ID: 961384683

View in Genome Browser
Species Human (GRCh38)
Location 3:126516771-126516793
Sequence GTGTCCTGTTAGGCCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 134}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961384674_961384683 3 Left 961384674 3:126516745-126516767 CCTGAGTGACCCCTACTGTCCCC 0: 1
1: 0
2: 1
3: 10
4: 163
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384669_961384683 21 Left 961384669 3:126516727-126516749 CCCCAGCGCCAGCTCTGCCCTGA 0: 1
1: 0
2: 2
3: 59
4: 460
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384672_961384683 13 Left 961384672 3:126516735-126516757 CCAGCTCTGCCCTGAGTGACCCC 0: 1
1: 0
2: 13
3: 71
4: 552
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384673_961384683 4 Left 961384673 3:126516744-126516766 CCCTGAGTGACCCCTACTGTCCC 0: 1
1: 0
2: 0
3: 18
4: 135
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384677_961384683 -8 Left 961384677 3:126516756-126516778 CCTACTGTCCCCACTGTGTCCTG 0: 1
1: 0
2: 4
3: 52
4: 500
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384675_961384683 -6 Left 961384675 3:126516754-126516776 CCCCTACTGTCCCCACTGTGTCC 0: 1
1: 0
2: 2
3: 21
4: 362
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384671_961384683 19 Left 961384671 3:126516729-126516751 CCAGCGCCAGCTCTGCCCTGAGT 0: 1
1: 0
2: 2
3: 30
4: 300
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384668_961384683 25 Left 961384668 3:126516723-126516745 CCTTCCCCAGCGCCAGCTCTGCC 0: 1
1: 0
2: 10
3: 126
4: 865
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384667_961384683 26 Left 961384667 3:126516722-126516744 CCCTTCCCCAGCGCCAGCTCTGC 0: 1
1: 1
2: 2
3: 56
4: 591
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384670_961384683 20 Left 961384670 3:126516728-126516750 CCCAGCGCCAGCTCTGCCCTGAG 0: 1
1: 0
2: 1
3: 39
4: 403
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134
961384676_961384683 -7 Left 961384676 3:126516755-126516777 CCCTACTGTCCCCACTGTGTCCT 0: 1
1: 0
2: 4
3: 37
4: 355
Right 961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961384683 Original CRISPR GTGTCCTGTTAGGCCTCTGT GGG Intronic
902825249 1:18968908-18968930 GTTGCCTGTTCAGCCTCTGTAGG - Intergenic
903669399 1:25026537-25026559 GTGCTCTGTTAGGCCTCGGCAGG + Intergenic
904163316 1:28536857-28536879 GTGGCTTGTGGGGCCTCTGTGGG + Exonic
906933551 1:50192154-50192176 GTGGGCTGGGAGGCCTCTGTGGG - Intronic
915041259 1:152969968-152969990 GTGTTCTGTGAGGCTTCTCTGGG - Intergenic
918486941 1:185039222-185039244 GTGTCCTGTTAGGGGTATATGGG - Intergenic
920016143 1:202910937-202910959 GTCTCCTGTTTTGCCTCTCTAGG - Intronic
920207239 1:204301473-204301495 GTGGCGTGTTTGGACTCTGTGGG - Intronic
922815994 1:228449831-228449853 GGGCCCTGTGAGGCCTCTGGGGG + Intergenic
924752225 1:246904638-246904660 GTGTCTTGATAGGCCTCTCATGG - Intronic
1063024735 10:2166433-2166455 GTGTCCGGCCAGGCCTCTGGGGG + Intergenic
1065297310 10:24289358-24289380 CTCTCCTCTCAGGCCTCTGTAGG - Intronic
1068130520 10:52889932-52889954 GTGTCCAGCTCGGGCTCTGTCGG - Intergenic
1072617091 10:97057119-97057141 CTGTCCCTTTAGGCCTCTCTTGG - Intronic
