ID: 961382587

View in Genome Browser
Species Human (GRCh38)
Location 3:126505535-126505557
Sequence CCACCCAGTGAGGTCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961382579_961382587 -9 Left 961382579 3:126505521-126505543 CCGCCCATGGGAACCCACCCAGT 0: 1
1: 1
2: 2
3: 13
4: 152
Right 961382587 3:126505535-126505557 CCACCCAGTGAGGTCCAGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961382587 Original CRISPR CCACCCAGTGAGGTCCAGTG GGG Intronic
900365587 1:2310795-2310817 CCCCCCTGTGAGGTCAGGTGGGG - Intergenic
900476700 1:2879512-2879534 CAACCCAGTGGGGGCCAGTCAGG - Intergenic
902033479 1:13439530-13439552 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
903183573 1:21617520-21617542 GCGCCCAGTGGGGTACAGTGTGG - Intronic
903745811 1:25585888-25585910 CAGCCCAGTGAGGGGCAGTGTGG - Intergenic
905927194 1:41759834-41759856 CCACCCTGTGAGGTCCTATGTGG - Intronic
906614471 1:47225250-47225272 CCCCCGAGTGAGTGCCAGTGAGG - Intronic
911054868 1:93700945-93700967 CCACCTGGTGAGGTCCGCTGAGG - Intronic
912788210 1:112624727-112624749 CCACCCATAGAGGTTAAGTGAGG - Intronic
913111222 1:115658867-115658889 CCACCCAGGAAGTTCCTGTGGGG + Intronic
916202278 1:162283620-162283642 CCAGTCAGTGAGGTCCAGGAAGG - Intronic
918261341 1:182799200-182799222 CCACAAATTGAGGTCCAGAGTGG - Intronic
919382113 1:196872411-196872433 CCATCCACTGATGTCCAGGGTGG - Intronic
920647780 1:207815914-207815936 CCTCCCAGGTAAGTCCAGTGTGG - Intergenic
921012919 1:211161030-211161052 CCACCCAGAGAGGTGCAGGTCGG + Intergenic
924542183 1:244991454-244991476 CCACCCTGTGACCTCCAGAGAGG - Intronic
924787100 1:247209176-247209198 GCACCCAGTGGGGCACAGTGTGG - Intergenic
1063769737 10:9183632-9183654 CCACCCCGTGGGCTCCTGTGCGG + Intergenic
1064561475 10:16598845-16598867 CCACCCTGTCAGGCCCAGAGAGG - Intronic
1065355973 10:24842178-24842200 CCTCCCACTGAGCTCCAGAGAGG - Intergenic
1066123255 10:32312099-32312121 CCACACAGAGAAGGCCAGTGAGG + Intronic
1067450411 10:46378654-46378676 CCATCCAGAGAGAGCCAGTGTGG - Intronic
1067571952 10:47378203-47378225 CCATCCATGGAGGTCCAGTTTGG - Intronic
1067586834 10:47481109-47481131 CCATCCAGAGAGAGCCAGTGTGG + Intronic
1072790844 10:98316663-98316685 CCACTCACTGAGCTGCAGTGAGG + Intergenic
1076502913 10:130950998-130951020 TCACCCAGGGAGGTCCTGTGAGG - Intergenic
1077115930 11:884663-884685 CTACCTGCTGAGGTCCAGTGAGG - Intronic
1077352740 11:2100438-2100460 CCTCGCAGTGAGCTCCGGTGGGG - Intergenic
1077465703 11:2732817-2732839 CCACCCACTGGGGCCCAGGGAGG + Intronic
1081054114 11:38386786-38386808 CAGCCCAGTGAGGCCCAGTTTGG - Intergenic
1086210084 11:84308627-84308649 CCACTCCGTGAGCTCCTGTGCGG - Intronic
1088530085 11:110798953-110798975 GGACTCTGTGAGGTCCAGTGGGG + Intergenic
1088761547 11:112933800-112933822 CAACCCAGTGAAGGCCAGTGTGG - Intergenic
1089378742 11:118012938-118012960 CTGCCCAGTGCAGTCCAGTGTGG - Intergenic
1089706564 11:120282265-120282287 CCACCCTGTTAGGTATAGTGAGG - Intronic
