ID: 961397762

View in Genome Browser
Species Human (GRCh38)
Location 3:126608981-126609003
Sequence TCTAGGGCAGCAGGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961397759_961397762 -7 Left 961397759 3:126608965-126608987 CCAACATTGGAATAACTCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 961397762 3:126608981-126609003 TCTAGGGCAGCAGGTTTTACTGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961397762 Original CRISPR TCTAGGGCAGCAGGTTTTAC TGG Intronic
900805563 1:4765373-4765395 TCAGGGGCAGCAGGGTTTATGGG + Intronic
902224677 1:14989064-14989086 TCTGGGACAGCAGGCTTTCCTGG + Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
906450879 1:45946396-45946418 TCCAGGGCAGAAGATTGTACTGG + Intronic
909691255 1:78410011-78410033 TGTAGGGCAGCTGGCTTTGCTGG - Intronic
913541554 1:119825994-119826016 TCCAGGGTAGCTGGTATTACAGG - Intergenic
917926890 1:179796874-179796896 TCTAGGACAGCAGGCTTACCTGG + Intronic
919048872 1:192487789-192487811 TCTTGAGTAGCTGGTTTTACAGG + Intergenic
919984480 1:202663275-202663297 TCTGGGATAGCAGGTTTTATCGG + Intronic
920283136 1:204859099-204859121 TCTTGGGTAGCTGGTATTACAGG + Intronic
923365793 1:233259200-233259222 TCTGTGGCAACTGGTTTTACAGG + Exonic
923596619 1:235365251-235365273 TCTTGAGTAGCTGGTTTTACAGG + Intergenic
1062853029 10:759936-759958 TCTAGGCCCGCAGGTGGTACAGG - Intergenic
1063451687 10:6154367-6154389 TCCAGGGCAGCTGGGATTACAGG + Intronic
1068746696 10:60540133-60540155 CCTAGGGCAGAATGTTTTATTGG - Intronic
1071864924 10:89718385-89718407 TCCAGGGTAGCAGGGATTACAGG - Intronic
1076406298 10:130214432-130214454 GCTAGGGCAGGAGGTCTCACTGG + Intergenic
1078284748 11:9940756-9940778 TCTTGGGCTGCAGGTTTAAGAGG - Intronic
1078457396 11:11485892-11485914 CATAGGGCAGCAACTTTTACTGG - Intronic
1079973486 11:27064277-27064299 TCTAAGGCAGCTGTTTTGACAGG - Intronic
1080460821 11:32453361-32453383 TCGATGGAAGCAGGTCTTACTGG - Intergenic
1081153045 11:39655781-39655803 TCTAGGACACCATGTTTTCCAGG - Intergenic
1081440784 11:43078432-43078454 TCTAGGTCAGCAGGATTTGGGGG + Intergenic
1086742805 11:90388449-90388471 TCTAGGGCAGGATTGTTTACAGG - Intergenic
1087147450 11:94826167-94826189 TCCAGGGCAGCTGGAATTACAGG - Intronic
1089527289 11:119105889-119105911 TTTAGGGGAGCAGGTTATGCAGG - Intronic
1089629060 11:119772468-119772490 TAGTGGGCAGCAAGTTTTACTGG + Intergenic
1092250492 12:6892580-6892602 TCCAGGGTAGCTGGTATTACAGG - Intronic
1092457055 12:8653294-8653316 TTCAGGGCAGCATCTTTTACTGG + Intronic
1097516025 12:60607739-60607761 TCTTGGGCAGCATGTTTCAGTGG + Intergenic
1098725693 12:73963600-73963622 TCTCGAGTAGCAGGGTTTACAGG + Intergenic
1098897028 12:76075198-76075220 TCTTGGGCAGCTGGGATTACAGG - Intronic
1098897033 12:76075222-76075244 TCTTGGGCAGCTGGGATTACAGG - Intronic
