ID: 961395202

View in Genome Browser
Species Human (GRCh38)
Location 3:126582186-126582208
Sequence CTTACAACATAGATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961395202 Original CRISPR CTTACAACATAGATGGAAAA TGG Intronic
904367762 1:30026700-30026722 CCAACAACATAGATGAAAAATGG + Intergenic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
909872534 1:80761005-80761027 CTAACAACACTGAAGGAAAAAGG - Intergenic
912593227 1:110848709-110848731 CATCCAAGAGAGATGGAAAAGGG - Intergenic
914329300 1:146651035-146651057 GATACAAAATAGATGTAAAATGG + Intergenic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
914914169 1:151808110-151808132 CTTACTACATTGCAGGAAAATGG + Intronic
915696412 1:157747255-157747277 CTCACTACATAGAAGGAAATTGG + Intronic
916354771 1:163892468-163892490 CTTGCAACATACATGGGTAAAGG - Intergenic
916834481 1:168529563-168529585 CTAACAACCTAGTGGGAAAATGG + Intergenic
917767577 1:178239128-178239150 CTAAAAACATAGATAGAATAGGG - Intronic
918608376 1:186457535-186457557 ATTACAACATAAATGCAAAAGGG - Intronic
919504915 1:198386579-198386601 TGAACAACATAGATGGAAATGGG - Intergenic
919973697 1:202597289-202597311 CTTACAACATGAATTGATAAAGG + Intronic
921109797 1:212024111-212024133 CTTACAAAATAGTTTGAAATTGG + Intronic
921367468 1:214387192-214387214 ATTAGAACATAGATAGTAAATGG - Intronic
921899827 1:220438366-220438388 CTTACATCTTAGATGTCAAAAGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
924796756 1:247298141-247298163 GTATCAACATAGCTGGAAAAGGG - Exonic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063469352 10:6272110-6272132 CATACAACATACATGCACAATGG - Intergenic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1065277599 10:24100683-24100705 CTTGCAAAATAGTTTGAAAAGGG - Intronic
1066747257 10:38613080-38613102 CTTACAAGCTAGATGGAATTGGG + Intergenic
1067231703 10:44416736-44416758 TTTACAACATAGCTTAAAAAGGG - Intergenic
1067487187 10:46661754-46661776 ATTACAAAATAGCTGGAAGAGGG - Intergenic
1067607618 10:47680253-47680275 ATTACAAAATAGCTGGAAGAGGG + Intergenic
1067812795 10:49443168-49443190 TTTACAACACAAATGGCAAAAGG - Intergenic
1068099280 10:52531862-52531884 ATTACAACATAGTCAGAAAATGG + Intergenic
1068991274 10:63153564-63153586 CATCCAAGAGAGATGGAAAAGGG + Exonic
1069322743 10:67193186-67193208 TGTACAACATAGATGGTAATTGG + Intronic
1070941547 10:80352923-80352945 CTCACAACATACCTGAAAAATGG + Intronic
1070941663 10:80353760-80353782 CTCACAACATACCTGAAAAATGG - Intronic
1071405970 10:85333061-85333083 CTCACAAGATCGATGGAAAATGG + Intergenic
1071446406 10:85752461-85752483 ATTACAAAATAGATATAAAATGG + Intronic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1071623175 10:87141618-87141640 ATTACAAAATAGCTGGAAGAGGG + Intronic
1073530314 10:104224914-104224936 CTTATATCATGGATAGAAAAGGG + Intronic
1073786500 10:106896017-106896039 GTTAGAACATAGATGGAACTTGG + Intronic
1073794708 10:106975033-106975055 CTTACAACACAGAAGGCCAAAGG + Intronic
1073802794 10:107061264-107061286 CTTACAACATGAAAGGTAAAAGG + Intronic
1074058798 10:109946082-109946104 CTTATAACATATATGGCACATGG - Intronic
1074215831 10:111382753-111382775 CATTGAACATAGCTGGAAAAGGG + Intergenic
