCCACAGTGAGGCTGGGGGAGG - Intergenic
979531833 4:121776599-121776621 AGCCAGAGGGAGGCTTGGGTAGG - Intergenic
979725685 4:123957778-123957800 GCACTTAGGGAGGCTGGGGCAGG - Intergenic
980387150 4:132101273-132101295 GCCCTGGGGGATGCTGGGGGAGG - Intergenic
980660641 4:135854464-135854486 GACCTGAGAGAGGCTGGGCACGG + Intergenic
981550706 4:145938059-145938081 ACCCAGAGTGAGGAGGGGGAAGG + Intronic
981567223 4:146114075-146114097 GCCCAGAGGGAGAAGGGTGATGG + Intergenic
981582210 4:146261198-146261220 CCCCAGAGGAAGGCTGGAGGAGG + Intronic
981668246 4:147255461-147255483 GGCCACAGCGAGGCTGGGGGAGG + Intergenic
982203178 4:152977552-152977574 GCTCTGAGGGAGGCTGAGGTGGG - Exonic
982205568 4:152995172-152995194 GCCCAGAGGCTGGGTGGTGATGG + Intergenic
983008466 4:162515766-162515788 GCCCAGAGGAGGGCTGGTGGGGG + Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
983601328 4:169532691-169532713 GCACTTAGGGAGGCTGAGGAGGG + Intronic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984719431 4:182956068-182956090 GCACAGATGGAGGCTCTGGATGG + Intergenic
985137486 4:186801787-186801809 GTCCAGAGGGAAGTTGGTGAGGG + Intergenic
985589039 5:755368-755390 GCCCAGAGTGAGGCTGGTGTAGG - Intronic
985603719 5:847884-847906 GCCCAGAGTGAGGCTGGTGTAGG - Intronic
985604125 5:849575-849597 GCCCTGAGGGAGTCTGAGGGGGG - Intronic
985630254 5:1010154-1010176 GCCCTGAGGGTGGGTGAGGAAGG + Intronic
985747386 5:1654969-1654991 GCCCAGGGGGCGGGTGGGGGTGG - Intergenic
985896372 5:2751826-2751848 GACGGGAGGGAGGCGGGGGAGGG + Intergenic
986158994 5:5206726-5206748 GCACTTAGGGAGGCTGAGGAAGG - Intronic
986297366 5:6449969-6449991 GCCCAGAAGAAGGCAGGGGGCGG - Intronic
986402741 5:7395933-7395955 GCCCGGCTGCAGGCTGGGGACGG - Intergenic
986988198 5:13522624-13522646 GCCCAGAGGGAGCCAGGGGGTGG - Intergenic
987099778 5:14581779-14581801 TCCCTGAGGCGGGCTGGGGAGGG - Exonic
987299629 5:16585819-16585841 GGCAAGAGGGAGTGTGGGGAGGG + Intronic
988456763 5:31393834-31393856 GCACCGTGGGAGGCTGAGGAGGG + Intergenic
988792036 5:34617724-34617746 GCACTTAGGGAGGCTGAGGAAGG + Intergenic
988866483 5:35340538-35340560 TCTCAAAGGGAGGCTGGGGTGGG + Intergenic
989359038 5:40578511-40578533 GCTAAGAGGGAGCGTGGGGATGG + Intergenic
989375849 5:40759233-40759255 GCCCTGTGGGAGGCTGAGGTGGG - Intergenic
989704635 5:44314110-44314132 GTCCAGGGGAAGGCTGGGAAGGG + Intronic
990245336 5:53858593-53858615 GCACACAGGGAGGCAAGGGATGG - Intergenic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
991383939 5:66063248-66063270 GGCCACAGCGAGGCTGGGGGAGG - Intronic
991688813 5:69206740-69206762 GCACTGTGGGAGGCTGAGGAGGG - Intronic
992399941 5:76403126-76403148 GCCGAGAGGGACGCTGGGCCGGG - Intergenic
997098373 5:130939753-130939775 GGGTAGAGGGAGGCTGGGGGAGG - Intergenic
997197073 5:131987454-131987476 GCACATAGGGAGGCAGGAGAAGG + Intronic
997525646 5:134551473-134551495 GCACTGTGGGAGGCTGAGGAGGG - Intronic
997622143 5:135305804-135305826 GCACAGTGAGAGGGTGGGGAGGG + Intronic
997811307 5:136973217-136973239 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
997978529 5:138454432-138454454 GCCCAGAGCCAGTGTGGGGAGGG + Intergenic
998394336 5:141808756-141808778 GCCTGGAGGAAGGATGGGGAAGG + Intergenic
998416044 5:141946638-141946660 GCCTAGAGTCAGGCTGGGGAGGG + Intronic