1107947835 13:45435718-45435740 TCTAGAGTAGCTGGGTTTACAGG + Intergenic
1109989383 13:70033741-70033763 TCTAGAGCAGCTGGAATTACAGG + Intronic
1110152524 13:72272009-72272031 TCTAGGTTTGAAGGTTTTACAGG - Intergenic
1111071167 13:83170091-83170113 TCTAGAGTAGCTGGGTTTACAGG - Intergenic
1112677763 13:101723212-101723234 TCTAGGACAGCAGGTTTAAATGG + Intronic
1113259537 13:108546349-108546371 TCTAGGGCAGTTGGTTTTAAGGG + Intergenic
1114144066 14:19952406-19952428 TCTTGGACATCAGGTTATACTGG - Intergenic
1114255038 14:20994377-20994399 TCTAGGGTAGCTGGGATTACAGG + Intronic
1115634357 14:35277147-35277169 TCTCGGGCAGCTGGAATTACAGG + Intronic
1120658833 14:87229031-87229053 TCTAGTGCAGCAGTTTTTCCTGG - Intergenic
1121030949 14:90658483-90658505 TCAAGGGAAGCAGATTTTATGGG - Intronic
1126634900 15:50770796-50770818 TCTCGAGTAGCTGGTTTTACAGG - Intergenic
1128000365 15:64185738-64185760 TCTAGAGCAGCTGGGATTACAGG - Intronic
1128509737 15:68306064-68306086 TCCCGGGTAGCAGGTATTACAGG - Intronic
1135057318 16:19241651-19241673 CCTAGGGCAGCAGGCTCTAGTGG + Intronic
1135838325 16:25849626-25849648 TCTAGGGTAGCTGGCATTACAGG + Intronic
1140804027 16:78516151-78516173 TCTTGGGCAGCAGGTACTTCTGG - Intronic
1141120837 16:81354875-81354897 TATAGGGGAACATGTTTTACAGG - Intronic
1141143835 16:81515216-81515238 TCTAGGGCTGAAGGATTGACCGG + Intronic
1142589815 17:998048-998070 TCTAGGGCAGCAGTTGTTTGAGG + Intronic
1146614897 17:34348494-34348516 TTTATGGCAGCAGGTTCTTCTGG + Intergenic
1147468000 17:40626747-40626769 TCTAGAGCAGCTGGGATTACAGG - Exonic
1148261277 17:46185761-46185783 TCTAGAGTAGCTGGTATTACAGG - Intronic
1148703833 17:49610340-49610362 TCTGGAGCAGCTGGTATTACAGG + Intronic
1149249689 17:54754161-54754183 TCTAGTGCTGCAGATTTTTCTGG + Intergenic
1151854735 17:76712649-76712671 TCTTGGGCAGCTGGGATTACAGG + Intergenic
1152977605 18:237988-238010 TCTAGGGCAGCTGGGATTACAGG + Intronic
1153767448 18:8387844-8387866 TCCAGGCCAGCAGGTTTTGCAGG + Intronic
1154262556 18:12849737-12849759 ACTGGGCCAGCTGGTTTTACCGG - Intronic
1157322248 18:46643457-46643479 TCCTGGGCAGGAGGATTTACTGG - Intronic
1167626690 19:50594730-50594752 TCTAGGGTAGCTGGGATTACAGG + Intergenic
924980269 2:213287-213309 TCTGGGGCAGAAAGTTTTAGTGG - Intergenic
926400260 2:12489431-12489453 GATAGGGGAGCAGGTGTTACTGG - Intergenic
929691726 2:44080481-44080503 TCTAGAGCAGCTGGGATTACAGG - Intergenic
930768483 2:55108949-55108971 TCAAGGCCAGCAGCTTTTTCAGG + Intronic
932735861 2:74254195-74254217 TCAAGGGCAGGAGGTAATACTGG - Intronic
936657661 2:114506577-114506599 TCTAGGGCTTCAGGTGTTGCAGG + Intronic
937638475 2:124184788-124184810 TTTAGTGCTCCAGGTTTTACAGG + Intronic
939224769 2:139351008-139351030 TCTATGGTGGCAGGTTTTTCAGG + Intergenic
942331639 2:174830782-174830804 TCTATAGCAGCTGGTTATACAGG - Intronic
