ID: 961405485

View in Genome Browser
Species Human (GRCh38)
Location 3:126676830-126676852
Sequence GGATGGACTCACTTTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961405485_961405491 5 Left 961405485 3:126676830-126676852 CCAAGAAGAAAGTGAGTCCATCC No data
Right 961405491 3:126676858-126676880 GGATAAGGAGTAGCAGTCCTTGG No data
961405485_961405487 -10 Left 961405485 3:126676830-126676852 CCAAGAAGAAAGTGAGTCCATCC No data
Right 961405487 3:126676843-126676865 GAGTCCATCCCAGAAGGATAAGG No data
961405485_961405492 6 Left 961405485 3:126676830-126676852 CCAAGAAGAAAGTGAGTCCATCC No data
Right 961405492 3:126676859-126676881 GATAAGGAGTAGCAGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961405485 Original CRISPR GGATGGACTCACTTTCTTCT TGG (reversed) Intergenic
No off target data available for this crispr