998443001 5:142177686-142177708 GCCCTGGGTGAGGTTGGGGAGGG + Intergenic
998567134 5:143225781-143225803 AGCCACAGGGAAGCTGGGGAGGG - Exonic
999412758 5:151366627-151366649 GCCCAGATGGGGGATGAGGATGG + Intergenic
1000369502 5:160521036-160521058 GCCAACAGAGAGGCTGTGGAGGG + Intergenic
1000397349 5:160789818-160789840 GCCCAGCAGGGGGTTGGGGATGG + Intronic
1000916498 5:167088378-167088400 GCACTGTGGGAGGCTGAGGATGG + Intergenic
1001128854 5:169046834-169046856 GAGCAGAGGGGTGCTGGGGAAGG - Intronic
1001266502 5:170278308-170278330 GCAGAGTGGGGGGCTGGGGAGGG + Intronic
1001761497 5:174211718-174211740 GCCCAGAGGGATGTGGGGGCTGG - Intronic
1001765443 5:174242285-174242307 GCCATGAGGGAGGCTGAGGCAGG + Intronic
1001936592 5:175709887-175709909 GCGCAGGGGGAGGCTGGAGAGGG - Intergenic
1002001282 5:176197581-176197603 GCACAGAGGGAGGTGGGGGGAGG - Intergenic
1002209509 5:177588778-177588800 GCTCTGGGGGAGGCAGGGGAAGG - Intergenic
1002253057 5:177941388-177941410 GCACAGAGGGAGGTGGGGGGAGG + Intergenic
1002277944 5:178115304-178115326 GCCCAGAGAGGGGCTGGGAGAGG - Intronic
1002374020 5:178775435-178775457 GCCCAGAGGCAGGCCTGGCATGG + Intergenic
1002415119 5:179116308-179116330 GGCCAGAGGGAGGTTGGAAAGGG - Intronic
1002567424 5:180119725-180119747 GCCCAGAGGGAGGAGGGCGCTGG - Intronic
1002707193 5:181169970-181169992 GCCGAGCAGGAGGCTGGGGGAGG - Intergenic
1002813494 6:657031-657053 GGCCGGAGGGAGGGCGGGGAGGG - Intronic
1002879548 6:1238747-1238769 GCCCAGGGGGACTGTGGGGATGG - Intergenic
1002897448 6:1388037-1388059 GCAGAGAGGGCGGGTGGGGAGGG - Intergenic
1002912318 6:1499538-1499560 TCCCAGTGGGAGGCTGAGGCAGG - Intergenic
1002917422 6:1540581-1540603 ACCCAGGGGCAGGGTGGGGAGGG - Intergenic
1003238832 6:4323587-4323609 GCCCAGAGACTGGCTGGGTAAGG + Intergenic
1003515562 6:6815605-6815627 GCACTTTGGGAGGCTGGGGAAGG - Intergenic
1003549188 6:7086623-7086645 GCACAGATGGAAGCTGAGGAAGG - Intergenic
1003738452 6:8905737-8905759 TCTCTGCGGGAGGCTGGGGAGGG + Intergenic
1004000686 6:11594353-11594375 GTCCAGAGAGAGGCTGGGATGGG - Intergenic
1004915981 6:20332477-20332499 CCCTAGAGAGAGACTGGGGAAGG + Intergenic
1005040417 6:21595481-21595503 GCCCAGGGGGTCGCTGGGGTCGG - Exonic
1005057562 6:21744229-21744251 GCCAGGAGGGAGGCCGGGGCGGG - Intergenic
1005325111 6:24692527-24692549 GCTCCGAGGGAAGCTGGGGTGGG - Intronic
1005431525 6:25763078-25763100 GCCCAAAGGTGGGCTGAGGAAGG - Intronic
1005522007 6:26609973-26609995 GGGCAGAGAGAGGATGGGGATGG + Intergenic
1005574599 6:27179692-27179714 GCGGAGAGGTAGGCAGGGGAAGG - Intergenic
1006010621 6:31040055-31040077 GCACTTAGGGAGGCTGAGGAGGG + Intergenic
1006054067 6:31367530-31367552 GCTCAGAGGGAAGATGGGGAGGG + Intergenic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1006457949 6:34142794-34142816 GCCCAGACGCAGGTTGGGGGAGG + Intronic
1006758367 6:36437760-36437782 GCACATTGGGAGGCTGAGGAGGG - Intronic
1006794286 6:36722015-36722037 GCCCACAGAGAGGCTGGAGCAGG + Exonic
1007069465 6:39025331-39025353 GTCCAGAGGGAGTGTGGGGGAGG - Intronic
1007253302 6:40511058-40511080 GGCCAAAGGGAGCCTGGGGCAGG + Intronic
1007366309 6:41396548-41396570 GCGCACAGGGAGCCTGGGGCAGG - Intergenic
1007377122 6:41464519-41464541 GCCCAGAGAGAGACTTGGGAAGG - Intergenic
1007547920 6:42708388-42708410 GCCCAGAGAGGGGCTGCAGAAGG - Intronic
