ID: 961404899

View in Genome Browser
Species Human (GRCh38)
Location 3:126672136-126672158
Sequence CCCTCCCCTCCAAAGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961404899_961404916 21 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404916 3:126672180-126672202 GGGAGTTGGGGGGTGTACCCAGG 0: 1
1: 0
2: 2
3: 20
4: 245
961404899_961404912 8 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404912 3:126672167-126672189 GCATTGGAGGCATGGGAGTTGGG 0: 1
1: 1
2: 2
3: 14
4: 197
961404899_961404908 0 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404908 3:126672159-126672181 GGGCCTCAGCATTGGAGGCATGG 0: 1
1: 1
2: 0
3: 32
4: 257
961404899_961404906 -8 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404906 3:126672151-126672173 GGGGAGGGGGGCCTCAGCATTGG 0: 1
1: 0
2: 1
3: 34
4: 365
961404899_961404915 11 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404915 3:126672170-126672192 TTGGAGGCATGGGAGTTGGGGGG 0: 1
1: 1
2: 7
3: 42
4: 503
961404899_961404914 10 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404914 3:126672169-126672191 ATTGGAGGCATGGGAGTTGGGGG 0: 1
1: 1
2: 4
3: 39
4: 325
961404899_961404909 1 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404909 3:126672160-126672182 GGCCTCAGCATTGGAGGCATGGG 0: 1
1: 1
2: 1
3: 16
4: 210
961404899_961404918 30 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404918 3:126672189-126672211 GGGGTGTACCCAGGATTTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 120
961404899_961404911 7 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404911 3:126672166-126672188 AGCATTGGAGGCATGGGAGTTGG 0: 1
1: 1
2: 1
3: 24
4: 218
961404899_961404917 29 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404917 3:126672188-126672210 GGGGGTGTACCCAGGATTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 130
961404899_961404907 -5 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404907 3:126672154-126672176 GAGGGGGGCCTCAGCATTGGAGG 0: 1
1: 0
2: 3
3: 25
4: 209
961404899_961404913 9 Left 961404899 3:126672136-126672158 CCCTGCGCCTTTGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 196
Right 961404913 3:126672168-126672190 CATTGGAGGCATGGGAGTTGGGG 0: 1
1: 1
2: 2
3: 29
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961404899 Original CRISPR CCCTCCCCTCCAAAGGCGCA GGG (reversed) Intergenic
900200161 1:1401077-1401099 CCCTGGCCTCCAAAGGCTTAGGG + Exonic
901197174 1:7446794-7446816 CCCTCCCCTCCACAGCCCCGGGG - Intronic
902548370 1:17204861-17204883 CCCTCCCCTCCAAAGACTCCTGG - Intergenic
904002239 1:27345380-27345402 CCCTCCCTCCCCATGGCGCATGG + Exonic
906185942 1:43862142-43862164 CTCTCCCCTCCAAAGGGGCCTGG + Intronic
906206999 1:43992169-43992191 CACTCCCCTCCCCAGTCGCAAGG + Intronic
907327862 1:53652554-53652576 CCCTGCCCTCCAGGGGCTCATGG - Intronic
908520473 1:64936305-64936327 CCCTCAACTCCACAGGCCCATGG + Intronic
