ID: 961406632

View in Genome Browser
Species Human (GRCh38)
Location 3:126684325-126684347
Sequence CTGGATGGAGGGAGAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961406624_961406632 10 Left 961406624 3:126684292-126684314 CCATCTGGAGGCTTTGTTCACAC No data
Right 961406632 3:126684325-126684347 CTGGATGGAGGGAGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961406632 Original CRISPR CTGGATGGAGGGAGAGCAGG TGG Intergenic
No off target data available for this crispr