1007661624 6:43490235-43490257 GCCCAGCAGCAGGCTGGTGATGG - Intronic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1007746344 6:44045827-44045849 GGCCAGAGGCAGGCCTGGGAGGG - Intergenic
1007824752 6:44592117-44592139 GCCCAAAGAGAGGCAGGAGAAGG + Intergenic
1008303004 6:49865712-49865734 GCCCAAAGGGAAGTTGAGGAGGG + Intronic
1008961835 6:57274336-57274358 GGCCGCAGGGAGGCTGGGGGAGG - Intergenic
1009045995 6:58237915-58237937 ACCCAGATGGTGCCTGGGGAAGG - Intergenic
1009444647 6:63727578-63727600 GCCAGGATGGAGGCTGGGCACGG + Intronic
1009642005 6:66350060-66350082 GCTCAGAGGAAGGCTAGGCAGGG + Intergenic
1010154128 6:72772563-72772585 CCCCAGATGGAGGCTGGTAAAGG - Intronic
1010378104 6:75197556-75197578 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1010530225 6:76959390-76959412 GGCCACAGCGAGGCTGGGGGAGG + Intergenic
1010732362 6:79404587-79404609 GCAGAGAGGGAAGCTGGGAAGGG - Intergenic
1011383804 6:86771919-86771941 GCACAGATGCAGGCTGGGCACGG + Intergenic
1011406699 6:87022860-87022882 GCAGAGAGGGAGGGAGGGGAGGG + Intergenic
1011626371 6:89286837-89286859 TTCCAGAGGGAAGCTGGGGAAGG + Intronic
1011765059 6:90611215-90611237 GCCCAAACTGCGGCTGGGGAAGG - Intergenic
1012390287 6:98730266-98730288 ACCCAGAGGGAGACAGGGAAAGG - Intergenic
1013216547 6:108032631-108032653 GCCTAGAGGGGAGCTGGAGAGGG + Intergenic
1013538878 6:111087943-111087965 CCCCCGAGGGCGGCTGGGGCTGG + Exonic
1014345859 6:120268450-120268472 GGCCACAGCGAGGCTGGGGGAGG - Intergenic
1014376657 6:120683829-120683851 ACTCAGGGGAAGGCTGGGGAGGG + Intergenic
1014648364 6:124004425-124004447 GAAAAGAGGGAGGGTGGGGAAGG + Intronic
1014699321 6:124664026-124664048 GCACATTGGGAGGCTGAGGAGGG + Intronic
1014838979 6:126194866-126194888 GCCCTTTGGGAGGCTGAGGAGGG + Intergenic
1016834298 6:148461976-148461998 GTACAGGGGGAGGCAGGGGAAGG - Intronic
1016933096 6:149428395-149428417 GCACTTAGGGAGGCTGAGGAGGG - Intergenic
1017246563 6:152233569-152233591 GCACTTAGGGAGGCTGAGGAGGG - Intronic
1017284477 6:152658451-152658473 GCCCTCAGGGAGGCTGAGGCAGG + Intergenic
1017590589 6:155974585-155974607 ACCCAGGGGCAGGCTGGGGCAGG + Intergenic
1017608074 6:156154303-156154325 TCCCAGTGGGAGGCTGAGGCAGG + Intergenic
1017774858 6:157672854-157672876 GCCCAGTGTGAGGCTGGCGCAGG - Exonic
1018240559 6:161770181-161770203 GCCCACATGGAGCATGGGGAAGG + Intronic
1018429822 6:163713817-163713839 GCCTGCAGGGAGGCTGGGGCAGG + Intergenic
1018705344 6:166460188-166460210 GCCCAGAGGGGGCATGGGAAGGG - Intronic
1018851727 6:167645212-167645234 GGCCAGCTGGAGGGTGGGGAGGG - Intergenic
1019057717 6:169235266-169235288 GCACTGTGGGAGGCTGGGGCAGG - Intronic
1019315066 7:380524-380546 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019315095 7:380584-380606 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315110 7:380614-380636 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315125 7:380644-380666 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019315138 7:380674-380696 GGACAGAGGGAGGGAGGGGAGGG + Intergenic
1019406557 7:887127-887149 GCCGAGGCGGGGGCTGGGGAAGG - Intronic
1019421412 7:952967-952989 GCCCAGAGGGTGGCTGGAGAGGG + Intronic
1019476791 7:1248263-1248285 GCCCAGGGGCAGGCGGAGGAAGG - Intergenic
1019490298 7:1310065-1310087 GGCTTGAGGGAGGCTGGGGGAGG + Intergenic
