ID: 961388114

View in Genome Browser
Species Human (GRCh38)
Location 3:126535954-126535976
Sequence GGTGATCTGGCCTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961388101_961388114 29 Left 961388101 3:126535902-126535924 CCCCACAAGGGTTGGGGCATGAG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 164
961388110_961388114 5 Left 961388110 3:126535926-126535948 CCAGGGCAGATGGCAGTGGGTGA 0: 1
1: 0
2: 2
3: 43
4: 369
Right 961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 164
961388104_961388114 27 Left 961388104 3:126535904-126535926 CCACAAGGGTTGGGGCATGAGGC 0: 1
1: 0
2: 1
3: 18
4: 180
Right 961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 164
961388102_961388114 28 Left 961388102 3:126535903-126535925 CCCACAAGGGTTGGGGCATGAGG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961388114 Original CRISPR GGTGATCTGGCCTTTCCTAG AGG Intronic
900127235 1:1074000-1074022 GCTGAGCTGGCCTTACCTGGTGG + Exonic
900333092 1:2146305-2146327 GGTGAGCTGGCCCTCCCTGGAGG + Intronic
901954636 1:12775305-12775327 GGTGAGCAGTCCTTTCCCAGAGG - Intronic
901972364 1:12918129-12918151 GGTGAGCAGTCCTTTCCCAGAGG - Intronic
902005066 1:13225657-13225679 GGTGAGCAGTCCTTTCCCAGAGG + Intergenic
902007842 1:13246296-13246318 GGTGAGCAGTCCTTTCCCAGAGG - Intergenic
902012815 1:13283633-13283655 GGTGAGCAGTCCTTTCCCAGAGG + Intronic
902024292 1:13371451-13371473 GGTGAGCAGTCCTTTCCCAGAGG + Intronic
903742530 1:25566614-25566636 GGTGCTCTGGCCTCTCCCGGGGG + Intronic
904153838 1:28465741-28465763 GATGATCTGGCATTCCCTATGGG - Exonic
905985867 1:42281729-42281751 GGTGATCTGGCCAAACCTAATGG - Intronic
907291006 1:53412817-53412839 GATGCTCTGGCCCTTCCCAGTGG - Intergenic
907759708 1:57345221-57345243 GTGGATCTGCCCTTTCCTACAGG + Intronic
909374666 1:74925640-74925662 GGTGACCTGGCCTTTCTTTCTGG - Intergenic
911538490 1:99129503-99129525 GGTGAGCTGGCCTTTCCTTCTGG + Intergenic
911748011 1:101462469-101462491 GGTGATTTGGCCTATTTTAGAGG - Intergenic
912666414 1:111584264-111584286 GGAGATTTGGCCTTTTCTGGTGG - Intronic
915868344 1:159529399-159529421 TGTGATCTGGCCTTGAGTAGGGG - Intergenic
921140927 1:212305438-212305460 TGTGGTCTGGTCTTTCCTGGTGG + Intronic
922095459 1:222439531-222439553 GGTGATCTGGCCTAGGCTAGGGG - Intergenic
923043477 1:230336970-230336992 GGTGATGAGGCCCTTCCTTGAGG - Intronic
923195330 1:231661141-231661163 GGTGACCTGGCCTTTCTTTCTGG + Intronic
1066473891 10:35725707-35725729 GTGGATCTGTCCTGTCCTAGGGG + Intergenic
1067572466 10:47381507-47381529 GGTGATCCAGGCTTTCCCAGAGG + Intronic
1068938044 10:62655404-62655426 GGTGAGATGGTCTTTCCAAGGGG - Intronic
1069203650 10:65654624-65654646 GGTGATCTGCCCCTTCCTTCTGG - Intergenic
1069360332 10:67634073-67634095 GGTGACCTGGCCTTTCTTTCTGG - Intronic
1071035293 10:81237703-81237725 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1071077044 10:81767551-81767573 GGTGATCTGGCCTTTCTTTCTGG + Intergenic
1071134387 10:82436934-82436956 GATGATCTGGCCTTTCCCTCTGG + Intronic
1078855977 11:15206652-15206674 GGTGAACTGGCATTACCAAGGGG + Intronic
1085306281 11:75487806-75487828 AGTGACCTGGCCTTGCCCAGAGG + Intronic
1086866598 11:91987047-91987069 AGTGCTATGGCCTTTGCTAGAGG - Intergenic
1093077115 12:14769980-14770002 GGTGATCTGGCCTTTCATGCCGG + Intronic
1094424304 12:30302660-30302682 GGGAATCTGGCCTTTCCAACAGG + Intergenic
1101973236 12:109332416-109332438 GCTCTTCTGGCCCTTCCTAGGGG + Intergenic