1092092772 12:5817409-5817431 ACACGCAGTGAGGTGCACTGGGG + Intronic
1097220095 12:57444253-57444275 CCACCAAGTCCGGTCCAGTGTGG - Intronic
1098292321 12:68968451-68968473 CCACCCAGTGATCTGGAGTGGGG - Intronic
1102149034 12:110676086-110676108 CCACCCAGGCAGGGCCAGAGCGG + Intronic
1103592782 12:122004188-122004210 CCGCCCAGTGTGGCCCAGTGTGG + Intergenic
1103620177 12:122182795-122182817 CCAGCCAGTGGGTTCCAGGGTGG - Intronic
1104129380 12:125878333-125878355 CCTCCCAGTGATGCTCAGTGGGG - Intergenic
1104901427 12:132191314-132191336 CCAGCCAGTGAGCTCCAGCACGG + Intergenic
1105493463 13:20909499-20909521 ACACACAGTGAGGTCCAGAAGGG - Intergenic
1107361239 13:39619512-39619534 CCACCCAGTGGGCTCCAGGCTGG - Intergenic
1113564836 13:111313520-111313542 CGACCCTGTGAGGTCCAGGCAGG - Intergenic
1113804509 13:113105643-113105665 CCAGCCACTGAGCTCAAGTGGGG - Intergenic
1115192539 14:30761063-30761085 CTTCCCAGTGAGGTCCCTTGAGG + Intergenic
1117823750 14:59678575-59678597 CCACATACTGAGGTCCAGCGTGG + Intronic
1119551692 14:75518850-75518872 CCAACCTGAGAGGTCAAGTGAGG + Intergenic
1119613561 14:76083501-76083523 CCACTCAGTGAGGACCTCTGAGG - Exonic
1122617498 14:103030029-103030051 CCACCCTGTGAGAGCCAGTTAGG - Intronic
1123121602 14:105919346-105919368 CCATTCAGTGGGGTTCAGTGGGG + Intronic
1202839551 14_GL000009v2_random:108927-108949 CTACTCAGTGGGCTCCAGTGAGG + Intergenic
1130332450 15:82932923-82932945 CCACCCAGTGGGGTTCAGATCGG - Intronic
1131249298 15:90820116-90820138 GCACCCAGTGAGAGCCAGTCTGG + Intergenic
1131953589 15:97707412-97707434 ACTCCCAGTGAGTTCCAATGGGG - Intergenic
1132549029 16:546769-546791 CCACCCTGTGAGGTCCTGAGTGG - Intronic
1134516864 16:14894526-14894548 CCAGCCAGTACGGTCTAGTGAGG - Intronic
1134704534 16:16293180-16293202 CCAGCCAGTACGGTCTAGTGAGG - Intronic
1134963008 16:18418934-18418956 CCAGCCAGTACGGTCTAGTGAGG + Intronic
1134967303 16:18501533-18501555 CCAGCCAGTACGGTCTAGTGAGG + Intronic
1135750465 16:25054853-25054875 CCACCCAGTGTTGGGCAGTGAGG - Intergenic
1135759512 16:25125998-25126020 CCACCCAGTGTTGGGCAGTGAGG - Intronic
1138396062 16:56705595-56705617 CCATCCAGTGTGGGCCTGTGGGG + Intronic
1138529436 16:57627102-57627124 CCACCCCGTGGGGTGCAGGGAGG - Intronic
1139477567 16:67210287-67210309 GCAGCCACTGAGGTCCAGGGAGG + Exonic
1140475999 16:75239540-75239562 CCAGCCACTGAGCTCCAGGGCGG - Intronic
1140734078 16:77882541-77882563 CCACCCCATGAGGAACAGTGAGG + Intronic
1141006770 16:80359922-80359944 CCAATGAGTGTGGTCCAGTGTGG + Intergenic
1141006778 16:80359971-80359993 CCAATGAGTGTGGTCCAGTGTGG + Intergenic
1141126355 16:81403771-81403793 CCTCCCAGGCAGGTCCGGTGCGG + Intergenic
1143297553 17:5882853-5882875 CCACCCAGTGAGGTCCCTAAGGG - Intronic
1145718901 17:27049853-27049875 CTACCCAGTGAGGTGCAGCAGGG - Intergenic
1148461053 17:47839235-47839257 CCACCCAGGGAAGTCCAGGAAGG + Intronic
1148870214 17:50654630-50654652 CCACCCAGTGAGGTACAGGTGGG + Intronic
1150069713 17:62140335-62140357 CCACCCAGGAAGGTCCAGATGGG - Intergenic