1019512020 7:1422364-1422386 GGGCAGAGTGAGGCTGGGGTGGG - Intergenic
1019582664 7:1774041-1774063 TCCCAAAGGGAGGCTGAGGTGGG - Intergenic
1019618007 7:1975252-1975274 GCCCCGAGGGGGCCTGGTGATGG - Intronic
1019620329 7:1988654-1988676 GCGCACAGCGTGGCTGGGGAGGG + Intronic
1020018123 7:4843560-4843582 GCCCAGAGTCAGGCTGGCCATGG - Intronic
1020036695 7:4967986-4968008 TCCCAGTGGGAGGCTGAGGTGGG - Intergenic
1020111700 7:5451410-5451432 GGCCACAGAGAAGCTGGGGATGG - Intronic
1020240626 7:6391825-6391847 GCCAAGAAAAAGGCTGGGGACGG - Intronic
1020309487 7:6857512-6857534 GCCCAGAGACTGGCTAGGGAAGG + Intergenic
1020312843 7:6882387-6882409 GCCCATTGGGAGGCTGAGGCAGG - Intergenic
1020904555 7:14048954-14048976 GCTGAGAGTGAGGATGGGGAAGG - Intergenic
1021451774 7:20788924-20788946 GCCCAGAAGGAGGAAGGGGTGGG + Intergenic
1021866948 7:24967671-24967693 GCCAAGAGGTAGGTAGGGGAAGG - Intronic
1021905203 7:25326549-25326571 CCCCAGTGGAGGGCTGGGGACGG + Intergenic
1022384326 7:29887619-29887641 GCCCAGAGGGAGGCTTGAAGAGG - Intronic
1022508732 7:30922246-30922268 TCCCAGATGGAGGTGGGGGAAGG + Intronic
1022567570 7:31418431-31418453 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1022715959 7:32898785-32898807 GCACATAGGGAGGCTGAGGCAGG - Intergenic
1022734520 7:33063215-33063237 GCTCAGAGTTAGGCTGGAGAGGG + Intergenic
1022741868 7:33129582-33129604 GCTCAGAGTTAGGCTGGAGAGGG + Exonic
1022785554 7:33634025-33634047 GACCAGCGGGAGGCTGTGCAGGG - Intergenic
1022896374 7:34753753-34753775 GCACTTTGGGAGGCTGGGGAAGG + Intronic
1023041405 7:36176071-36176093 TCCCAGCGAGAGGCAGGGGAGGG - Intronic
1023136598 7:37058936-37058958 ACCAAGGGGGATGCTGGGGAAGG + Intronic
1023817481 7:43961822-43961844 TCCCAAGGGGTGGCTGGGGATGG + Intergenic
1023986297 7:45099122-45099144 GCACTTAGGGAGGCTGGGGCGGG - Intergenic
1024476819 7:49820838-49820860 GCCCAGGTGCAGGCTGAGGAAGG + Intronic
1025222865 7:57131314-57131336 GCCCATTGGGAGGCTGAGGCAGG + Intronic
1025633659 7:63302987-63303009 GCCCATTGGGAGGCTGAGGCAGG + Intergenic
1025649037 7:63445173-63445195 GCCCATTGGGAGGCTGAGGCAGG - Intergenic
1025844325 7:65182651-65182673 GCTAAGAGAGAGGCTGGGAATGG - Intergenic
1025894653 7:65688985-65689007 GCTAAGAGAGAGGCTGGGAATGG - Intergenic
1026028851 7:66771383-66771405 GCCCTTTGGGAGGCTGAGGAGGG - Intronic
1026108532 7:67439915-67439937 GCCCACAGTAGGGCTGGGGAGGG - Intergenic
1026151096 7:67788659-67788681 GCCCAGGGGGAGAGAGGGGAAGG + Intergenic
1026441005 7:70444086-70444108 GCCAAGGAGGAGGCTGGGGGAGG + Intronic
1026444726 7:70474298-70474320 GCCTAGAGGGCAGGTGGGGAAGG - Intronic
1026882845 7:73918523-73918545 GCAAAGAGAAAGGCTGGGGAAGG - Intergenic
1026911823 7:74095516-74095538 GCTACTAGGGAGGCTGGGGAGGG - Intronic
1026931172 7:74223796-74223818 AGCCAGAGGCAGGCTGGGGCTGG + Intronic
1026954990 7:74371503-74371525 GCCAGGAGGGAGGCGGGGGAGGG + Intronic
1027244561 7:76358581-76358603 TCACTGAGGGGGGCTGGGGAGGG - Intronic
1027459055 7:78429370-78429392 GGTCAGAGGTAGGCTGAGGAGGG + Intronic
1029144386 7:98435443-98435465 GCTCACAGGGAGGCTGAGGTGGG - Intergenic
1029341130 7:99945676-99945698 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1029442608 7:100595371-100595393 GTGCGGAGGGAGGCTGAGGAGGG + Intronic