909135790 1:71799000-71799022 CCCTACCCTCAAAAGGCTCAAGG - Intronic
910468277 1:87523649-87523671 GCCTCCCCACCAAGGGCACAGGG - Intergenic
910699281 1:90055456-90055478 CCCTCCCCTCAAAAAGCCCCAGG + Intergenic
911091323 1:94019536-94019558 CCCTCCCCTCCGTGGGCCCAAGG - Intronic
913106246 1:115616537-115616559 CCCGCCCCACCAAGAGCGCAAGG - Intergenic
917853947 1:179086960-179086982 CCCTGCCCTCCAAAGCCATATGG - Intronic
918094818 1:181325875-181325897 CGCTCCCCTCCCAGGCCGCAGGG + Intergenic
1063369633 10:5512638-5512660 ACCTCATCTCCAAAGGCGCACGG - Intergenic
1063843814 10:10102782-10102804 CCTTCCCCTCCAAAGAGGCATGG - Intergenic
1064016137 10:11773794-11773816 AACTCCCCTCCAGAGGCGCCTGG + Intergenic
1064626580 10:17267311-17267333 CCCTGCCCTCCCAAAGCGCTGGG + Intergenic
1068416766 10:56733741-56733763 CCCTACCCTGCAAAGCCACAGGG - Intergenic
1069920942 10:71815320-71815342 CCGTCCCCTCCCAGGGAGCAAGG + Exonic
1070370809 10:75780118-75780140 ACATCCCCTCCAAAGGCCCTAGG - Intronic
1070830946 10:79417828-79417850 CCCTCCCATTCCAAGGCTCAGGG - Intronic
1073336487 10:102714206-102714228 CCCTCCCGTCCCCAGGCCCAGGG - Intronic
1074529117 10:114284940-114284962 GCCTCCCCTCCAAAGGCCAGCGG - Exonic
1075563399 10:123484992-123485014 CCTTCCCCTCCCAAGGCTCATGG - Intergenic
1076520442 10:131077823-131077845 CCATCCCCTCCACAGGCCCTGGG + Intergenic
1076836162 10:133022088-133022110 CCCTCCCCTCCAGTGTCTCAGGG + Intergenic
1077060059 11:614030-614052 TCCTCCCCTCCTCAGGCCCAGGG - Exonic
1078170224 11:8924112-8924134 CCCACCCCTCCCAAAGCCCAGGG + Intronic
1081859024 11:46321437-46321459 CCCTCCCCTCCAATGAAGAAAGG - Intergenic
1084315298 11:68342328-68342350 CCCTCTTCTCCAAAGGGGAAAGG - Intronic
1084477488 11:69397080-69397102 CCCTGCCCTCCTAAGGCCCATGG - Intergenic
1084710831 11:70842897-70842919 CCTTCCACTCCACAGGCTCAGGG + Intronic
1084748791 11:71190232-71190254 CCCTCTGCTCCAAAGGGGCAAGG - Intronic
1086545814 11:87966234-87966256 CCCTCCCCTTCATAGGGGGAGGG + Intergenic
1087879208 11:103394758-103394780 CCCTCCCCTCCCATAGCACAGGG - Intronic
1090419133 11:126561979-126562001 CCCTCCCCTTCCAGGGCCCAGGG - Intronic
1091200481 11:133776587-133776609 CCCTCCCCGCCAAAGGAAAAAGG + Intergenic
1096048476 12:48585456-48585478 CCCTCCCCTCTAAATTCTCAGGG + Intergenic
1102960998 12:117093172-117093194 CCCTGCCCTCCAGAAGCTCAGGG - Intronic
1103934050 12:124466035-124466057 CCCTCTCCCCCAGAGACGCAGGG - Intronic
1104968464 12:132520488-132520510 CCCTGCCCTCCAAACGCCCGAGG + Intronic
1105012099 12:132762437-132762459 GCCTCGCCTCCCAAGGCGCTGGG - Intergenic
1106084053 13:26524415-26524437 CCTTTCCCTCCAAAGGTGCTGGG - Intergenic
1108934027 13:55864797-55864819 CCGTACCCTGCAAAGCCGCAGGG + Intergenic
1109789280 13:67226772-67226794 CCCTCCCCTCCAAAGCCAAGCGG - Exonic
1113078719 13:106493622-106493644 CCCTACCCTCCCAAGCCACAGGG + Intronic
1114046412 14:18880440-18880462 CCCTTTCCTCCGAAGGCGCCCGG + Intergenic
1114117800 14:19639010-19639032 CCCTTTCCTCCGAAGGCGCCCGG - Intergenic
