ID: 961389202

View in Genome Browser
Species Human (GRCh38)
Location 3:126542417-126542439
Sequence CCCCGGGGCCGCGGCGGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 5, 3: 92, 4: 787}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961389202_961389215 17 Left 961389202 3:126542417-126542439 CCTGGGCCGCCGCGGCCCCGGGG 0: 1
1: 0
2: 5
3: 92
4: 787
Right 961389215 3:126542457-126542479 ACCTGGCAGCGCGCCTCTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 52
961389202_961389209 0 Left 961389202 3:126542417-126542439 CCTGGGCCGCCGCGGCCCCGGGG 0: 1
1: 0
2: 5
3: 92
4: 787
Right 961389209 3:126542440-126542462 AGCCGCCGCCTCCCGCGACCTGG 0: 1
1: 0
2: 2
3: 29
4: 285
961389202_961389217 18 Left 961389202 3:126542417-126542439 CCTGGGCCGCCGCGGCCCCGGGG 0: 1
1: 0
2: 5
3: 92
4: 787
Right 961389217 3:126542458-126542480 CCTGGCAGCGCGCCTCTTCCGGG 0: 1
1: 0
2: 2
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961389202 Original CRISPR CCCCGGGGCCGCGGCGGCCC AGG (reversed) Exonic