1029575380 7:101400144-101400166 GCCCTCAGGGAGGCAGGGGTGGG + Intronic
1029605770 7:101598687-101598709 TCCCAGATGGAGCCTGGGTAGGG + Intergenic
1029667546 7:102005580-102005602 GCCCTGTGGGAGGCTGAGGCAGG - Intronic
1029742106 7:102496696-102496718 TCCCAAGGGGTGGCTGGGGACGG + Intronic
1029760095 7:102595861-102595883 TCCCAAGGGGTGGCTGGGGACGG + Intronic
1030008336 7:105140352-105140374 GCACTTTGGGAGGCTGGGGAGGG + Intronic
1030099117 7:105929510-105929532 GCTACGAGGGAGGCTGAGGAGGG + Intronic
1030208101 7:106970124-106970146 GCCCTTTGGGAGGCTGAGGAGGG + Intergenic
1030849467 7:114465209-114465231 GCACTTAGGGAGGCTGAGGAGGG - Intronic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032215356 7:129952942-129952964 GCCCAGAGCGAGGCTGGGGTAGG - Exonic
1032267663 7:130380377-130380399 TCCCACGGGGAGGCTGGGGTGGG - Exonic
1032440964 7:131942892-131942914 GATAAGAGGGAGGGTGGGGAGGG + Intergenic
1032475839 7:132211041-132211063 GCCCAGACTGGGGCTGGGGGAGG + Exonic
1032768574 7:135024215-135024237 GCCCAGAGCGGGCCTGGTGATGG + Intronic
1033210571 7:139457215-139457237 GCCCAGGGTGGGGCTGGGCAGGG + Intronic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033463076 7:141564971-141564993 GCCCTTTGGGAGGCTGAGGAGGG - Intronic
1033478639 7:141716233-141716255 GTCCAGAGGAAGGCAAGGGAGGG + Exonic
1033786430 7:144737002-144737024 GACCAGAGGGAGGCAAAGGAGGG + Intronic
1034211239 7:149365073-149365095 TGCAAGAGGGATGCTGGGGAAGG - Intergenic
1034331954 7:150290352-150290374 GCCCACAGGAAGGCTGATGAGGG - Intronic
1034418346 7:150976766-150976788 GCCCAGGGGGAGGCTGTGGGCGG - Intronic
1034580324 7:152035838-152035860 GCCCCAAGTGAGGATGGGGAAGG + Intronic
1034666083 7:152819518-152819540 GCCCACAGGAAGGCTGATGAGGG + Intronic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035023383 7:155811523-155811545 GGGCAGAGGTAGGATGGGGAAGG + Intronic
1035031753 7:155865483-155865505 TCCCAGAGGGAGAATAGGGAAGG - Intergenic
1035062355 7:156079101-156079123 GCCCGAAGGGAGACTGGGGAGGG - Intergenic
1035188030 7:157140952-157140974 GGCGAGAGGGAAGCTGGGTAGGG + Intronic
1035470560 7:159106477-159106499 GGGCAGAGAGAGGCCGGGGAGGG + Intronic
1035470645 7:159106742-159106764 GGGCAGAGAGAGGCTGGGTAGGG + Intronic
1035676465 8:1459930-1459952 GCCCTGTGGGAGGCTGAGGTGGG - Intergenic
1035678641 8:1471569-1471591 GTTAGGAGGGAGGCTGGGGAGGG - Intergenic
1035828293 8:2668196-2668218 TCCCAGAGGGTGGCAGGGGCGGG + Intergenic
1036650608 8:10640411-10640433 GCCCTCTGGGAGGCTGAGGAAGG + Intronic
1036747655 8:11421303-11421325 AACCAGATGGAGGCAGGGGAGGG - Intronic
1036762454 8:11518746-11518768 GCCCAGAGACCAGCTGGGGAAGG - Intronic
1036777833 8:11625677-11625699 ACGGTGAGGGAGGCTGGGGAAGG + Intergenic
1037683732 8:21119876-21119898 TCCCAGCTGGAGGCTGAGGAGGG + Intergenic
1037765518 8:21770091-21770113 GCTCAGAGGGAGTCTTGGGTGGG - Intronic
1037819789 8:22130090-22130112 CCCCAGAGAGAGGCAAGGGAGGG + Intronic
1037820914 8:22134134-22134156 GCGCACATGGAGGCTGGAGACGG + Intergenic
1037865873 8:22441525-22441547 GGGCGGAGGGAGGCTGGGGCCGG + Intronic
1037896279 8:22658578-22658600 GCCCAGATGGCAGTTGGGGAGGG + Intronic
1037906485 8:22718686-22718708 GCCCTGGGGGATGCTGGGGCTGG + Intronic
1039742937 8:40398559-40398581 TCCCTGAGGCAGGCTGGAGAGGG + Intergenic