1115841359 14:37474363-37474385 CCCTCCCCTCCCACGACACATGG - Intronic
1117176794 14:53153405-53153427 CCCTCCCAGCCAGAGGGGCAGGG - Intergenic
1119524902 14:75315072-75315094 CCCACTCCTCAAAAGGCACAGGG - Intergenic
1119653495 14:76400051-76400073 CCCTCCCAGCCAAAGCAGCATGG - Intronic
1120797429 14:88649921-88649943 CCCTGCCTTCAAAAGGAGCAAGG + Exonic
1122621467 14:103059783-103059805 CCCTCCCCTCCACAGCCACCAGG - Intergenic
1122778753 14:104134862-104134884 CCCTCCCCGCCCCAGGCTCAGGG + Intergenic
1126431515 15:48590043-48590065 CTCTGCCTTCCAAAGGCACATGG + Intronic
1127012855 15:54649356-54649378 CCGTACCCTGCAAAGGCTCAGGG - Intergenic
1127786004 15:62355206-62355228 CCCTCCCATCCACATGAGCAGGG - Intergenic
1127852004 15:62921396-62921418 ACCTCCCCTTCAAAGGCTTAAGG - Intergenic
1129112616 15:73346608-73346630 CCCTCACCTCCAGAGACTCATGG + Intronic
1132779268 16:1614100-1614122 CCCGCCCCCCGAAAGGCGCGGGG - Intronic
1132891528 16:2207137-2207159 CCCAGCCCTCCAAAGTCCCAGGG - Intronic
1133484684 16:6208481-6208503 CCTTGACCTCCAAAGGGGCAGGG - Intronic
1133741907 16:8658261-8658283 CTCACGCCTCCAAAGGCTCAAGG - Intergenic
1134058283 16:11183500-11183522 CCCTTCCCTCCACAGGCCCCGGG + Intergenic
1134336661 16:13305965-13305987 CCCTGCCCTCCAGAAGCTCATGG + Intergenic
1134539890 16:15055884-15055906 CACTCACCTCCAAAGGCGGGTGG + Exonic
1136367156 16:29814116-29814138 CCCTCCCACCCAAAGGGGCAGGG - Intronic
1136402181 16:30024949-30024971 CCCTCCCCTCCTCCAGCGCAAGG + Exonic
1136403623 16:30031135-30031157 CCCTCCCCACCGAGGGGGCAGGG - Exonic
1136610857 16:31364049-31364071 CCCTCCACCCCAAGGGAGCAGGG + Intronic
1136716867 16:32288678-32288700 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1136835243 16:33494923-33494945 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1139329030 16:66173333-66173355 CCCTCTCCTCCACAAGGGCAAGG - Intergenic
1139516733 16:67456826-67456848 CCCTCCCCTCCAAAGCATCAGGG + Intronic
1139561991 16:67748956-67748978 CCCTCTCCTCCCAAGTGGCATGG + Intronic
1141198695 16:81881050-81881072 CGCTGACCTCCAAAGGGGCAGGG + Intronic
1141436121 16:84000869-84000891 CCCTCCCCTCCAAGGATGCCTGG - Intronic
1141940350 16:87271820-87271842 TCCTCCCCTCCAAAGCCTCCTGG - Intronic
1142203703 16:88772923-88772945 GCCTCCCCTCCAAACACCCACGG + Intronic
1142249226 16:88983484-88983506 TCCTCCCCTCCTGAAGCGCATGG + Intergenic
1203009560 16_KI270728v1_random:229109-229131 CCCTCCCCACCAAGTGCCCAGGG - Intergenic
1203145415 16_KI270728v1_random:1795244-1795266 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1143974763 17:10821629-10821651 CCCTACCCTCCAAACCCCCATGG + Intergenic
1144536146 17:16094026-16094048 GCCTCCCAACCACAGGCGCATGG + Intronic
1146002774 17:29141108-29141130 CTCTCCCCTCCACAGACGCCAGG + Intronic
1146474597 17:33152916-33152938 CCCTCCCCTCCGAGGCCGGAAGG + Intronic
1147261465 17:39211779-39211801 CCCTCCCCACCAAGGGTGGAGGG + Exonic
1149547951 17:57518325-57518347 CCCTCCCCTCCCCAGGCGTATGG + Intronic
