ID: 961394595

View in Genome Browser
Species Human (GRCh38)
Location 3:126578272-126578294
Sequence AGCATGGGCGGCCCCACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961394595_961394601 0 Left 961394595 3:126578272-126578294 CCTGGTGTGGGGCCGCCCATGCT 0: 1
1: 0
2: 0
3: 9
4: 126
Right 961394601 3:126578295-126578317 TCTGGGATGTTTAGCATCCCTGG 0: 1
1: 1
2: 4
3: 27
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961394595 Original CRISPR AGCATGGGCGGCCCCACACC AGG (reversed) Intronic
902291814 1:15440360-15440382 AGGATGCCCGGCCCCACAGCTGG + Exonic
906044543 1:42817456-42817478 GGCAGGGGCGGAGCCACACCGGG + Intronic
907240320 1:53077539-53077561 GGCGTTGGTGGCCCCACACCTGG + Intronic
912383023 1:109257796-109257818 AGCCTGGGGGGCCCCACCCCAGG - Intronic
917450300 1:175142422-175142444 AGCATGTGCTGCTCCACAGCAGG + Intronic
921219933 1:212966176-212966198 AGCATGCCTGTCCCCACACCAGG - Intronic
923147349 1:231207505-231207527 AGCCTGGGCTGGGCCACACCTGG - Intronic
1069859482 10:71461486-71461508 AGCAGGGGCCTCCCCACAGCGGG + Intronic
1070819284 10:79345633-79345655 AGCATGAGCATCCCCACCCCAGG - Intergenic
1076106565 10:127827979-127828001 AGCAGGGGAGCCCCCACACTGGG - Intergenic
1076829006 10:132985046-132985068 AGGGCTGGCGGCCCCACACCAGG + Intergenic
1077047725 11:553761-553783 CGCATGGGCGGGCCCACCTCTGG - Intronic
1079025698 11:16946112-16946134 ATCATGGGTGGCGCCACAGCAGG - Intronic
1081911920 11:46705238-46705260 GGCATTTGCGGCTCCACACCGGG + Exonic
1083159804 11:60848050-60848072 AGCCTGGCTGGCCCCTCACCTGG - Exonic
1084578445 11:70006407-70006429 AGCCTGGGCGCGCCCACCCCAGG - Intergenic
1085112850 11:73903251-73903273 AGAATGGGCAACCCCAAACCTGG - Intronic
1085456809 11:76670245-76670267 GGGATGGGCAGCCCCACGCCTGG + Intronic
1089495031 11:118903411-118903433 AGCCATGGCGGCCCCACAGCTGG - Exonic
1089544442 11:119212344-119212366 AGCATGAGCCACCACACACCCGG - Intronic
1095699323 12:45174839-45174861 AGGTCGGGCGTCCCCACACCGGG - Intergenic
1102953912 12:117047299-117047321 AACATGGGCAGCCCCAGGCCTGG + Intronic
1103927261 12:124429828-124429850 AGAGGGGCCGGCCCCACACCCGG + Intronic
1110940319 13:81341061-81341083 GGCTTGGCCGGCCCCGCACCCGG - Intergenic
1112496204 13:99906850-99906872 AGGATGGGCAGCCCCACAGCGGG + Intergenic
1113034263 13:106031527-106031549 AGCCTGTGCGTCCCCCCACCCGG - Intergenic
1113361853 13:109639359-109639381 TGTATGGGCTGCCTCACACCTGG - Intergenic
1113927806 13:113951106-113951128 AGGCTGGGCCTCCCCACACCAGG - Intergenic
1122557942 14:102591811-102591833 GGCTTGGGCGTCCCCACGCCGGG + Intergenic
1122904388 14:104795281-104795303 AGGGAGGGCGGCCCCACGCCGGG - Intronic
1122957493 14:105077670-105077692 AGCATGGGTGGCCACAGGCCCGG + Intergenic
1122976294 14:105172225-105172247 AGCCTGGGCCGCCCAGCACCAGG - Intergenic
1123215786 14:106808163-106808185 ATTATGGGCTGCCCCACTCCTGG - Intergenic
1124636953 15:31371586-31371608 AGCATGGGCGGCTGGACTCCGGG + Intronic
1126552343 15:49946779-49946801 AGCAGGGGCTGCCCCAGACTGGG + Intronic
1128588020 15:68868161-68868183 AGCATGGCCTGTGCCACACCTGG + Intronic
1128733832 15:70039347-70039369 GGCATGGGCACCCCCACCCCAGG + Intergenic
1130690083 15:86074657-86074679 AGGATGGGCTGACCAACACCAGG - Intergenic
1132288960 15:100686059-100686081 AGGATGGGCGGCCACACCCAGGG + Intergenic
1132593219 16:735570-735592 ACCATGGGCTGCCCCAGGCCAGG + Intronic