1102349249 12:112180012-112180034 GGTGCTCTCACCTTTCCTAAGGG + Intronic
1104071225 12:125347471-125347493 GGTGAGCTTTCCTTTTCTAGAGG - Intronic
1105668295 13:22585264-22585286 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
1106009942 13:25810350-25810372 GCTGAAGTGGCCTTTCCTCGGGG + Intronic
1109307750 13:60660164-60660186 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1109536867 13:63733019-63733041 GCTGATTTGGCCTTTTATAGAGG + Intergenic
1111348541 13:86995660-86995682 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
1114696223 14:24630235-24630257 GTTGAGCTGGCCCTACCTAGGGG + Intergenic
1114784780 14:25584450-25584472 GGTAACCTGACCTTTCTTAGTGG + Intergenic
1117517030 14:56512087-56512109 AGTGATTTGGGCTTTGCTAGAGG - Intronic
1121906477 14:97750742-97750764 GGTGAGCAGGCCAGTCCTAGGGG + Exonic
1123419354 15:20118817-20118839 GAAGACCTGGCCTTTCCCAGAGG - Intergenic
1123446512 15:20334686-20334708 GAAGACCTGGCCTTTCCCAGAGG + Intergenic
1123528576 15:21125359-21125381 GAAGACCTGGCCTTTCCCAGAGG - Intergenic
1125286342 15:38096676-38096698 GGTGATCTGGCCCTTCTCTGTGG - Intergenic
1131989989 15:98083749-98083771 GCTGCTCTTGCCTTTCCCAGTGG + Intergenic
1136659681 16:31746513-31746535 GGTGACCTGGCCTTTCTTTCTGG + Intronic
1145888519 17:28398831-28398853 GCTGATCTAGCCGTTCCTAGTGG + Exonic
1153018640 18:606859-606881 GGTGAACTGGCCTTGCCTTGTGG - Intronic
1153407440 18:4756916-4756938 GGTCATCTGTCCTTTCCTGGAGG + Intergenic
1155763079 18:29590256-29590278 GGTGACCTGGCCTTTCCCTCTGG - Intergenic
1161729115 19:5948117-5948139 TGCTTTCTGGCCTTTCCTAGGGG - Intronic
1163120167 19:15212599-15212621 GAGGAGCTGGCCTTTCCTTGAGG - Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164013372 19:21229589-21229611 GGTGACCTGGCCTTTCTTTCTGG - Intronic
1164463175 19:28465560-28465582 GGGGCTCTGGCCTCTCCTGGGGG - Intergenic
1168522339 19:57062311-57062333 GGTGATTTTGCCTTTCCCAAGGG - Intergenic
926073777 2:9923724-9923746 GGGGTTCTGGCCTTTCCCCGTGG - Intronic
928120908 2:28582876-28582898 GCTGATCTGCCCCCTCCTAGAGG + Intronic
928900226 2:36309608-36309630 GGTGGTCTGGCCTTTCCCTGTGG - Intergenic
930545953 2:52767233-52767255 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
932484529 2:72075605-72075627 GGTCATGTGGCCTTGCCTTGGGG - Intergenic
933436378 2:82255683-82255705 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
935669955 2:105546573-105546595 GGGGATTTGTCCTTTCCCAGGGG + Intergenic
936851981 2:116910932-116910954 GGTCATCTGGTCTTACCTACTGG + Intergenic
936862197 2:117031401-117031423 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
938136645 2:128764509-128764531 GGTGATGTGGCCTTTCTTTTTGG + Intergenic
943286729 2:186010510-186010532 GGTGACCTGGCCTTTCTTTCTGG - Intergenic
945189511 2:207172243-207172265 GGTGTTCTGCCCCTCCCTAGAGG + Intergenic
945235075 2:207625636-207625658 GGTGCCCTGGGCTCTCCTAGCGG + Intronic
948625744 2:239266867-239266889 GGTGCTGTGGCCTTCCCCAGGGG + Intronic
1169294314 20:4379706-4379728 GGTGAACCAGTCTTTCCTAGTGG - Intergenic
1169984675 20:11430662-11430684 AGTGTTCTGGCCTTTCCTCCAGG + Intergenic
1170743266 20:19076381-19076403 GCTGACGTGGCCTTTCCCAGTGG - Intergenic
1172854864 20:37993946-37993968 GGTGGCCTGGCCTGGCCTAGTGG + Intronic
1174532900 20:51228027-51228049 GGTGAGCTGGCCTCATCTAGAGG + Intergenic
1176241852 20:64079124-64079146 GGAGAGCTGGCCTTCCCTGGAGG - Intronic
1176369261 21:6052661-6052683 TGTGAACTGGGCTTTCCTCGTGG + Intergenic