1072634839 10:97171257-97171279 TTGGGGTGTTAGGCCTCTGTGGG - Intronic
1075129761 10:119727426-119727448 GTGTCCTGTAAGGTTGCTGTGGG - Intronic
1076305970 10:129466253-129466275 CTGTCCTCTTAGGCTTCTGGTGG + Intergenic
1076712685 10:132347373-132347395 GTGTCTGGTGGGGCCTCTGTGGG + Intronic
1076712706 10:132347472-132347494 GTGTCCTGTGGGGCTTGTGTGGG + Intronic
1077326685 11:1967041-1967063 GTGTCCTGGTCACCCTCTGTCGG + Intronic
1078775462 11:14389628-14389650 GTGTCCTACCAGGGCTCTGTGGG - Intergenic
1081240156 11:40695625-40695647 TTTTCCTGTTTGGCGTCTGTAGG + Intronic
1082980967 11:59120583-59120605 GTGACCTGTTAGGGCTGTGAGGG + Intronic
1083756372 11:64793840-64793862 GTGACCTGTTGGGGCTCTGATGG + Intronic
1085499567 11:77007405-77007427 GGTTCCTCTTTGGCCTCTGTTGG + Intronic
1088850480 11:113699782-113699804 GTGTCCTGTTGGAGCTCTGTGGG - Intronic
1202809666 11_KI270721v1_random:22221-22243 GTGTCCTGGTCACCCTCTGTCGG + Intergenic
1092813700 12:12294696-12294718 CCGTCCTGCTGGGCCTCTGTGGG - Intergenic
1101478995 12:105078605-105078627 TTTACCTGTTTGGCCTCTGTGGG + Intronic
1103987950 12:124779909-124779931 GTGTCCTGTGCTGCCTCAGTGGG - Intronic
1104411322 12:128560399-128560421 GTCTCCTGGAAGGCCACTGTGGG - Intronic
1109554864 13:63959794-63959816 CTGTCCTGTTGGGCTTCTGATGG - Intergenic
1113416359 13:110131550-110131572 GTCTCCTGTTAGGGTGCTGTGGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113958625 13:114112991-114113013 GAGTCCTGGTCGGCCTCTGCTGG - Intronic
1117609337 14:57465972-57465994 ATGTACTGTCAGGCCTCAGTGGG + Intergenic
1121625922 14:95385357-95385379 GGGTGCTCTTAGGCTTCTGTAGG - Intergenic
1121627422 14:95396380-95396402 GTTTCCTGTTTGGGTTCTGTAGG + Intergenic
1130388093 15:83430228-83430250 GTGTTCTGGGAGGCCTGTGTGGG + Intergenic
1133446148 16:5862770-5862792 GGGTCGTGTTAGGTCTCTTTCGG - Intergenic
1137082935 16:36087168-36087190 GTGCCTTTTGAGGCCTCTGTAGG + Intergenic
1137083027 16:36089039-36089061 GTTCCCTCTGAGGCCTCTGTTGG + Intergenic
1138026239 16:53524346-53524368 GTGCCCTGTCTGGCCTCCGTGGG - Intergenic
1141227648 16:82133991-82134013 GTTTCCTGTTAGATTTCTGTAGG + Intergenic
1141609642 16:85174152-85174174 GTGACCTGTTCAGCCTCCGTGGG + Intronic
1142624105 17:1181091-1181113 CCTTCCTGGTAGGCCTCTGTAGG - Intronic
1145683827 17:26633526-26633548 GTGTGCTTTGAGGCCTGTGTTGG + Intergenic
1148824262 17:50380587-50380609 CTGACCTGTGAGGCCTTTGTGGG - Intronic
1152300873 17:79494866-79494888 GGGTCCTCTTGTGCCTCTGTTGG - Intronic
1152481710 17:80558367-80558389 GTTTCCTGTTCGGCCTCTGAAGG - Intronic
1155378380 18:25188168-25188190 GTGGCCCGGTAGGCCTCAGTTGG - Intronic
1158387952 18:57015991-57016013 TTGTCCTGTTTGCCCTCTGCCGG + Intronic
1167128400 19:47567779-47567801 GTGCCCTGCCAGGCCTCTGGAGG + Intergenic
1167700726 19:51043604-51043626 GGGTCCTGTTCTGCCTCTGTGGG - Intergenic
926166509 2:10524529-10524551 GTCTCCTGCCAGGCCTCTGCTGG - Intergenic
926228847 2:10987637-10987659 GTGTCCTGATTGGTCCCTGTAGG - Intergenic
927585170 2:24296627-24296649 GTTTCTTGTGAGGCCTCTTTTGG - Intronic
928775912 2:34763271-34763293 GTGTCTTGTTAGGCTTCTAGAGG + Intergenic
