ID: 961399702

View in Genome Browser
Species Human (GRCh38)
Location 3:126630030-126630052
Sequence GGACCCAGAGGAAAACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961399697_961399702 8 Left 961399697 3:126629999-126630021 CCAGGTAATGCAAGTGCACAGAA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 961399702 3:126630030-126630052 GGACCCAGAGGAAAACAAATGGG 0: 1
1: 1
2: 0
3: 29
4: 296
961399696_961399702 23 Left 961399696 3:126629984-126630006 CCTAGAGAAGATCATCCAGGTAA 0: 1
1: 0
2: 2
3: 15
4: 194
Right 961399702 3:126630030-126630052 GGACCCAGAGGAAAACAAATGGG 0: 1
1: 1
2: 0
3: 29
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961399702 Original CRISPR GGACCCAGAGGAAAACAAAT GGG Intronic