1074221217 10:111440162-111440184 CTTAGAACAGGGATGGCAAATGG - Intergenic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1080499544 11:32856504-32856526 CTTACAACAGGAATAGAAAATGG - Exonic
1081060878 11:38475084-38475106 ATGTCAACATAGATGTAAAATGG - Intergenic
1081288070 11:41296800-41296822 CTTAAAACATTGATATAAAAAGG + Intronic
1081429732 11:42963271-42963293 CTTACAAGACAGAGAGAAAATGG + Intergenic
1081619577 11:44611395-44611417 CCTACCACATTGATGGAAAGAGG + Intronic
1082960363 11:58913619-58913641 CTGACACCATAGAGGGAGAAGGG + Intronic
1083116858 11:60468899-60468921 CTTAAAACAATGATGCAAAAGGG - Exonic
1084612606 11:70212999-70213021 CTTACAACATTGCTGGGAGAGGG - Intergenic
1086472122 11:87125248-87125270 CTTACATAATAGAGGGAAAGTGG + Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1090456433 11:126854008-126854030 CTTACAGCATTCAGGGAAAAGGG + Intronic
1090619964 11:128551658-128551680 CTGAGAAAATACATGGAAAAGGG - Intronic
1093015258 12:14148712-14148734 ATTACAAATCAGATGGAAAAAGG + Intergenic
1094042034 12:26128261-26128283 TTTGCAAGAGAGATGGAAAAGGG + Intronic
1094444132 12:30511019-30511041 CTATCAACATTCATGGAAAAAGG + Intergenic
1096759255 12:53826217-53826239 CTTACAAGATGTCTGGAAAAGGG - Intergenic
1096971398 12:55669180-55669202 CTTAAAACCTAGATCTAAAAGGG - Intergenic
1097040064 12:56150940-56150962 CTTACTTCATTGATGTAAAATGG + Intergenic
1097474063 12:60032438-60032460 TTTTCAGCATATATGGAAAAAGG - Intergenic
1097595111 12:61620027-61620049 GTTACTACATAGCTGCAAAATGG - Intergenic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099007673 12:77253678-77253700 GTTGCAACATGGATGGAAATGGG + Intergenic
1100249646 12:92805029-92805051 ATTAGAACATAGAATGAAAATGG + Intronic
1100938624 12:99699963-99699985 CTTACAAAATAGACTGAGAAAGG - Intronic
1101656795 12:106729356-106729378 CTTAGAACATAGCAGCAAAAGGG + Intronic
1103314836 12:120044457-120044479 CTTAGAACAGGGATGGAAATGGG - Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1108247037 13:48527504-48527526 CTTGCAATATAAATAGAAAATGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109183614 13:59244157-59244179 CTTACACTATTGAGGGAAAAAGG - Intergenic
1109492628 13:63122671-63122693 CTTAGAACACACATAGAAAATGG - Intergenic
1109555997 13:63976419-63976441 CTTCCAACTTAGTTGGAACATGG - Intergenic
1110024798 13:70523003-70523025 CTTCAAAAATACATGGAAAATGG + Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1111865587 13:93764179-93764201 CTTACAAAATACATAGCAAAGGG - Intronic
1112559166 13:100496642-100496664 TTTACCAGATAAATGGAAAAAGG - Intronic
1113119939 13:106915447-106915469 CTTACAATGTGGAGGGAAAAAGG + Intergenic
1113307059 13:109090339-109090361 TTTACAAGAAAGATGGAAAGGGG - Intronic
1115544792 14:34455945-34455967 CTTACAACTTAGAATTAAAAAGG - Intronic
1116069365 14:40024550-40024572 TTTATAATAAAGATGGAAAAGGG - Intergenic
1116149690 14:41125092-41125114 CTTAAAACATATATTTAAAATGG - Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1120023008 14:79551510-79551532 CTTAAAAGAGAGATGGAAAGAGG - Intronic
1120073446 14:80128839-80128861 GTAACAACATAGATGGAACTGGG - Intergenic
1120377819 14:83731788-83731810 GTTACTACATAGATGTAACATGG - Intergenic
1130651313 15:85763666-85763688 CTTACAGGATGGATGGAAAGGGG + Intronic