1152893741 17:82897807-82897829 CCACACAGTGAGAACCACTGAGG - Intronic
1153517565 18:5918415-5918437 ACACCCAGAGAGGCCCATTGAGG - Intergenic
1153954895 18:10087815-10087837 TGACCCAGTGACCTCCAGTGGGG - Intergenic
1155129266 18:22914178-22914200 CAAACCAGTGTGGTCCAGAGAGG + Intronic
1157914756 18:51654436-51654458 CCCCTCAGTGAGGCTCAGTGCGG - Intergenic
1158045706 18:53153033-53153055 CCACCCAGGGAGTGCCAGAGAGG - Intronic
1160728584 19:630033-630055 CCACCCAGGAAGGTCCAGATGGG - Exonic
1161593611 19:5140204-5140226 CCACACAGTGAGAGCCTGTGGGG + Intronic
1161811349 19:6472969-6472991 CCAGCCAGTGACCTTCAGTGAGG - Exonic
1163284507 19:16338073-16338095 CCACCCTGTGAGGTCCAAGCTGG - Intergenic
1165746542 19:38233315-38233337 CCAGACAGTGATGTCCAGAGGGG + Intergenic
1166960084 19:46491990-46492012 CCACCCACTGAGGACCAGGCTGG - Exonic
1167097400 19:47381669-47381691 CCACACACTGGGGTTCAGTGGGG + Intronic
1168704504 19:58461772-58461794 CCATGCAGTGAGGTGCACTGTGG + Intergenic
925297784 2:2789681-2789703 TGACCCAGAGAGGTGCAGTGTGG + Intergenic
925315152 2:2916855-2916877 CCAGCCAGAGTGGGCCAGTGAGG + Intergenic
929442364 2:41974048-41974070 TCACCCAGGGAGGGCCAGAGGGG + Intergenic
929572264 2:43030098-43030120 GAACCCAATGAGGGCCAGTGTGG - Intergenic
931642542 2:64394653-64394675 GATCCCAGTGAGGGCCAGTGTGG + Intergenic
936241398 2:110791178-110791200 CCACACAGTCAGGTAAAGTGTGG - Intronic
936535773 2:113309833-113309855 AAACCCCGTGAGGTCCTGTGGGG - Intergenic
938728250 2:134125692-134125714 GCACACAGTGGGCTCCAGTGAGG - Intronic
939697424 2:145343838-145343860 CCACCCCGTGAGACCCTGTGAGG - Intergenic
940155710 2:150654053-150654075 CCATCAAGTGAGGACAAGTGAGG + Intergenic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
947337612 2:229103456-229103478 GCACACAGTGAAGTCCAGTAGGG - Intronic
947992639 2:234498588-234498610 CCACCCAACGTTGTCCAGTGAGG + Intergenic
948632210 2:239309612-239309634 CCTGCCAGTGAGGGCCAGCGAGG + Intronic
1169353129 20:4886120-4886142 CCACCCAGGCAGCTCCAGGGTGG + Intronic
1171048369 20:21832667-21832689 GCCCACAGTGAGGTCCTGTGGGG - Intergenic
1173963242 20:47091264-47091286 CCAGCCTCTGACGTCCAGTGTGG + Intronic
1174303611 20:49600035-49600057 CCATGCAGTGAGGCCCAGAGGGG - Intergenic
1176090186 20:63315175-63315197 TCACTCAGTGAGATCCAGAGGGG + Intronic
1176166274 20:63675689-63675711 CCACGCAGGGAGTTGCAGTGGGG + Intronic
1176628282 21:9113788-9113810 CTACTCAGTGGGCTCCAGTGAGG + Intergenic
1179308763 21:40178550-40178572 AGACCCTGTGAAGTCCAGTGTGG - Intronic
1180692119 22:17725995-17726017 CCACCACATGAGGTCAAGTGTGG + Intronic
1180701972 22:17786012-17786034 CTCCCCAGTGATGCCCAGTGAGG - Intergenic
1180710290 22:17835002-17835024 CCTCCCAGTGAACTGCAGTGCGG - Intronic
1180949993 22:19716632-19716654 CCACCCACTGGGGCCCAGTCAGG - Intronic
1182087138 22:27569022-27569044 CCAACCTGTGAGGTTCAGGGAGG - Intergenic
1182769760 22:32786230-32786252 GCACACAGTGAGGTACAGTTAGG + Intronic
1184862239 22:47179179-47179201 GCACACAGGGAGATCCAGTGTGG - Intergenic