943417560 2:187627877-187627899 TCTCGGGTAGCTGGTATTACAGG + Intergenic
943900130 2:193423245-193423267 TCTTGGGCAGCAGGTTTGTCTGG + Intergenic
944738806 2:202591862-202591884 TCTCGGGCAGCTGGGATTACAGG - Intergenic
944852669 2:203735882-203735904 TCTTGGGCAGCTGGGATTACAGG - Exonic
945282370 2:208047992-208048014 TCTCTGGCAGCAGATTTCACTGG + Intergenic
947826882 2:233112434-233112456 TCTGGGGCAACAGGTGTTGCAGG + Intronic
1170023702 20:11865287-11865309 TCTAGGGCAGCACATTATTCTGG - Intergenic
1172735229 20:37121897-37121919 TCCAGGGCAGCTGGGATTACAGG + Intronic
1174344004 20:49916042-49916064 GCTAGGGCTGCGGGTGTTACGGG + Intergenic
1174730387 20:52910226-52910248 TCTATGGCAGGTGGTTTTTCAGG - Intergenic
1175344041 20:58258149-58258171 TCTAGGACCAGAGGTTTTACTGG + Intergenic
1175802875 20:61811102-61811124 TCCAGAGCAGCAGGTGTGACAGG - Intronic
1176426385 21:6551095-6551117 TCGAGGTCAGCAGGTTACACAGG - Intergenic
1178322142 21:31613807-31613829 TCCAGGGTAGCTGGTATTACAGG - Intergenic
1178880558 21:36446886-36446908 TCTAGGCCAGCAGGGATTTCAGG + Intergenic
1179075887 21:38121358-38121380 CTGACGGCAGCAGGTTTTACGGG + Exonic
1179556150 21:42177934-42177956 TCTAGGGTAGCAGGGACTACAGG + Intergenic
1179701876 21:43159412-43159434 TCGAGGTCAGCAGGTTACACAGG - Exonic
1183515457 22:38263024-38263046 TCTAGAGCAGCTGGGATTACAGG + Intronic
1184407425 22:44308044-44308066 TCTAGGGCAGCAGGGCTTGGGGG + Intronic
950007598 3:9701549-9701571 CCTAGAGCAGGAGCTTTTACTGG - Intronic
950549706 3:13658805-13658827 TCTAGGGCAGGTGGTTTCTCAGG + Intergenic
956471227 3:69569149-69569171 TCTTGGCCATCAGGTTTTTCTGG + Intergenic
957401245 3:79716694-79716716 TCTTGTGCAGCTGGTATTACTGG - Intronic
961397762 3:126608981-126609003 TCTAGGGCAGCAGGTTTTACTGG + Intronic
965095319 3:164217961-164217983 TCCAGGGCTGCAGGTCTTGCAGG + Intergenic
972258619 4:37385448-37385470 TCTTGAGCAGCAAGTTTCACAGG - Intronic
984527704 4:180876279-180876301 TCTAAGGCAGGATGTTGTACTGG + Intergenic
985835487 5:2269067-2269089 TCTAGGGCAAGAGGATTTATAGG - Intergenic
987550297 5:19370917-19370939 TCTAGTTCACAAGGTTTTACAGG - Intergenic
987828933 5:23071231-23071253 TCTTGGGTAGCTGGGTTTACAGG - Intergenic
988103481 5:26712017-26712039 TCTGGGCCAGCAGGTTTTATTGG - Intergenic
988220130 5:28333857-28333879 TCCAGGACAGCAGGTATTTCAGG + Intergenic
988973047 5:36488796-36488818 TCCAGGGTAGCTGGTATTACAGG + Intergenic
990514311 5:56517630-56517652 TCTTGGGCAGGAGGTTTATCAGG - Intronic
993209860 5:84934345-84934367 TCTGGAGTAGCAGGTATTACAGG - Intergenic
998209825 5:140187000-140187022 TCCAGGGCAGCTGGGATTACAGG - Intronic
998479598 5:142451772-142451794 TCCAGAGCAGCTGGGTTTACAGG - Intergenic
998605089 5:143625266-143625288 TCTAGAGCAGCTGGGATTACAGG - Intergenic
999528150 5:152430957-152430979 GCAAGGGAAGCAGTTTTTACAGG + Intronic