1131390726 15:92046031-92046053 CTTATAACCCAGTTGGAAAATGG - Intronic
1132777544 16:1604086-1604108 CCTATAACATATATGGTAAATGG - Intronic
1133909728 16:10054351-10054373 CTTATATGATAGATGTAAAACGG - Intronic
1134241078 16:12507421-12507443 ATTCCAACATGTATGGAAAACGG - Intronic
1136644619 16:31600476-31600498 GTATCAACATAGAAGGAAAAAGG - Intergenic
1137675591 16:50302244-50302266 CTGACAACAGACAAGGAAAATGG - Intronic
1140004264 16:71059899-71059921 GATACAAAATAGATGTAAAATGG - Intronic
1140067610 16:71625094-71625116 CTTACAACATAGGTGTTATAAGG + Intergenic
1140321781 16:73959578-73959600 CTTAGAACATAGAGAGAAACTGG + Intergenic
1143032360 17:3974753-3974775 GTAACAACAGACATGGAAAAGGG - Intergenic
1149118935 17:53137394-53137416 CTAATAACTTAGATAGAAAAGGG + Intergenic
1149664145 17:58354072-58354094 CTTAGAGCAAGGATGGAAAATGG - Exonic
1152240555 17:79158697-79158719 ATTAAAACATAAATGAAAAAGGG + Intronic
1152499052 17:80695964-80695986 GTTACATCTTAGATGGAAATTGG + Intronic
1154489516 18:14908947-14908969 CTGCCACCATAGATGGACAATGG + Intergenic
1157851036 18:51051063-51051085 CCAAAAACATGGATGGAAAATGG - Intronic
1158739789 18:60127149-60127171 CATTCAAAATAGATTGAAAATGG - Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159159896 18:64630542-64630564 CTTAAAACATATATGAACAAAGG + Intergenic
1160109640 18:76014046-76014068 CTCAAAACAGAGATGGAAACTGG + Intergenic
1160605375 18:80045934-80045956 CTGACAACGCAGATGAAAAAGGG + Exonic
1161537224 19:4827420-4827442 CTTACAACAGAGATAGAAGCTGG - Intronic
1164585821 19:29475255-29475277 GTTAAAAGATAGATGGATAATGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165833157 19:38739148-38739170 CAAACAAAATAGATGGAAAGAGG + Intronic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
928652549 2:33418237-33418259 CTTAGAATAGACATGGAAAAAGG + Intergenic
928766111 2:34647707-34647729 CTTACAACATGTGTGGAAAATGG - Intergenic
929350357 2:40943623-40943645 CTGACAACTTAGATAGTAAAAGG + Intergenic
930521785 2:52476723-52476745 CTTCCAAAATAGATGGTAGATGG + Intergenic
934177576 2:89590167-89590189 CTTACAAGCTAGATGGAATTGGG - Intergenic
934310015 2:91853497-91853519 CTTACAAGCTAGATGGAATTGGG + Intergenic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
935623389 2:105147751-105147773 CTTACAAAATGGATGGATAATGG + Intergenic
936493653 2:112998326-112998348 TTTACACCATAGAAAGAAAATGG - Intergenic
937164318 2:119796759-119796781 GTTACAACAATGCTGGAAAACGG - Intronic
939400452 2:141685636-141685658 CTTACAACAGGGATGTAGAAAGG + Intronic
939428319 2:142070212-142070234 CTTATAAGAGAGAAGGAAAAGGG + Intronic
941665434 2:168240070-168240092 TTTGCTACATAGATGAAAAATGG + Intronic
942360862 2:175170061-175170083 GTGAGAACAAAGATGGAAAAGGG - Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943257324 2:185612406-185612428 AGTAAAATATAGATGGAAAATGG - Intergenic
943829560 2:192442669-192442691 ATTATTACAGAGATGGAAAAGGG - Intergenic
945841255 2:214890423-214890445 CATATAACATAGATGGCGAAAGG - Intergenic
945899832 2:215525227-215525249 CTTATAACAAAGAGGGAAGAGGG + Intergenic
946140408 2:217685621-217685643 CCAACAAAATAAATGGAAAAAGG - Intronic
946955072 2:224920901-224920923 TTTACTACATAGATGGAACAGGG - Intronic