1185220418 22:49626696-49626718 CCACCCACTGAGGCGCAGGGTGG + Intronic
950707832 3:14793887-14793909 CCACCCTGGGAGGCCCAGGGGGG + Intergenic
950799623 3:15539524-15539546 GGACCAAGTGAGGTTCAGTGTGG - Intergenic
951980653 3:28562856-28562878 CCAACAACTGAGGCCCAGTGAGG - Intergenic
957560129 3:81812085-81812107 CCACTCCGTGAGCTCCTGTGCGG - Intergenic
961382587 3:126505535-126505557 CCACCCAGTGAGGTCCAGTGGGG + Intronic
961430060 3:126875072-126875094 CCGCCCAGTGGGATCCAGAGAGG - Intronic
961578254 3:127856249-127856271 CCATCCAGTGGCATCCAGTGCGG + Intergenic
961743521 3:129047997-129048019 CTGCCCAGTGATGTCCAGTGGGG + Intergenic
963262189 3:143204210-143204232 CCACACAGTGAGGGCGTGTGTGG + Intergenic
964471927 3:157065436-157065458 CCACCCAGAGAAGCCCTGTGGGG - Intergenic
966223515 3:177573568-177573590 GCACCCAGTGAGGTTCACTAAGG - Intergenic
969197453 4:5574292-5574314 CCACTCAGAGAGGTGTAGTGTGG + Intronic
974047320 4:56908510-56908532 CCACCGAGTCAGGTCCTTTGAGG + Intronic
974781707 4:66561568-66561590 CCGCCCGGTGGGGTCCTGTGCGG - Intergenic
975898001 4:79117891-79117913 CCACCCACTTTGGTCCTGTGTGG - Intergenic
979044982 4:115851754-115851776 CCACCCAGTTAGGTCAGGTTAGG - Intergenic
981710380 4:147703556-147703578 CTCCGCAGTGAGGTACAGTGAGG - Intergenic
981945152 4:150333580-150333602 CCATCCAGTGATGTCTACTGTGG + Intronic
983265896 4:165507737-165507759 TGACCCAGAGAGGTCCAGAGAGG - Intergenic
983296037 4:165870490-165870512 CCCCACAGTGAGGGCCAGTGAGG + Intergenic
985552431 5:540453-540475 CCATCCAGAGAGGTCCAGCCTGG + Intergenic
986569939 5:9154418-9154440 CCACCCAGAGAGAGCCAGGGAGG - Intronic
987328450 5:16833694-16833716 TCAGCCAGTGAGGTGCAGAGTGG - Intronic
987504793 5:18754093-18754115 CCACACAGTGGCGTCCAGAGTGG + Intergenic
994251472 5:97541952-97541974 CCACCCCGTGGGCTCCTGTGCGG - Intergenic
995130456 5:108624491-108624513 ACACCCAGTGCTGTCCACTGGGG + Intergenic
997371657 5:133365411-133365433 CCACCCAGGCAGGTCCAGATGGG + Intronic
998445390 5:142194576-142194598 CCACCCAGTGGGTAGCAGTGGGG - Intergenic
1000414241 5:160966610-160966632 CAACACAGTGAGGCCCAGAGAGG - Intergenic
1002517451 5:179769886-179769908 CCAGACAGTGAGGTTCATTGAGG + Intronic
1003158957 6:3619142-3619164 CCACCCAGAGAGGTCTGGGGTGG - Intergenic
1004612888 6:17262528-17262550 CCACCCATTGGAGTACAGTGGGG - Intergenic
1007376807 6:41462623-41462645 CCACCAACTGATGTGCAGTGAGG + Intergenic
1008555455 6:52669559-52669581 CCAGGCACTGAGGTCCAGAGGGG + Intergenic
1013313403 6:108918626-108918648 CCACCCTGCATGGTCCAGTGAGG + Intronic
1015488540 6:133799732-133799754 CTACCCAGTGAGGAAAAGTGAGG + Intergenic
1018705948 6:166463022-166463044 CCAGGCAGTGAGGTTCTGTGCGG + Intronic
1019188043 6:170232548-170232570 CCACCCAGAGAGCTGCACTGTGG + Intergenic
1019408024 7:894033-894055 CTGCCCAGGCAGGTCCAGTGCGG + Intronic
1019412349 7:911842-911864 CCACCCAGAGAGGGGCAATGGGG + Intronic
1019599238 7:1873253-1873275 CCAGCCCGTGAGGTCCAGAGGGG - Intronic
1021775816 7:24054417-24054439 CAACTCCGTGAGGTTCAGTGGGG + Intergenic
