ID: 961403038

View in Genome Browser
Species Human (GRCh38)
Location 3:126660528-126660550
Sequence CTCACGGACCTGAGCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961403026_961403038 30 Left 961403026 3:126660475-126660497 CCTGGAGGGCTCTGCCAGTGAGG No data
Right 961403038 3:126660528-126660550 CTCACGGACCTGAGCAGAGGGGG No data
961403030_961403038 16 Left 961403030 3:126660489-126660511 CCAGTGAGGTGATAGGCTGGTGC No data
Right 961403038 3:126660528-126660550 CTCACGGACCTGAGCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961403038 Original CRISPR CTCACGGACCTGAGCAGAGG GGG Intergenic
No off target data available for this crispr