1132613502 16:829113-829135 AGATGGGGCTGCCCCACACCCGG + Intergenic
1132770965 16:1563097-1563119 AGGATGGGCGGGCTGACACCCGG - Intronic
1132801838 16:1758458-1758480 AGCAGGGGAGGCCCCAGAGCTGG - Intronic
1133198944 16:4190552-4190574 AGCATGCACGGCTCCACAGCAGG - Exonic
1138496602 16:57412768-57412790 AGCATGGGCGTCCCTACAGTAGG - Intronic
1138619235 16:58198164-58198186 AGCCTGGGCGGCCCCAGGCCGGG - Intergenic
1141537385 16:84691877-84691899 AGCATGGCCGTGCCAACACCTGG + Intergenic
1142147703 16:88499464-88499486 AGCTGGGCCGGCCCCACCCCAGG - Intronic
1143255940 17:5558128-5558150 AGCAGGGCCTGCCCCACAGCCGG + Intronic
1143628807 17:8125548-8125570 GCCAGGGGCGGCCCCACACCCGG - Intergenic
1144756614 17:17683392-17683414 AGCGAGGGCTGCCCCCCACCTGG - Intronic
1151866416 17:76806212-76806234 GGCACGGGCGGCCCCGCACTCGG + Intergenic
1152571355 17:81122632-81122654 AGCATGGGCCCCGCCGCACCGGG + Exonic
1152822665 17:82445210-82445232 TGCATGGGCGGCCGGACCCCGGG + Intronic
1154935113 18:21046947-21046969 AGCATGGGGGCCACCACACCCGG + Intronic
1160189275 18:76701684-76701706 AGCATGGGAATCCCCACTCCAGG + Intergenic
1160214273 18:76913794-76913816 AGCATGTGCGGTCGCACACCGGG + Exonic
1160903392 19:1440404-1440426 AGCATGGCCGGCCCGGCATCGGG + Exonic
1161339260 19:3731835-3731857 AGGATGGGAGGGCCCGCACCTGG + Intronic
1161532223 19:4796752-4796774 AGCATGCGGTGCCCCACAGCAGG - Exonic
1162030997 19:7917202-7917224 AGCATGTGAGGCCCAGCACCAGG - Intronic
1162728069 19:12701690-12701712 GGCTCGGGCGGCCCCTCACCTGG - Intronic
1163698303 19:18774983-18775005 AGCCTGGGCGCCCGCTCACCTGG - Exonic
1164207630 19:23071233-23071255 AGCCGGGGCAGCCCCACACTCGG + Intergenic
1164627935 19:29741667-29741689 AGGCTGGGAGGCCCCAGACCAGG - Intergenic
1165383857 19:35498982-35499004 AGCAAGGGCAGGCTCACACCAGG + Intronic
1165744524 19:38222780-38222802 AGCCTGGGCGGCCCGGCAGCCGG - Intronic
1167638315 19:50667581-50667603 AGCAGGAGGGGCCCCACCCCGGG + Exonic
934087243 2:88520120-88520142 AGCATGCTCAGCCCCTCACCAGG - Intergenic
936547772 2:113407383-113407405 AGCATCAGCAGCCCCAAACCTGG - Intergenic
942381644 2:175397945-175397967 AGCATGGCTGGCTCCACAGCTGG + Intergenic
944205597 2:197154781-197154803 GGCATGGGAGGCTCCACACAAGG - Intronic
945081007 2:206085875-206085897 AGCAGAGGCGGCCCCAGGCCCGG - Intronic
947808065 2:232982136-232982158 GGCATGGGCAGCCCCATGCCTGG + Intronic
1172941094 20:38655269-38655291 AGCAGGGGCGGACTCTCACCTGG + Intergenic
1172993059 20:39050138-39050160 AGCAAGGTCGGACCCCCACCGGG + Intergenic
1173470695 20:43321177-43321199 TGCAGGGGCTGCCCCAGACCGGG + Intergenic
1174584805 20:51600109-51600131 AGCTTGGGCGTCCTCCCACCAGG + Exonic
1175597030 20:60243473-60243495 AGCATGGCCCTGCCCACACCTGG - Intergenic
1176248586 20:64109397-64109419 AGCGTGGCCAGCCCCACCCCAGG - Intergenic
1178881681 21:36455005-36455027 AGAATGGGTGGCTCCTCACCTGG - Intergenic
1181028103 22:20137234-20137256 AGCCTGGACTCCCCCACACCAGG - Intronic
1181269842 22:21652586-21652608 AAAAAGGGCGGCCCCACCCCGGG - Intronic
1182114761 22:27749807-27749829 AGCCTGGGCAACCCCACCCCTGG - Exonic
1183416661 22:37686529-37686551 AGCGTGCTCGGCCCCAGACCTGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184878628 22:47291194-47291216 AGCAAGGGCGGCCTCATTCCAGG - Intergenic
1185340183 22:50287600-50287622 AGCATGGGGGAGCCCCCACCTGG + Intronic