1023545341 7:41312481-41312503 CCACCCTGTGAGTTCCAGGAGGG + Intergenic
1023855795 7:44182993-44183015 CCACCAGCTGAGGGCCAGTGGGG - Intronic
1029170460 7:98626364-98626386 CCACCCAGGGCAGTTCAGTGAGG - Intronic
1029435168 7:100559998-100560020 TCACCCAGTGAGGACCAGGCTGG - Intronic
1030525059 7:110642829-110642851 CAGGCCAGTGAGGTCGAGTGTGG + Intergenic
1032660732 7:133981033-133981055 CTACTCAGTGAGGACAAGTGTGG - Intronic
1032722321 7:134560360-134560382 CCACCCAGTGAGGCCCACAGAGG + Intronic
1034398585 7:150846505-150846527 TGACCCAGTGTGTTCCAGTGGGG - Intronic
1035444805 7:158932959-158932981 CAGCCCAGTGTGTTCCAGTGAGG + Intronic
1035860832 8:3026325-3026347 GGATCCAGCGAGGTCCAGTGAGG - Intronic
1035860843 8:3026365-3026387 AGGTCCAGTGAGGTCCAGTGAGG - Intronic
1035860845 8:3026375-3026397 AGGCCGAGTGAGGTCCAGTGAGG - Intronic
1035860855 8:3026415-3026437 AGGCCCAGTGAAGTCCAGTGAGG - Intronic
1035860871 8:3026495-3026517 AGGTCCAGTGAGGTCCAGTGAGG - Intronic
1035860885 8:3026564-3026586 AAGCCCAGTGAGGTCCGGTGAGG - Intronic
1035860892 8:3026594-3026616 AGGTCCAGTGAGGTCCAGTGAGG - Intronic
1035860895 8:3026604-3026626 AGGCCCGGTGAGGTCCAGTGAGG - Intronic
1040583375 8:48716061-48716083 CCACCCAGACAGGTCGGGTGGGG + Intronic
1042963346 8:74325639-74325661 CCAGCAAGTAAGGTCCAGTAAGG + Intronic
1043486000 8:80699969-80699991 ACCCCCAGTGAGGTCAGGTGGGG + Intronic
1045561274 8:103266043-103266065 CCACCCAGGGAGCTTTAGTGGGG + Intergenic
1048002348 8:130389247-130389269 CCACCCAGTAAGCTCTAGGGTGG + Intronic
1049001909 8:139831676-139831698 CCATCCAGTGGGGCTCAGTGAGG - Intronic
1049235883 8:141512076-141512098 CCACCCAGTGCGTCTCAGTGTGG - Intergenic
1049454003 8:142677875-142677897 CAACCCAGTGGGTTCCAGGGAGG + Intronic
1049642743 8:143722727-143722749 CCCCCCAGGGTGGTCCTGTGGGG + Intergenic
1050153705 9:2643429-2643451 CCAGCCAGCGAAATCCAGTGCGG + Exonic
1057703091 9:97377671-97377693 CCACCCAGTGAGGCCCTGCTTGG + Intronic
1059123088 9:111660271-111660293 CCAGCCAGTGAGGTTCATTATGG + Intronic
1059174231 9:112154715-112154737 CCTTCCAGTGAGGTCCACAGAGG - Intronic
1059216360 9:112567541-112567563 CCACCCAGTGACTTCCATTTAGG + Intronic
1059357520 9:113711531-113711553 ACACCCTGTGAGGTCCCTTGGGG + Intergenic
1060309402 9:122445845-122445867 CCACTGAGTGAGGACCTGTGTGG + Intergenic
1060340079 9:122767704-122767726 CCACCCAGGGAATTCCAGTGAGG + Intergenic
1061439270 9:130588915-130588937 CCACCCAGAGAGGTCCTGCCTGG - Intronic
1061908003 9:133708624-133708646 CCACTCACTGAGGGCCACTGGGG - Intronic
1061947960 9:133919426-133919448 TCACCCAGGGCTGTCCAGTGAGG - Intronic
1061998853 9:134205624-134205646 CCACCCAGGGAGGGGCGGTGGGG + Intergenic
1062133269 9:134911804-134911826 CCACCCAGTGAACTCCAGTGGGG - Intronic
1203751128 Un_GL000218v1:81468-81490 CTACTCAGTGGGCTCCAGTGAGG + Intergenic
1186749507 X:12607007-12607029 CCACCCATTGGGGTCCACTGTGG + Intronic
1192832769 X:74767694-74767716 CCACCCAGTGAGGAGAAGTAGGG + Intronic