929960348 2:46491557-46491579 GTTTCCTCTGAGGCCTCTCTCGG + Intronic
930251362 2:49037807-49037829 ATTTCCTGTTAGGACTATGTTGG - Intronic
932612249 2:73208450-73208472 GTGTCCTGTAGGTCCTCCGTTGG - Exonic
935647387 2:105350978-105351000 ATGTCATGTTAGGCTTCTCTTGG + Intergenic
935796537 2:106647088-106647110 GTTTCCTGTGTGGGCTCTGTAGG - Intergenic
938995065 2:136669697-136669719 GTTTCCTGCTAGGCATCTGCTGG + Intergenic
939828267 2:147041914-147041936 GTGTCATGGTAGTCCTCTTTAGG + Intergenic
942322775 2:174750455-174750477 GTTTCTTGTGAGGCCTCTCTCGG - Intronic
1169968128 20:11239638-11239660 ATCTCCTGCTTGGCCTCTGTAGG - Intergenic
1171737872 20:28818293-28818315 GAGTGCTTTTAGGCCTCTGGTGG - Intergenic
1174909047 20:54586695-54586717 GTGTCCAGTGGGGCCTCTGTGGG + Intronic
1178428227 21:32496579-32496601 GTGACCTTTTTGGCCTCTGGGGG - Intronic
1179492237 21:41748145-41748167 GCGTCCTGCCAGGCCTCTGCTGG - Intronic
1183886123 22:40884027-40884049 GTTTCCTGTAAAGCCTCTTTTGG + Intronic
952315992 3:32232725-32232747 GTGTCCTCTGAGGCCTCTGGAGG + Intergenic
953252393 3:41258079-41258101 GTGTCCTCTTAGGCCGCTGAAGG + Intronic
953754738 3:45636414-45636436 GTGCCCTGATGGGCTTCTGTTGG - Intronic
954865363 3:53724524-53724546 CTGTCCTGTGGGGCCTCTGCAGG + Intronic
956123889 3:65993293-65993315 GTGTCATTTTAAGCCTCAGTGGG - Intronic
958405876 3:93759334-93759356 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
958407419 3:93766510-93766532 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
958408078 3:93773282-93773304 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
958408117 3:93773965-93773987 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
960583670 3:119301509-119301531 TTAGCCTGTTAGGCATCTGTGGG + Intronic
961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG + Intronic
964449687 3:156800143-156800165 GGATCCTGTGAGGCCACTGTGGG + Intergenic
964828596 3:160857952-160857974 GTGTCCTGTCATGACTCTTTTGG + Intronic
965483748 3:169252712-169252734 GTGTCCTTTAGTGCCTCTGTGGG - Intronic
966833279 3:184029388-184029410 GTTACCTGGTTGGCCTCTGTAGG - Intergenic
967477282 3:189936664-189936686 TGTTCCTGTTTGGCCTCTGTGGG - Intergenic
968228787 3:196992245-196992267 GTGTCCTGTTACGCCACAGCCGG + Intronic
971508159 4:27389325-27389347 GTTTCCTTTTCAGCCTCTGTAGG + Intergenic
971745340 4:30572558-30572580 GTGTCCTGATAGGAGGCTGTTGG - Intergenic
973865571 4:55109432-55109454 GTGTCCTGATACTCTTCTGTAGG - Intronic
987906045 5:24078618-24078640 GTTTCCTCTTAGGCCTCTCTTGG - Intronic
989510377 5:42280008-42280030 GTGTCCTGTTACTGATCTGTGGG - Intergenic
989858327 5:46329854-46329876 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
989858380 5:46330880-46330902 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
989858576 5:46334291-46334313 GTTTCCTTTGAGGCCTATGTTGG - Intergenic
989859150 5:46343624-46343646 GTTTCCTTTGAGGCCTTTGTTGG - Intergenic
989861600 5:46384932-46384954 GTTTCCTTTGAGGCCTATGTTGG + Intergenic
989944965 5:50212559-50212581 GTGTGCTTTGAGGCCTCTGGTGG - Intergenic
997612752 5:135226621-135226643 GTGGAATGTGAGGCCTCTGTAGG + Intronic
999362979 5:151001703-151001725 GTCTCCAGTTAGGCCTGTGATGG + Intergenic
