ID: 961407897

View in Genome Browser
Species Human (GRCh38)
Location 3:126695341-126695363
Sequence ACTGATATCCAGAATCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961407897_961407899 24 Left 961407897 3:126695341-126695363 CCTTACAGATTCTGGATATCAGT No data
Right 961407899 3:126695388-126695410 AACATTTTCTTCCATTCTGTAGG 0: 32
1: 1135
2: 13097
3: 17778
4: 10740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961407897 Original CRISPR ACTGATATCCAGAATCTGTA AGG (reversed) Intergenic
No off target data available for this crispr