1039814818 8:41084066-41084088 GCCCTGTGGGAGGCTGAGGTGGG + Intergenic
1040044741 8:42951306-42951328 GCACTTTGGGAGGCTGGGGAGGG - Intronic
1040285654 8:46099203-46099225 GGCCACAGGCAGGCTGGTGAGGG + Intergenic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1040583022 8:48712752-48712774 GCACATTGGGAGGCTGAGGAGGG + Intronic
1041681303 8:60595337-60595359 GCCCACAGGAAGGCAGGAGAAGG + Intronic
1042229259 8:66540436-66540458 GCCCAGAATGAGGCTGGAAATGG - Intergenic
1042287677 8:67132144-67132166 GCTCAGAGTGTGGCCGGGGAGGG + Intronic
1042708503 8:71688266-71688288 GTCAAGAGGGAGGCTGGGGAAGG - Intergenic
1043423687 8:80126727-80126749 GCACATAGGGAGGCTGAGGCGGG - Intronic
1043687554 8:83106874-83106896 GCAGAGAGGGGAGCTGGGGAGGG - Intergenic
1043783468 8:84366528-84366550 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1044205373 8:89487119-89487141 GCACAGAGGGAGCCTAGGAAGGG + Intergenic
1046803543 8:118455093-118455115 GTCCAGTGGGAGGATGAGGAAGG - Intronic
1046973512 8:120248608-120248630 GCCCTTTGGGAGGCTGAGGAGGG + Intronic
1047306957 8:123660191-123660213 GCAAGGAGGGAGGTTGGGGAAGG - Intergenic
1047498806 8:125427259-125427281 GCCCAGTGGGAGGCCCGGGAGGG - Intergenic
1047523937 8:125616423-125616445 GACCAGAGGGAGGATGAGGAGGG + Intergenic
1047772378 8:128039626-128039648 GCTCAGAGGGAGTCTTGGTAAGG + Intergenic
1048020570 8:130535269-130535291 GCCCAAAGGGAAGCTGGGTGGGG - Intergenic
1048419932 8:134268060-134268082 GGCAAGAGGGAGGATAGGGAAGG - Intergenic
1048923832 8:139253249-139253271 GCCGAGATGGAAGCTGGGGGAGG + Intergenic
1049252449 8:141596574-141596596 ACTCAGGAGGAGGCTGGGGAGGG + Intergenic
1049270875 8:141695581-141695603 ACCCCTAGGGAGGCTGGGAAAGG + Intergenic
1049271722 8:141699648-141699670 ACCCTAAGGGAGGCTGGGAAAGG + Intergenic
1049303412 8:141883813-141883835 GCCCAGTGGGAGGCTTGGGAGGG - Intergenic
1049542189 8:143213692-143213714 GGCCCCAGGGTGGCTGGGGAGGG - Intergenic
1049542203 8:143213711-143213733 GGCCCGAGGATGGCTGGGGAGGG + Intergenic
1049611650 8:143558703-143558725 GCCCAGAAGGCAGCTGGGGGCGG - Intronic
1049710860 8:144062753-144062775 GGCGAGGGGGTGGCTGGGGATGG - Intronic
1049725022 8:144141872-144141894 GCCCACGGGAGGGCTGGGGAGGG - Intergenic
1049787049 8:144456012-144456034 GCCCAGAGAGAGCCAGAGGAGGG - Intronic
1050093097 9:2035287-2035309 GCACTGTGGGAGGCTGAGGAGGG - Intronic
1050426396 9:5516652-5516674 GCACAGAGGGAGGCTGAGCAGGG - Intronic
1050458000 9:5852372-5852394 GCTATGAGGGAGGCTGAGGAGGG - Intergenic
1050524542 9:6534093-6534115 TCCCAGCGGGAGGCTGAGGTAGG + Intronic
1050538907 9:6653228-6653250 GCACTTTGGGAGGCTGGGGAGGG + Intergenic
1050590352 9:7154066-7154088 GCTGTGAGGGAAGCTGGGGAAGG + Intergenic
1052312121 9:27078827-27078849 GCCCAGAGTGTAGCTGGGAAGGG - Intergenic
1053232829 9:36425580-36425602 GCTAATAGGGAGGCTGAGGAAGG + Intronic
1053372373 9:37573629-37573651 GCCCCCAGAGAGGCTGGAGAAGG + Intronic
1053476328 9:38384542-38384564 GCCCAGAGGGAAGCAGGTGAGGG - Intergenic
1053476612 9:38386456-38386478 GCCCAGAGGGAGGTAGGTGGTGG + Intergenic
1053512535 9:38700873-38700895 TCAGAGAAGGAGGCTGGGGATGG - Intergenic
1053886840 9:42650038-42650060 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1054225859 9:62457488-62457510 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1054743821 9:68834386-68834408 GTGCTGAGGGAGGCTGGGGAGGG - Intronic