1000787355 5:165561826-165561848 TCTAGAGCAACGGGTATTACAGG - Intergenic
1007758177 6:44114574-44114596 TCTGGGGAAGCAGGTTTTTCAGG - Intronic
1007872378 6:45054944-45054966 CCTGGGGCAGCAAGTTTTAATGG - Intronic
1007930968 6:45690195-45690217 TCTGTGGCTGCAGCTTTTACTGG - Intergenic
1015852564 6:137589145-137589167 GCTAGGGCAACAGGCTTGACTGG - Intergenic
1022733191 7:33051285-33051307 TCTTGGGTAGCAGGGATTACAGG + Intronic
1023083419 7:36546605-36546627 TCTGGGTAAGCAGGTTTTGCTGG + Intronic
1026315812 7:69226291-69226313 TCCAGAGCAGCTGGTATTACAGG + Intergenic
1026463754 7:70636235-70636257 TCTAAGGCAGCATGTTCTCCAGG + Intronic
1026622249 7:71960008-71960030 TCTAGAGCAGCTGGGATTACAGG - Intronic
1027974799 7:85138410-85138432 TCTAGAGCAGCTGGGATTACAGG + Intronic
1028715334 7:93959603-93959625 TCTGGGGCTGCAGGCTTGACTGG + Intergenic
1029248758 7:99221248-99221270 TCTAGAGTAGCTGGTATTACAGG - Intergenic
1031240685 7:119235041-119235063 TCTAGGGTGGCAGGGATTACAGG + Intergenic
1034225099 7:149475405-149475427 TCTAGGTCAGTAGGATGTACGGG + Exonic
1034973993 7:155437309-155437331 TGTTGGGCAGCAGCTTTTATGGG + Intergenic
1037819920 8:22130603-22130625 TCTAGGGCCGCAGGTTGGAGGGG + Exonic
1042688314 8:71465995-71466017 TCTAGGGCAGAATGTTTTGATGG - Intronic
1045746183 8:105425129-105425151 CCAAGAGCAGCAGGTTCTACAGG - Intronic
1046230192 8:111345661-111345683 TCTAGGGTAGCTGGGATTACAGG + Intergenic
1047826773 8:128584788-128584810 TGTTAGGCAGCAGTTTTTACAGG + Intergenic
1049950410 9:638314-638336 TCCAGCTCAGCAGGCTTTACTGG - Intronic
1050968037 9:11833922-11833944 TCTCGGGCCTCAGGTATTACAGG - Intergenic
1051901132 9:22042067-22042089 ACTAGCCCAGCAGGTTCTACGGG + Intergenic
1052360122 9:27545615-27545637 AGTAAGGAAGCAGGTTTTACAGG - Intergenic
1056235217 9:84587685-84587707 CCTAGGTCAGCTGTTTTTACAGG + Intergenic
1058358862 9:104118080-104118102 TCTATTACAGCAGTTTTTACTGG + Intronic
1060663612 9:125419460-125419482 TCTAGGGTAGCTGGGATTACAGG - Intergenic
1185780013 X:2835949-2835971 TCTTGGGGAGCAGGGTTTGCAGG + Intronic
1186855026 X:13618226-13618248 CCTAGAGCAGCAGGTTTGATTGG - Intronic
1187300413 X:18043760-18043782 TCTAAGGAGGCAGGTTTTAGGGG + Intergenic
1190925371 X:54898940-54898962 TCAAGGCCAGCAGGTTGTGCTGG + Intergenic
1192095404 X:68205322-68205344 TCTTGAGCAGCTGGTATTACAGG - Intronic
1194288458 X:92039295-92039317 TTCAGGGCAGCAAGTTTTCCAGG + Intronic
1194742222 X:97587256-97587278 TCTAGGACAGCAGATTTACCAGG - Intronic
1195029419 X:100911845-100911867 GTGAGGGCAGCAGGTTTTTCAGG + Intergenic
1195657260 X:107343970-107343992 TTTAGGGAAGCAGGAGTTACAGG - Intergenic
1200605979 Y:5263860-5263882 TTCAGGGCAGCAAGTTTTCCAGG + Intronic
1201290036 Y:12414040-12414062 TCTTGGGGAGCAGGGTTTGCAGG - Intergenic
1201977998 Y:19873083-19873105 TCTGGAGCAACAGGTTTTTCAGG - Intergenic