947673241 2:231955265-231955287 GTTACAACAGATATGAAAAATGG - Intergenic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1170044913 20:12074822-12074844 CTTACAAATAAGATGAAAAAGGG + Intergenic
1170771192 20:19333903-19333925 CTTTCACCATAAATGGAAACAGG - Intronic
1172560909 20:35887754-35887776 CTTACAACATAGGTTGGCAATGG + Intronic
1172831057 20:37835014-37835036 TTTGCAACATATTTGGAAAAGGG + Intronic
1173466327 20:43284829-43284851 CTTACTAGAAACATGGAAAAGGG + Intergenic
1177677272 21:24316886-24316908 CTTACAGCATAGGAGAAAAAAGG + Intergenic
1177927027 21:27230282-27230304 AGTACAACATAGAAGGAAAGTGG - Intergenic
1178400320 21:32279605-32279627 CTTACAAAAAAGAAGAAAAAGGG - Intergenic
1178563597 21:33662305-33662327 CCTAGAAAATAGATGGAAAGAGG - Intronic
1183696241 22:39424800-39424822 CTTATAACATAGAGGGACAGGGG + Intronic
950894594 3:16437306-16437328 CTTTCAAGATATATGGACAAAGG - Intronic
951621718 3:24609091-24609113 CTTCCAAAAGATATGGAAAATGG + Intergenic
953801148 3:46023505-46023527 CATCCAAGAGAGATGGAAAAGGG + Intronic
954299268 3:49690759-49690781 CTTACAACTGAGATGGATACAGG + Intronic
954401893 3:50323409-50323431 CTTACAACATGGATGAGGAAAGG + Intronic
954782369 3:53071199-53071221 CTTAAAACAAGGAAGGAAAAGGG + Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
958056069 3:88413842-88413864 CTTGCAACCTACATGAAAAATGG + Intergenic
959331245 3:105008200-105008222 CTTACAAAATAGTTTGAAATTGG - Intergenic
960726886 3:120679409-120679431 CATAGAACATAGATTGTAAAGGG + Intronic
960751013 3:120953099-120953121 CTTAGAAACTATATGGAAAATGG - Intronic
960930879 3:122848268-122848290 CTTACAACAAAGATGAATAGAGG - Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
961804110 3:129476489-129476511 CTTACCACATAGTTGGAATCCGG - Exonic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
966014168 3:175121019-175121041 CTTAAAAGGTAGATGCAAAAAGG - Intronic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
966527195 3:180932049-180932071 CTTACAAAGTAAATGGAAGAAGG - Intronic
966714432 3:183001113-183001135 CTTAAAACATGGAGGGACAAAGG + Intergenic
967697755 3:192553327-192553349 AATACCACAAAGATGGAAAAGGG + Intronic
969938635 4:10707853-10707875 CTCACAACATAGAGGTAAAGAGG + Intergenic
971080020 4:23199008-23199030 CTTACTACATAGAAAGAAGAGGG + Intergenic
971908131 4:32755863-32755885 CTTAAAAGATAGAGGCAAAATGG + Intergenic
973333867 4:48936471-48936493 CTTACAACATACAAGCAACACGG - Intergenic
973997038 4:56468462-56468484 CTTACTACATACCTGGAATATGG + Intronic
974555343 4:63439650-63439672 CCTACAGCATAGATGCACAAGGG - Intergenic
974638664 4:64600002-64600024 CTTCCCAAATAGAGGGAAAAAGG + Intergenic
974779835 4:66540379-66540401 CATACTACATTGATGGAAGATGG - Intergenic
976175179 4:82344537-82344559 GTTACAACATTTTTGGAAAATGG - Intergenic
976555188 4:86442871-86442893 CTTACATGCTGGATGGAAAATGG - Intronic
977013696 4:91665045-91665067 CTTACAACTCAAATGTAAAAAGG - Intergenic
978071888 4:104483028-104483050 CTTCCAAGATGGGTGGAAAATGG - Intronic
978881539 4:113709132-113709154 CTTAAAAACTAAATGGAAAAAGG - Intronic
978907176 4:114019925-114019947 CTTAACACATAAATAGAAAAAGG + Intergenic
980807181 4:137828751-137828773 CATAGAAAATAAATGGAAAATGG + Intergenic
981361627 4:143852488-143852510 AGTACAACATCTATGGAAAACGG - Intergenic