1185366325 22:50438595-50438617 AGCATGGGGGGCTCCAAACCTGG - Exonic
954108395 3:48421184-48421206 AGCAGGGGCTGGCCCCCACCAGG + Intronic
954567908 3:51614441-51614463 AACATGAGCCACCCCACACCTGG + Intronic
959686059 3:109147965-109147987 TGCATGGGGGCCTCCACACCTGG - Intergenic
961394595 3:126578272-126578294 AGCATGGGCGGCCCCACACCAGG - Intronic
962509449 3:136084190-136084212 AGCAGGGGGGGCCCCAGGCCTGG - Intronic
971943960 4:33250616-33250638 AGCATGGGCCATCCCACTCCTGG - Intergenic
974800543 4:66812115-66812137 AGGTTGAGCAGCCCCACACCGGG + Intergenic
974952918 4:68603746-68603768 AGCATGGGGGGCCCTAGGCCTGG - Intronic
976882028 4:89938432-89938454 AGCATGTGTGACCACACACCAGG + Intronic
986065303 5:4229198-4229220 GGGATGGGTGGCCACACACCAGG + Intergenic
986102440 5:4626488-4626510 ACCCTACGCGGCCCCACACCTGG - Intergenic
989765411 5:45076818-45076840 AGCATGGGCTGCTTCTCACCAGG - Intergenic
991599610 5:68339589-68339611 AGCACAGGCAGCCCCTCACCAGG - Intergenic
999951581 5:156657481-156657503 GGCATGAGCCACCCCACACCTGG - Intronic
1000627378 5:163554526-163554548 ATCATGTGCGCCACCACACCTGG + Intergenic
1001683752 5:173577371-173577393 AGCATGGGCAGGCCCTCACAGGG - Intergenic
1003306769 6:4936008-4936030 GGCCTGGGTGGACCCACACCCGG - Intronic
1012419856 6:99052794-99052816 TCCATGGGAGGCCCCACACCTGG - Intergenic
1017708990 6:157148857-157148879 GGCATTGGCGGCCCCATTCCTGG - Exonic
1019381522 7:726744-726766 GGCCGTGGCGGCCCCACACCCGG + Exonic
1020188503 7:5976395-5976417 AGCAGGGCGGGCCCCACATCAGG + Intronic
1020294412 7:6748375-6748397 AGCAGGGCGGGCCCCACATCAGG - Intergenic
1022643148 7:32206740-32206762 AGCATGGCAGTGCCCACACCCGG + Intronic
1026427673 7:70312651-70312673 GGAAAGGGTGGCCCCACACCAGG + Intronic
1029611287 7:101627857-101627879 AGCATGGGTGGCCCCACCCTGGG - Intronic
1031625166 7:123984398-123984420 AGCATGGTAGTCCCCAAACCTGG + Intergenic
1034462412 7:151205161-151205183 TCCGTGGGCTGCCCCACACCTGG - Intronic
1035162660 7:156962458-156962480 AACATGGGCTTCCCCACACACGG - Intronic
1038414486 8:27384137-27384159 ACCATGACCGGCCCAACACCTGG + Intronic
1042363985 8:67915333-67915355 TGAATGGGCAGCCCCAGACCAGG - Intergenic
1043621052 8:82192540-82192562 GGGCTGGGCGGCCCCACACTCGG - Intergenic
1046497753 8:115036779-115036801 GGCTTGGCCGGCCCCACACTGGG + Intergenic
1049157901 8:141078135-141078157 AGCATGGCCCTGCCCACACCTGG - Intergenic
1049437203 8:142592222-142592244 CTCCTGGGCGTCCCCACACCTGG - Intergenic
1050294889 9:4195368-4195390 GGCTTGGCCGGCCCCACACTCGG + Intronic
1052865900 9:33464446-33464468 ACCATGGGCTTCCACACACCTGG + Intronic
1057035949 9:91811685-91811707 GCCAGGGGCAGCCCCACACCTGG + Intronic
1057174836 9:92988492-92988514 AGCAGGGGCCCCGCCACACCAGG - Intronic
1059175824 9:112169509-112169531 AGCAGTGGGGCCCCCACACCTGG + Intronic
1059324070 9:113492863-113492885 AGCATGGGAGGCCCCTTAGCAGG + Intronic
1062262523 9:135670090-135670112 ACCATGGGCACCCCCAGACCAGG + Intergenic
1062446313 9:136596866-136596888 AGGATGGGCGGCCCCAGAGAGGG - Intergenic
1188743903 X:33817873-33817895 TGCATGGGCTGCCACACACTGGG - Intergenic
1192848033 X:74925636-74925658 AGCAGAGGCGGCCCCACTCTGGG - Intergenic
1195106640 X:101609349-101609371 AGCCTGGGCAGCTCCACACATGG + Intergenic
1200251371 X:154556047-154556069 AGGATGGGTGGCCCCACTTCTGG + Intronic
1201423067 Y:13820495-13820517 GGCTTGGCGGGCCCCACACCCGG - Intergenic