1149610303 17:57954720-57954742 CCCTCCCCCTGAAAGGCGCTCGG + Intronic
1151559937 17:74864666-74864688 GCCTCCTCCCCAAAGGCACAGGG + Intronic
1151820030 17:76492276-76492298 CCCTCCCCTGCCCAGGCTCAGGG + Intronic
1152069966 17:78129516-78129538 CCCTCCCTTCCAAATGGGCTTGG - Intronic
1152825116 17:82459612-82459634 GCCTCCCCTCCCAAGGTGCTGGG - Intronic
1160165056 18:76503861-76503883 CTCTCTCTTCCAGAGGCGCAGGG - Intergenic
1161038456 19:2097844-2097866 CCCAACCCTCCAAAGCCTCAGGG - Intronic
1161068236 19:2248494-2248516 CACTTCCCTCCGAAGGCCCAGGG + Exonic
1163425044 19:17236371-17236393 CCCTCCCCTCCAAAGCCTCCAGG + Intronic
1164995646 19:32719256-32719278 CCCTCGCCTCCCAAAGCGCTGGG + Intergenic
1165802145 19:38559202-38559224 CCCACCTCTCCACAGGCGCCTGG - Intronic
1165854415 19:38871040-38871062 CCCTCCCCTTCAGAGGCCCAGGG + Intronic
1166714995 19:44961296-44961318 CCCTGCCCTCCAAGGGCCCCTGG - Intronic
1166851904 19:45765294-45765316 GCCTCCCATCCAAAGGGGGATGG + Exonic
925147291 2:1589561-1589583 CCCTCCCCTGGGAAGGCGCTTGG - Intergenic
925976033 2:9142801-9142823 CCCCACCCTCCAAAGGCACGCGG - Intergenic
926886329 2:17602155-17602177 CCCTGCCCTCCAGTGGCCCATGG + Intronic
927031866 2:19128430-19128452 CCCTCCCCTCCACCTGAGCAAGG - Intergenic
927579793 2:24231797-24231819 TGCTCCCCTCCAAATGGGCAAGG - Intronic
928196969 2:29223047-29223069 CCCTTCCCTCCAGGGGAGCAGGG - Intronic
929600069 2:43199381-43199403 ACCTCCCCTCCAAACCCTCATGG + Intergenic
931014958 2:57966199-57966221 CCCTTGCCTCCCAAGGCCCATGG + Intronic
934078890 2:88451570-88451592 CCCTCCCTTCAAAAGGCCTAAGG + Intronic
934766370 2:96882376-96882398 CCCTTCCCTCCAACGTGGCAGGG + Intronic
935281175 2:101519045-101519067 CCCTCCCCTCCCTGGGCGCAGGG + Intergenic
935918795 2:107986831-107986853 CCCTCCCCTCTAAAACCGCCCGG - Intronic
936048793 2:109207048-109207070 CCCTCTCCTCCAAATGAGCATGG - Intronic
937220801 2:120342485-120342507 CCTTCCCCTCCTGAGGGGCAAGG - Intergenic
937973567 2:127567486-127567508 CCCTCCCCTCCAAGTTCTCAGGG - Intronic
938051385 2:128175747-128175769 CCCTCCCCTTCCCAGGAGCATGG + Intronic
938703520 2:133899948-133899970 GCCTCCCCTCCAAAATCTCAAGG - Intergenic
941767468 2:169313827-169313849 CCCTCCTCTCCCAAAGCGCTAGG + Intronic
942066944 2:172280417-172280439 CACTCCCCTCCAAAAATGCAGGG - Intergenic
946194816 2:218026766-218026788 CCTTCCCCTCCAAACCCTCAAGG + Intergenic
946247429 2:218395781-218395803 CCTTCTCGTCCAAAGGAGCAGGG + Exonic
947792810 2:232877431-232877453 CCCTTCCCTCCAAAGGCCCTGGG - Intronic
948913685 2:241019277-241019299 CCCTCCCATCCACAGGCTCCTGG - Intronic
1169065784 20:2693431-2693453 CCCTCCCCTCCTGGGGCGCTGGG - Intronic
1171811104 20:29744458-29744480 CCCTCACCTCCCAAAGTGCAGGG - Intergenic
1172795378 20:37533369-37533391 CCCTGCCCTCCAAGAGCTCACGG - Intergenic
1175926413 20:62473650-62473672 CCCTCCCCTCCCCAGGAGCCTGG + Intronic
1176046226 20:63094190-63094212 CCCTCCCCTCCCCATGCCCATGG - Intergenic