1000196188 5:158960751-158960773 GTTTCCTGTTTGCTCTCTGTAGG + Intronic
1001175450 5:169464304-169464326 GTGTCCTGATACTCCTCTGCTGG + Intergenic
1007679055 6:43621863-43621885 GCGGCCTGATAGGCCTCTGGAGG - Intronic
1012423694 6:99092094-99092116 GTGTCCTTTAAGGCCTTTGGGGG + Intergenic
1013569862 6:111411196-111411218 GTGTGATGTTAGGCCTCTTCTGG - Intronic
1014273400 6:119359944-119359966 ATGTCCTGTATGGCTTCTGTAGG - Intergenic
1015471073 6:133607128-133607150 GGGGCCTCTTAGGCCTCAGTTGG + Intergenic
1015641624 6:135339705-135339727 GAGTCCTGTTATGCATATGTTGG - Intronic
1015649628 6:135441352-135441374 GAGTCCCGTTATGCCTGTGTTGG - Intronic
1019186460 6:170223398-170223420 GGGTCCTGCCAGGCCTCTGCTGG + Intergenic
1019197957 6:170292996-170293018 GTGTCCTTTTTGGACTCTATAGG + Intergenic
1021978453 7:26031370-26031392 GTGCCCTCTGAAGCCTCTGTGGG - Intergenic
1022469961 7:30676057-30676079 GGGCCCTGATAGGCCTCTGCTGG - Intronic
1022665435 7:32406119-32406141 GTGTGCTTTTAGGCCTCTGTGGG - Intergenic
1025310989 7:57941893-57941915 TTTTCCTTTTAGGCCTCTGTTGG - Intergenic
1026356815 7:69565025-69565047 CTGTACTGTGAAGCCTCTGTTGG + Intergenic
1026913376 7:74105814-74105836 GTTTCCTGTTGGGGCTCTGAGGG + Intronic
1027972758 7:85106916-85106938 GTGTCCTGTGAGGGATCTGGTGG - Intronic
1028149743 7:87357918-87357940 GTGTCCTTGTAGGTATCTGTAGG + Intronic
1030780075 7:113589789-113589811 GTTTCCTGTTAGGCATCTGTAGG + Intergenic
1036931261 8:12958461-12958483 GTGCCCAGCTATGCCTCTGTAGG + Intronic
1039919800 8:41885252-41885274 GTGTCTTGTAAGTCCTGTGTGGG + Intronic
1046327389 8:112667589-112667611 GTTTCCTGATAAGGCTCTGTGGG + Intronic
1047645180 8:126862724-126862746 GTTTTCTGTAAGGCCTCTGGAGG + Intergenic
1048555019 8:135467471-135467493 GTGTAGTGTCAGGCCTCTTTAGG + Intronic
1051151054 9:14079535-14079557 GTGTCCTGTAAAGACTCGGTGGG + Intergenic
1054276667 9:63083828-63083850 GAGCGCTGTTAGGCCTCTGGTGG - Intergenic
1054398167 9:64681103-64681125 GAGCGCTGTTAGGCCTCTGGTGG + Intergenic
1056755892 9:89381858-89381880 CTGTTATGTTAGGCCTCTGCTGG - Intronic
1057561817 9:96133745-96133767 GTGTCCTGGTAGGAGGCTGTTGG - Intergenic
1058532559 9:105921261-105921283 ATGTCATGTGAGGCCTCAGTTGG + Intergenic
1060578342 9:124719542-124719564 GTTTCCTGCTAGTCTTCTGTAGG - Intronic
1203445519 Un_GL000219v1:51046-51068 GTGTGCTGTTTGGTTTCTGTGGG - Intergenic
1186875008 X:13808105-13808127 GTGCTCTGTTAGTGCTCTGTTGG - Intronic
1187286953 X:17914737-17914759 GTGTCCAGGTCGGCTTCTGTAGG + Intergenic
1188773150 X:34179377-34179399 GTGTCCAGAAAGACCTCTGTTGG - Intergenic
1191570977 X:62619138-62619160 GTTTCCTTTGAGGCCTATGTTGG + Intergenic
1191585348 X:62820118-62820140 TTTTCATGATAGGCCTCTGTGGG + Intergenic
1192184070 X:68934665-68934687 GGGTCCTGAAAGACCTCTGTGGG - Intergenic
1196657877 X:118238641-118238663 TTGTCCTTTTATGCCTCTGTAGG + Intergenic
1197623505 X:128778834-128778856 GTGTTCTGCCAGGCCACTGTTGG + Intergenic
1198312026 X:135433583-135433605 GTCGCCTGTTACTCCTCTGTAGG + Intergenic
1201080847 Y:10243164-10243186 GAGTGCTTTTAGGCCTCTGGTGG - Intergenic
1201867934 Y:18674111-18674133 CTTTCCTGTTAGGCCTCTTAGGG + Intergenic