ID: 961406319

View in Genome Browser
Species Human (GRCh38)
Location 3:126682242-126682264
Sequence GGTGCCAAGCCTCCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961406314_961406319 6 Left 961406314 3:126682213-126682235 CCATCTGGGCTCAGGACCTGGGC No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406306_961406319 20 Left 961406306 3:126682199-126682221 CCCAGACAGTTTCCCCATCTGGG No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406317_961406319 -10 Left 961406317 3:126682229-126682251 CCTGGGCTAGCAGGGTGCCAAGC No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406312_961406319 7 Left 961406312 3:126682212-126682234 CCCATCTGGGCTCAGGACCTGGG No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406310_961406319 8 Left 961406310 3:126682211-126682233 CCCCATCTGGGCTCAGGACCTGG No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406304_961406319 27 Left 961406304 3:126682192-126682214 CCAGGTGCCCAGACAGTTTCCCC No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data
961406308_961406319 19 Left 961406308 3:126682200-126682222 CCAGACAGTTTCCCCATCTGGGC No data
Right 961406319 3:126682242-126682264 GGTGCCAAGCCTCCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961406319 Original CRISPR GGTGCCAAGCCTCCCCAAGG AGG Intergenic
No off target data available for this crispr