1055124153 9:72699708-72699730 GCACATTGGGAGGCCGGGGAGGG + Intronic
1056233523 9:84570059-84570081 ACCCACAGAGAGGCTGGGCACGG + Intergenic
1057142255 9:92734735-92734757 GCCCACAGTGAGGCAGGGGAAGG - Intronic
1057669845 9:97077602-97077624 GCCCACAGGGTGGCTGGCGCTGG - Intergenic
1057695008 9:97316968-97316990 GAGCAGTGGGAGGCTGGAGAGGG - Intronic
1057885457 9:98826547-98826569 GGCCAGGAGGAGGCTGGGGGAGG - Intronic
1057930024 9:99185147-99185169 GGCGAGAGGGAGGCAGGGCAGGG + Intergenic
1058869296 9:109188714-109188736 GGCCAGAGGAAGGCTGTGTAGGG - Intronic
1058873687 9:109223726-109223748 GCCTAGGGGGAGGCCGGGCACGG + Intronic
1059119746 9:111631389-111631411 GCCGCCAGCGAGGCTGGGGATGG + Exonic
1059191797 9:112333720-112333742 GCCCCGAGGGAGGGCGGGGACGG - Intergenic
1059328664 9:113520606-113520628 ACCCAGAGGGAGGCTGGCAGGGG - Intronic
1059426378 9:114223340-114223362 GCTCAGAGGGAGGCTGGAGGAGG + Intronic
1059443659 9:114324986-114325008 GCCCGGCGGGAGGCCAGGGAGGG - Intronic
1059444859 9:114331763-114331785 GCCCGGCGGGAGGCCAGGGAGGG - Intronic
1059855968 9:118397489-118397511 GCACAGAGCGGGGCTGAGGAGGG + Intergenic
1060072152 9:120559373-120559395 GCCAAGCGGGAGGCTGAGGCAGG + Intronic
1060103933 9:120862063-120862085 GCCCAGAGGGAGGCGCCGCAGGG + Intronic
1060282018 9:122221296-122221318 GCCGAGAGGGGAGCTGGGGGAGG - Intronic
1060297870 9:122355413-122355435 GCTCAGAGAAAGGTTGGGGAGGG + Intergenic
1060550634 9:124483352-124483374 TCCCCGAGGGAGGCTGGTGATGG - Intronic
1061002475 9:127910179-127910201 GCTCTGGGGGAGGCTGGGGAGGG + Intronic
1061022629 9:128026185-128026207 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1061059926 9:128245182-128245204 CCCCAGAGGGCGGCTGGGGGAGG - Intronic
1061220312 9:129246709-129246731 GGACAGAGGGAGGCGCGGGAGGG + Intergenic
1061246337 9:129402862-129402884 GTCCAGGGGGAGGCTGCTGAGGG - Intergenic
1061277393 9:129577221-129577243 GTCTAGGGGGAGGCTGGGGAAGG + Intergenic
1061377798 9:130236381-130236403 GTCCGGAGGGAGGCTGGAGCGGG + Exonic
1061719781 9:132544440-132544462 GCCAGGATGGAGGCTGTGGACGG - Intronic
1061780039 9:132989981-132990003 CCCCAGCGTGAGGCTGGGGGCGG + Intronic
1061801378 9:133115081-133115103 ACCCAGAGGGAGTCTGGGTTTGG - Intronic
1061886733 9:133594864-133594886 GCCCAGAGGCAGGCAGGGCAAGG + Intergenic
1062050526 9:134444455-134444477 GGAAAGAGGGAGGCAGGGGAAGG - Intergenic
1062084461 9:134641653-134641675 GCCCAGTGGGAGGCGGGGGCTGG + Intergenic
1062123645 9:134847948-134847970 ACCCAGACGCAGGCTGGGGGCGG + Intergenic
1062125908 9:134862573-134862595 ATCCATAGGGAGGCTGGGGGTGG + Intergenic
1062277771 9:135738837-135738859 CCCCTGTGTGAGGCTGGGGAGGG + Intronic
1062391536 9:136335890-136335912 GCCCGGGGGGAGGCTGAGCATGG - Intronic
1062391693 9:136336399-136336421 GCCCAGCGGGAGGCAGGGGGTGG + Intronic
1062479367 9:136744308-136744330 GCCCAGGGTGAGGCTCAGGATGG + Intronic
1062523621 9:136969681-136969703 GGGCAGAGGGAGGCTGGGCTGGG - Intronic
1062536715 9:137024288-137024310 GCCCTATGGGAGGCTGGGGAGGG - Intronic
1062612274 9:137380501-137380523 GCCCAGAGGGGGGTTGGGGTGGG - Intronic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1185709993 X:2296333-2296355 CCCCAGAGGGAGGGGAGGGAAGG + Intronic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1186496275 X:10015003-10015025 ACCCCGAGGGAGACTGGGGGCGG + Intergenic
