ID: 961399702 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:126630030-126630052 |
| Sequence | GGACCCAGAGGAAAACAAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 327 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 29, 4: 296} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 961399697_961399702 | 8 | Left | 961399697 | 3:126629999-126630021 | CCAGGTAATGCAAGTGCACAGAA | 0: 1 1: 0 2: 0 3: 12 4: 155 |
||
| Right | 961399702 | 3:126630030-126630052 | GGACCCAGAGGAAAACAAATGGG | 0: 1 1: 1 2: 0 3: 29 4: 296 |
||||
| 961399696_961399702 | 23 | Left | 961399696 | 3:126629984-126630006 | CCTAGAGAAGATCATCCAGGTAA | 0: 1 1: 0 2: 2 3: 15 4: 194 |
||
| Right | 961399702 | 3:126630030-126630052 | GGACCCAGAGGAAAACAAATGGG | 0: 1 1: 1 2: 0 3: 29 4: 296 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 961399702 | Original CRISPR | GGACCCAGAGGAAAACAAAT GGG | Intronic | ||