1176368302 21:6046818-6046840 ACGTCCCATCCGAAGGCGCACGG - Intergenic
1176877713 21:14149836-14149858 CCGTACCCTGCAAAGCCGCAGGG - Intronic
1179221869 21:39415229-39415251 CCCTCCCTGCCAAAGCCCCATGG - Intronic
1179755217 21:43491724-43491746 ACGTCCCATCCGAAGGCGCACGG + Intergenic
1179824560 21:43956968-43956990 TCCTCCCCTCGAAAGGTGGAGGG - Intronic
1179906524 21:44425863-44425885 CCCTCCCCTCCCCAGGGGCCCGG - Intronic
1180155356 21:45974753-45974775 CCGGCCCCTCCAAGGGCCCAAGG - Intergenic
1180464948 22:15603076-15603098 CCCTTTCCTCCGAAGGCGCCCGG + Intergenic
1181033052 22:20157449-20157471 GCCACCCCTCCCAAGGGGCAGGG + Intergenic
1181510256 22:23385788-23385810 GCCACCCCTCCCAAGGGGCAGGG - Intergenic
1182423155 22:30258121-30258143 CTCCCCACTCCAAAGGAGCATGG + Intergenic
1182701368 22:32242217-32242239 CCCTCCCCACTAAAGGAGCCAGG + Intronic
1184247832 22:43244693-43244715 CCCTCCCCTCCCTAGGCCCTGGG + Intronic
1184945232 22:47797877-47797899 CCGTCTCCTCTAAAGGGGCAGGG - Intergenic
949626060 3:5867810-5867832 TCCTCCCTTCCAAAGGAGTACGG - Intergenic
950505350 3:13391167-13391189 CCCTTCCCTTCAAAGGGGCCAGG + Intronic
951082195 3:18465790-18465812 CCCTCCCCTCGGCATGCGCAGGG - Intergenic
954441592 3:50525207-50525229 CCCTCCCCTTTAGAGGGGCAAGG + Intergenic
956436264 3:69237273-69237295 TCCTCCCCTCCTAAGCCACAGGG + Intronic
959342483 3:105148903-105148925 CTCTACCCTGCAAAGGCACAGGG - Intergenic
959420462 3:106121781-106121803 CCCTTGCCTCCAAAGTCCCAGGG - Intergenic
961404899 3:126672136-126672158 CCCTCCCCTCCAAAGGCGCAGGG - Intergenic
962200850 3:133400134-133400156 CATGCCCCTCCAGAGGCGCAGGG + Exonic
966599052 3:181756900-181756922 CCCTCCATTACAAAGGCCCAGGG - Intergenic
969078359 4:4598839-4598861 GCCTCCACTCCCAAGGGGCAGGG + Intergenic
969262645 4:6043532-6043554 CCCTCCACTCCCAAGCCTCAAGG + Intronic
969527814 4:7712928-7712950 TCCTCCCCTGCAAGGCCGCAGGG + Intronic
970885505 4:20983954-20983976 CCCTCCACTCCAAAGGGGTCTGG - Intronic
972503487 4:39698553-39698575 CCCTCCCCTCCCAGAGCGCTAGG + Intronic
976728444 4:88239658-88239680 CCATCACCTCCACAGGCCCAAGG + Intergenic
977914167 4:102572320-102572342 CCCACCCCACCACAGGCCCAGGG - Intronic
979369902 4:119872570-119872592 CCCTTGCCTCCAAAGGCCCCTGG + Intergenic
982136958 4:152281300-152281322 CCCTCCTCTGCAAAGTCGCCAGG + Intergenic
985288958 4:188366826-188366848 CCCTGGCCTCCCAAAGCGCAGGG + Intergenic
988492107 5:31713661-31713683 CCCTCCCCTCCTAAGTAGCTGGG + Intronic
988497059 5:31754319-31754341 CCCTCTCCTCCGACGGCCCATGG - Intronic
993984486 5:94581350-94581372 CTCTCACCTCCAGAGGAGCAAGG + Intronic
999753718 5:154648822-154648844 CCCTCCCCTCCAGAGTGGCTGGG + Intergenic
1003158995 6:3619347-3619369 GGCTCCCCTCCAAAGGCACTGGG - Intergenic
1004584869 6:16989617-16989639 CCTTCCCATCCAAAAGCACAGGG + Intergenic
1005267347 6:24126132-24126154 CCTCCCCCTCCAAAGGGGCAGGG - Intronic
1007178942 6:39914787-39914809 CACTCCCCTCCAAAGGCAGGTGG + Intronic