982087858 4:151854479-151854501 ATAACAACATAGATGGAGACAGG - Intergenic
983910554 4:173234198-173234220 CTTACATGATGGATGGAAGAGGG - Intronic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988073157 5:26321074-26321096 TTTACAACATAGCTGGTGAAAGG - Intergenic
988735749 5:34019305-34019327 TTCACAACAGAGATGGGAAAAGG - Intronic
990089000 5:52017531-52017553 CTTAATACATATATTGAAAAGGG + Intronic
990147105 5:52774622-52774644 CTTACAAAATAGAGGAAATAAGG - Intergenic
992541056 5:77764087-77764109 CTATCAACATAGGTGAAAAATGG + Intronic
992799826 5:80286081-80286103 CCAAGAACATACATGGAAAAAGG + Intergenic
992920452 5:81511256-81511278 ATTACAGCATAGAAAGAAAATGG - Intronic
993194720 5:84726843-84726865 CTTAGAAGAGATATGGAAAATGG - Intergenic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
994089255 5:95794500-95794522 CTTGTTACATAGAGGGAAAATGG + Exonic
995402713 5:111759814-111759836 CCTACAGGATAGATGGAAGAGGG - Intronic
995716931 5:115089516-115089538 CTTGCAATATATATGGCAAAGGG + Intergenic
996977704 5:129455155-129455177 CTTAAAAGATAGCTGCAAAATGG - Intergenic
997853014 5:137349474-137349496 CTTACAGCATAGATGGTATAGGG + Intronic
999058537 5:148608536-148608558 GATACAATATAGATGGAACAGGG + Intronic
1003430658 6:6034256-6034278 ATTACAAAATAACTGGAAAATGG + Intergenic
1004844052 6:19619091-19619113 CTTATAACAAAGATGCAAGAAGG + Intergenic
1005656047 6:27938439-27938461 CTAACAACATATATAGAAGATGG - Intergenic
1006150109 6:31982549-31982571 CTTACAAGACAGATGGGAACAGG - Intronic
1006156410 6:32015287-32015309 CTTACAAGACAGATGGGAACAGG - Intronic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007145350 6:39624211-39624233 CTTACCATTTAGTTGGAAAATGG - Intronic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1007459434 6:42007232-42007254 TTTACAACAAAAATGTAAAAAGG + Intronic
1008474843 6:51925194-51925216 CTCACAACCTAGCAGGAAAATGG + Intronic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1009466796 6:63980898-63980920 CTAACAACATAGATAGGAAGTGG + Intronic
1010012519 6:71065748-71065770 CTTAAAAAATACATGGAAATTGG - Intergenic
1010222007 6:73456107-73456129 CTTGCAACATAGATGAACATTGG - Intergenic
1012563459 6:100616693-100616715 CTTAAAACATTCATGGCAAAAGG + Intronic
1012698592 6:102422137-102422159 CTTATAACATAGTTTGAATATGG - Intergenic
1012857803 6:104523735-104523757 CTTACTACCTGGATGGTAAATGG - Intergenic
1014368529 6:120576006-120576028 GTAATGACATAGATGGAAAAGGG - Intergenic
1014786620 6:125626725-125626747 CTTAAAACATTGAGGGGAAACGG + Intergenic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1017428502 6:154346954-154346976 CTAATAATATAGATTGAAAAGGG - Intronic
1017450831 6:154553025-154553047 CCCACAACATGCATGGAAAATGG + Intergenic
1021507276 7:21399528-21399550 TATACAAAATAGATGAAAAAGGG - Intergenic
1022159773 7:27697937-27697959 ATAATAACATAGAAGGAAAAGGG - Intergenic
1023078636 7:36507208-36507230 CTCACAACAGTGCTGGAAAATGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG + Intergenic
1032754574 7:134876655-134876677 CTTCCAAAATTGATAGAAAATGG - Intronic
1033595981 7:142857973-142857995 TTTGAAACATAGAAGGAAAATGG + Intronic
1033787174 7:144746712-144746734 CCTACAACTTAGATAGTAAAAGG - Intronic
1034832710 7:154323581-154323603 CTTACCCCAGAGATGGCAAATGG - Intronic