1178090633 21:29159381-29159403 GGAGATCCGGCCTTTCTTACAGG + Intronic
1179754258 21:43485880-43485902 TGTGAACTGGGCTTTCCTCGTGG - Intergenic
950162566 3:10771414-10771436 GGTGGTTGGGCCTTTCCTTGAGG - Intergenic
951957596 3:28274510-28274532 GGTGATCTGGCCTTTCTGTCTGG + Intronic
956757165 3:72400364-72400386 AGAGATATGGCCTCTCCTAGGGG + Intronic
957268705 3:78001920-78001942 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
958503568 3:94945288-94945310 GGTGACCTGGCCTTTCTCTGTGG + Intergenic
958650328 3:96929622-96929644 GGTGACCTGGCCTTTCTTTCTGG + Intronic
958896014 3:99830330-99830352 GGTCCTTTGGCCTTTCATAGTGG + Intronic
959418191 3:106102938-106102960 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
960413906 3:117360477-117360499 GGTGACCTGGCCTTTCTCACTGG - Intergenic
961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG + Intronic
962964953 3:140344941-140344963 GGGGCTCTGGCATTTCCAAGTGG + Intronic
965288625 3:166848356-166848378 GGTGACCTGGCCTTTCCCTCTGG + Intergenic
966071446 3:175884127-175884149 GGTAATCTGGCCTTTCTTTCTGG + Intergenic
969592631 4:8130636-8130658 GGTGATCTGACCTGGCCTGGAGG + Intronic
969796211 4:9530505-9530527 GCTGATCGTGCCATTCCTAGAGG - Intergenic
970583064 4:17490930-17490952 TCAGATCTGGCCTTTGCTAGCGG - Intronic
971107610 4:23543777-23543799 GGTGACCTGGCCTTTGCCTGTGG - Intergenic
971285845 4:25289494-25289516 GGTGATCTGGCCTTTCTCTTTGG + Intergenic
972232633 4:37093291-37093313 GGTGACTTCCCCTTTCCTAGTGG - Intergenic
972557454 4:40195305-40195327 GGTGATCTGGCTTTCCACAGAGG + Intronic
974130345 4:57747120-57747142 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
974899556 4:67980742-67980764 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
975856496 4:78630267-78630289 AGTGATCTGGCCTTTGCTCTTGG - Intergenic
975998428 4:80342412-80342434 GGTGACCTGGCCTTTCTCTGCGG - Intronic
978657019 4:111076293-111076315 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
979583709 4:122390256-122390278 GGTGACCTGGCCTTTCTTTCTGG + Intronic
980787223 4:137571483-137571505 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
981093555 4:140756629-140756651 GGGGAGCTGGGCTTCCCTAGTGG - Intergenic
981237717 4:142437502-142437524 GGTGACCTGGCCTTTCTTTTTGG - Intronic
981631698 4:146826507-146826529 GGTGACCTGGCCTTTCTTTCTGG + Intronic
984279349 4:177650245-177650267 GGTGATCAGACCTTACCTGGGGG - Intergenic
985816207 5:2130119-2130141 CTGGATCTGGCCTTCCCTAGCGG + Intergenic
986011676 5:3722757-3722779 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
988076382 5:26360959-26360981 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
989657250 5:43758468-43758490 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
992571882 5:78066908-78066930 GGTGATCTGGCCTTTCTCTCTGG - Intronic
1001057468 5:168461557-168461579 GGAAGTCTCGCCTTTCCTAGTGG + Intronic
1001839528 5:174863382-174863404 GGTGACCTGGCCTTTCTTTCTGG + Intergenic
1002004255 5:176219130-176219152 GGGGTTCGGCCCTTTCCTAGGGG + Intergenic
1002222118 5:177691499-177691521 GGGGTTCGGCCCTTTCCTAGGGG - Intergenic
1002967399 6:1979789-1979811 GGTGATCTGGCCTTTCTCTCTGG - Intronic
1005170795 6:22982051-22982073 GGTGACCTGGCCTTTCTTTCTGG - Intergenic
1006048740 6:31322771-31322793 GGTGATCTGGCCTTTCTCTCTGG - Intronic
1008082858 6:47211801-47211823 GGTGGTCTGGCCTTTCTTTCTGG - Intergenic
1008244073 6:49149380-49149402 GGTGAGCTGGCCTTTCTCTGTGG + Intergenic