1010552759 6:77243160-77243182 CCCACCCCTCCAAAAAAGCATGG - Intergenic
1018389226 6:163330027-163330049 TACTCCCCTCCAAAGGCCCACGG - Intergenic
1019496650 7:1343726-1343748 CCCTCCCCTGAAAAGGCACGTGG + Intergenic
1019748404 7:2713415-2713437 CCCTCCCCTGCAGAGGCAGAAGG + Exonic
1022113309 7:27244185-27244207 CCCTCCCCACCAAAGGCTAATGG + Intronic
1023822094 7:43986145-43986167 CCCGCCCCTCCCAAGAGGCATGG + Intergenic
1025017294 7:55449562-55449584 GCCTTCCCTCCCCAGGCGCAGGG + Intronic
1027245531 7:76364634-76364656 GCCTCCCCTCCAGTGGTGCAGGG + Intergenic
1029283815 7:99452917-99452939 ACCTCCACTCCACAGGAGCAGGG - Intronic
1029750358 7:102539559-102539581 CCCGCCCCTCCCAAGAGGCATGG + Intronic
1029768310 7:102638667-102638689 CCCGCCCCTCCCAAGAGGCATGG + Intronic
1030973370 7:116089903-116089925 CCCTTCTGTCCAAAGGCCCAGGG + Intronic
1034228791 7:149502631-149502653 ACCTCACCTCCACTGGCGCAAGG - Intergenic
1035023764 7:155813822-155813844 CCCTCCACTCCAAGGGCCCGGGG - Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035780171 8:2221832-2221854 CCCACCCCTCCTAAAGCACATGG - Intergenic
1036452386 8:8880298-8880320 CCCACCCCTCCAAAGGTGCTTGG + Intronic
1039478760 8:37856385-37856407 CCCTGCCCTCAAAGGGCTCAAGG + Intergenic
1040473157 8:47753046-47753068 CCTTCTCCTCCAAAGGATCACGG + Intergenic
1041131556 8:54707441-54707463 ACATCCCCTCCTAAGGCTCAAGG - Intergenic
1041193790 8:55379807-55379829 CCCTCCCCTCCAGAGGCTGTGGG + Intronic
1041924098 8:63218295-63218317 CCTTACCCTCCCAAGGTGCAGGG + Intergenic
1042356199 8:67830755-67830777 CCCTTCTCTACAAAGGCCCAAGG + Intergenic
1043937604 8:86159734-86159756 CTCACCCCTCCAAAGCCACATGG + Intergenic
1049419711 8:142511228-142511250 CCACCCTCTCCAGAGGCGCATGG - Intronic
1049874487 8:145007572-145007594 CCCTCGCCTCCAGCTGCGCAAGG + Intergenic
1050312278 9:4365866-4365888 CCCTCCACCCCAAAGGGTCAAGG + Intergenic
1054740792 9:68804042-68804064 CCCACCCCTCCACACGCTCATGG - Intronic
1054795562 9:69298186-69298208 CCCACCCCTCACAAGGGGCATGG + Intergenic
1057705043 9:97389995-97390017 CCCTCCCCTCCCCAGTCTCATGG - Intergenic
1060069627 9:120534720-120534742 CCTTCCCCTTCACAGGCGCCAGG + Intronic
1060233297 9:121841372-121841394 CCCTCCCTTCCAAAATCTCATGG - Intronic
1061073869 9:128328841-128328863 CCCTCCCCTCCACAGCGACAGGG - Intronic
1061244107 9:129392459-129392481 CCCGCCCCCCCAAAGCCACACGG + Intergenic
1062153812 9:135034865-135034887 CCCTTCCCTTCCAAGGCCCACGG + Intergenic
1203361737 Un_KI270442v1:222375-222397 CCCTCACCTCCCAAAGTGCAGGG - Intergenic
1186456335 X:9712927-9712949 TCCTCCCCTCCTGAGGCGAAAGG - Intronic
1187391715 X:18890612-18890634 CCCTACCTTCCACAGGCCCAGGG - Intergenic
1189732214 X:44033425-44033447 CCCTGCCTTCAAAAGGCTCATGG - Intergenic
1190369369 X:49726748-49726770 CCCTCCCCACCACAGCTGCAAGG + Intergenic
1195683300 X:107564544-107564566 CCCTCCCCTTCCAAGCCCCAGGG - Intronic
1198395570 X:136215632-136215654 CCATCCCCACCAAAGGTTCATGG + Intronic