1186806240 X:13143047-13143069 GCCCAGAGGGAGGCTGAGAAGGG + Intergenic
1187073981 X:15915838-15915860 GCCTACAGGGAGGCAGGGTAGGG - Intergenic
1187499009 X:19823132-19823154 GCTGAGTGGGAGGATGGGGATGG + Intronic
1187706860 X:22017845-22017867 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1188297128 X:28463251-28463273 GGGCAGAGAGAGGTTGGGGAGGG - Intergenic
1188442523 X:30227242-30227264 TACCAGAGGCAGGGTGGGGAGGG - Intergenic
1188634880 X:32417313-32417335 GCCCAGAGGGAGAGTAGGGATGG + Intronic
1189245198 X:39557954-39557976 GCCCAGGGCTGGGCTGGGGATGG + Intergenic
1189257949 X:39654742-39654764 GCCCTGGGTGAGGCTGGGAAGGG + Intergenic
1189304836 X:39979211-39979233 AGCCAGGGAGAGGCTGGGGATGG - Intergenic
1189392388 X:40587021-40587043 GCACATAGGGAGGCTGAGGCGGG + Intronic
1190074184 X:47303608-47303630 GCACTGTGGGAGGCTGAGGAGGG - Intergenic
1190101086 X:47523682-47523704 GGCCAGGGGGAGGCAGGGGAAGG - Intergenic
1190491883 X:50990618-50990640 GCAGAGAGGGAGGCAGGGGCTGG - Intergenic
1190501279 X:51081062-51081084 GCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1190668702 X:52719247-52719269 GCCCTGTGGGAGGCTGAGGCCGG + Intergenic
1190670715 X:52739157-52739179 GCCCTGTGGGAGGCTGAGGCCGG - Intergenic
1190743509 X:53306341-53306363 GTCCAGAGGGAGGCAGGGGCAGG + Intronic
1191006629 X:55717149-55717171 GCACTTTGGGAGGCTGGGGAGGG - Intergenic
1192234089 X:69285266-69285288 GCCCAGGGAGAGGATGGGAAAGG + Intergenic
1192449115 X:71232225-71232247 GCCCTTTGGGAGGCTGAGGAGGG - Intergenic
1192609907 X:72557089-72557111 GCCTGTAGGGAGGCTGAGGAAGG + Intronic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1194451288 X:94047464-94047486 GCACATAGGGAGGCTGAGGCGGG + Intergenic
1194749791 X:97671391-97671413 AGCCAGAGGGAGGCTTGTGAAGG - Intergenic
1195223650 X:102770099-102770121 TACCAGACAGAGGCTGGGGAGGG - Intergenic
1195302619 X:103545704-103545726 GCACATAGGGAGGCTGAGGCGGG + Intergenic
1195728012 X:107937028-107937050 GCCCAGAGTAAGACTGAGGAAGG + Intergenic
1195937472 X:110139427-110139449 GCTGAGAGCGAGGATGGGGAAGG + Intronic
1196798881 X:119524332-119524354 GCACTGTGGGAGGCTGAGGAGGG + Intergenic
1198137960 X:133773166-133773188 TCCCAGTGGGAGGCTGAGGCAGG - Intronic
1198277885 X:135113237-135113259 CCCCAGACGGTGCCTGGGGAAGG - Intergenic
1198310748 X:135424575-135424597 GCCCAGAGGGGAGCCGGGAAGGG + Intergenic
1198719982 X:139606467-139606489 GCCACTAGGGAGGCTGAGGAAGG - Intronic
1199342590 X:146698807-146698829 GCACTTAGGGAGGCTGGGGCGGG - Intergenic
1199955733 X:152740806-152740828 GCCCAAAGAGAGACTGGAGAAGG - Intergenic
1200009902 X:153113052-153113074 GCACTGTGGGAGGCTGGGGTGGG + Intergenic
1200029698 X:153286870-153286892 GCACTGTGGGAGGCTGGGGTGGG - Intergenic
1200061183 X:153484522-153484544 GCCAGGCGGGAGGCTGAGGAGGG + Intronic
1200073180 X:153538884-153538906 GCCAAGGGAGAGGCTGGCGAGGG + Intronic
1200207648 X:154328900-154328922 GGCCAAGGGGAGGCTGGGGCAGG - Intronic
1200215279 X:154365534-154365556 GCCCTGTGGGAGGCAAGGGAGGG - Intronic
1200793389 Y:7318890-7318912 GGCCAAAGGAAGACTGGGGAGGG - Intergenic
1201142606 Y:11041179-11041201 GCCCTTTGGGAGGCTGAGGAAGG - Intergenic