ID: 961402804

View in Genome Browser
Species Human (GRCh38)
Location 3:126658907-126658929
Sequence CCTCTCATGCTGCACAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961402804_961402809 3 Left 961402804 3:126658907-126658929 CCTATCCTGTGCAGCATGAGAGG No data
Right 961402809 3:126658933-126658955 ATTGTGAATGCACTTTTTTAGGG No data
961402804_961402810 4 Left 961402804 3:126658907-126658929 CCTATCCTGTGCAGCATGAGAGG No data
Right 961402810 3:126658934-126658956 TTGTGAATGCACTTTTTTAGGGG No data
961402804_961402808 2 Left 961402804 3:126658907-126658929 CCTATCCTGTGCAGCATGAGAGG No data
Right 961402808 3:126658932-126658954 GATTGTGAATGCACTTTTTTAGG No data
961402804_961402811 19 Left 961402804 3:126658907-126658929 CCTATCCTGTGCAGCATGAGAGG No data
Right 961402811 3:126658949-126658971 TTTAGGGGAGAAACTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961402804 Original CRISPR CCTCTCATGCTGCACAGGAT AGG (reversed) Intergenic
No off target data available for this crispr