1035815564 8:2536267-2536289 CTTAAAATATAGATCGAAAGGGG - Intergenic
1037069609 8:14627553-14627575 ATTACCACATAGTAGGAAAATGG - Intronic
1039186571 8:34923820-34923842 CTTCCAACATATATGGAAATGGG - Intergenic
1040056354 8:43061038-43061060 CTTAAATCATGGGTGGAAAATGG - Intronic
1041625348 8:60019640-60019662 CTAACCACAGAGATGGAATAAGG - Intergenic
1044130310 8:88515087-88515109 TTAACACCAAAGATGGAAAAGGG + Intergenic
1044304958 8:90628373-90628395 CTGACAATAAAGATGGAAACAGG + Intronic
1045132693 8:99174414-99174436 CCTGCAACAGTGATGGAAAAAGG + Intronic
1045962401 8:107983325-107983347 CATCCAAGAGAGATGGAAAAGGG + Intronic
1046134407 8:110008300-110008322 CTTAAAACAAAAAAGGAAAATGG - Intergenic
1046139818 8:110076604-110076626 TTGAAAACATAGAAGGAAAATGG - Intergenic
1046751207 8:117928862-117928884 CTTACGACACCGATGAAAAAGGG + Intronic
1046858840 8:119067542-119067564 TTTCCAAAATAGAAGGAAAATGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048112469 8:131483859-131483881 CCTAAAACATAGCTGAAAAATGG - Intergenic
1048250213 8:132859550-132859572 CTATCAACATCTATGGAAAAGGG - Intergenic
1049283028 8:141760218-141760240 CAAACAACATAGGTGGCAAAAGG + Intergenic
1050290729 9:4151663-4151685 CTTAGAACAAAGATGAAGAAAGG - Intronic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1052214161 9:25945055-25945077 CTAACAACATGGATGGAACTGGG - Intergenic
1052656294 9:31365938-31365960 CATATAACATAGCTAGAAAAAGG - Intergenic
1052721114 9:32172012-32172034 CTTACAAAATAGATGGAAGGCGG + Intergenic
1054444275 9:65297651-65297673 CTGTCAGCATACATGGAAAAAGG - Intergenic
1054485997 9:65723854-65723876 CTGTCAGCATACATGGAAAAAGG + Intronic
1055274099 9:74594848-74594870 CTTACAGGATAGATGAAAATTGG - Intronic
1056318026 9:85410138-85410160 CCAACAAGATAGATGGACAAAGG + Intergenic
1058243245 9:102593958-102593980 CTTGCAACATATTTTGAAAAAGG + Intergenic
1203399208 Un_KI270519v1:67409-67431 TTTTCACCATAGGTGGAAAAGGG - Intergenic
1185776678 X:2808921-2808943 TTTACACCACAGAGGGAAAAAGG - Intronic
1185988566 X:4866267-4866289 TTTACAAGAAAGAAGGAAAATGG + Intergenic
1186956906 X:14692718-14692740 CCTAGACCAAAGATGGAAAATGG + Intronic
1187415055 X:19086240-19086262 CTTACATCATTGAAGGGAAAGGG + Intronic
1187508944 X:19900326-19900348 CTCAGAAAATAGAAGGAAAACGG - Intergenic
1190830894 X:54058316-54058338 TTTACAACATACATGACAAAGGG + Intergenic
1190852025 X:54254159-54254181 CGTACAATATATGTGGAAAATGG + Intronic
1192187947 X:68966723-68966745 CTAACATCATAAATGAAAAAGGG - Intergenic
1192422147 X:71043288-71043310 CTTGTAACATTGATGGTAAAGGG + Intergenic
1195051955 X:101105221-101105243 CTTAAAACATATATGGAGTAGGG + Intronic
1197454857 X:126666413-126666435 CTTATGACATAGATTGAAATGGG - Intergenic
1197813725 X:130475180-130475202 CTTATCACATCGATGGAAACAGG - Intergenic
1197992505 X:132333133-132333155 CCAACAAGATAGAAGGAAAATGG - Intergenic
1199434841 X:147801851-147801873 CATAGAACATATCTGGAAAAGGG + Intergenic
1199855281 X:151754396-151754418 CTTACAAAAGAGAGAGAAAAGGG - Intergenic
1202247283 Y:22833081-22833103 ATTACCACATATATGGAAATGGG + Intergenic
1202400272 Y:24466829-24466851 ATTACCACATATATGGAAATGGG + Intergenic
1202470509 Y:25203257-25203279 ATTACCACATATATGGAAATGGG - Intergenic