1009208343 6:60832285-60832307 GGTGGTCTGGTCTCTCTTAGTGG - Intergenic
1011753320 6:90474948-90474970 TGTGTCCTGGCCTTTCCCAGGGG + Intergenic
1012869640 6:104658137-104658159 GGTGACCTGGCCTTTCTCTGTGG - Intergenic
1014201983 6:118618389-118618411 GGGGAACTGGCCTTTCAAAGTGG - Intronic
1014564212 6:122928965-122928987 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1014574106 6:123048693-123048715 CGTGATCCGGCCTTTCCTGAAGG + Exonic
1014824716 6:126036112-126036134 GGTGATCTTGCATGGCCTAGAGG + Intronic
1017408250 6:154142416-154142438 GGTGTTCTCGCCTTTTCTGGTGG - Intronic
1019770144 7:2878506-2878528 GGTGATCTGGCCTTTTTTTGTGG + Intergenic
1024056703 7:45664078-45664100 GGTGATCAGGCCTCCCCTGGGGG + Intronic
1025107928 7:56188155-56188177 GGTGATCTGGTCTTTCCATACGG - Intergenic
1025870288 7:65425000-65425022 GGTGACCTGGCCTTTCTTTTTGG - Intergenic
1026310317 7:69177925-69177947 GGTGATCTGGTCTTTCCATACGG + Intergenic
1027563315 7:79759865-79759887 GGTGACCTGGCCTTTCTTTCTGG - Intergenic
1030107202 7:105997092-105997114 GGTGATTTTGCCTTTCCTTGTGG - Intronic
1033641608 7:143267466-143267488 GGAGATCTGTCCTTGCCAAGAGG - Intronic
1034179257 7:149125425-149125447 AGTTTTCTGTCCTTTCCTAGAGG + Intronic
1035672436 8:1429858-1429880 GGTGATCTGGCCATTCATTGTGG + Intergenic
1038646454 8:29366028-29366050 GGTGGTCAGGACTTTCCTCGGGG + Intergenic
1039244701 8:35596031-35596053 GGTCTTCTGACCTTTCCTATGGG - Intronic
1039820684 8:41131522-41131544 GGTGACCTGGCCTTTCCCTCTGG - Intergenic
1041623833 8:60002243-60002265 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
1045977978 8:108150813-108150835 GGTGACCTGGCCTTTCTTTCTGG - Intergenic
1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG + Intergenic
1049267648 8:141677640-141677662 GCTGGTCTGGACTTCCCTAGAGG - Intergenic
1050240029 9:3625211-3625233 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1050309300 9:4336377-4336399 GGTGACCTGGCCTGGCCTGGTGG - Intronic
1051654977 9:19371243-19371265 GGTGAACTGTCCTTTGCTATTGG + Intronic
1052197582 9:25736267-25736289 AGTCATCTGGCCTTTCTTTGAGG + Intergenic
1053039230 9:34855672-34855694 GATGACCTGGCCTTTCCTTCTGG + Intergenic
1057806889 9:98225879-98225901 GCTGATCTGGCCATTGCCAGTGG - Intronic
1057886070 9:98830588-98830610 GGGGAGCTGGCCTTTGCCAGGGG + Intronic
1058114434 9:101069047-101069069 GATGATCTAGCCTTCCCTAGTGG + Intronic
1059364755 9:113777803-113777825 GGTAATCTGTCCATTCCTGGAGG + Intergenic
1061083698 9:128387034-128387056 GGTCACCTGTCCTTTCCTAGGGG - Intronic
1187137068 X:16558297-16558319 GGTGCTGTGGCCTTTCTTAGGGG - Intergenic
1191078727 X:56486196-56486218 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1191889191 X:65923740-65923762 GGTGATCTGGCCTTTCTCTCTGG + Intergenic
1193908997 X:87279430-87279452 GGTGACCTGGCCTTTCCCTCTGG + Intergenic
1194183269 X:90738999-90739021 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
1194330534 X:92579143-92579165 GGTGACCTGGCCTTTCTCATGGG + Intronic
1195567905 X:106363631-106363653 GGTCTCCTGGCCTCTCCTAGGGG - Intergenic
1195686144 X:107588150-107588172 GGTGACCTGGCCTTTCTTTCTGG + Intronic
1199365860 X:146981850-146981872 GGTTACCTGGCCTTTCCTTATGG + Intergenic
1199564268 X:149198058-149198080 GGTGACCTGGCCTTTCTTTATGG + Intergenic
1200529885 Y:4320954-4320976 GGTGATCTGGCCTTTCTCTCTGG - Intergenic
1200639238 Y:5698213-5698235 GGTGACCTGGCCTTTCTCATGGG + Intronic
1201739218 Y:17305468-17305490 GGTGACCTGGCCTTTCTTTCTGG - Intergenic