ID: 961405482

View in Genome Browser
Species Human (GRCh38)
Location 3:126676804-126676826
Sequence AAGGGGATGCACCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961405472_961405482 23 Left 961405472 3:126676758-126676780 CCTTGCACACATTTTGAGAAATT No data
Right 961405482 3:126676804-126676826 AAGGGGATGCACCTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961405482 Original CRISPR AAGGGGATGCACCTTGAGGA AGG Intergenic
No off target data available for this crispr