ID: 961410776

View in Genome Browser
Species Human (GRCh38)
Location 3:126718799-126718821
Sequence CTGCACCAACAGAACCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961410776_961410781 -5 Left 961410776 3:126718799-126718821 CCCCTCTGGTTCTGTTGGTGCAG 0: 1
1: 0
2: 0
3: 12
4: 196
Right 961410781 3:126718817-126718839 TGCAGGGACCACTGCCCAGATGG 0: 1
1: 0
2: 2
3: 18
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961410776 Original CRISPR CTGCACCAACAGAACCAGAG GGG (reversed) Intronic
900601705 1:3505557-3505579 CTGCACCCACAGAACCGTTGAGG + Intronic
901842604 1:11963620-11963642 CTGATCCAACAGAACAAGTGAGG + Exonic
902609949 1:17591179-17591201 CAGCACCATCAGCACCAGTGAGG - Intronic
903399590 1:23031438-23031460 CAGGACTAAAAGAACCAGAGAGG - Intronic
904670200 1:32158943-32158965 CTGAAACAAGAGACCCAGAGAGG - Intronic
905170624 1:36107725-36107747 CAGCACCATCAGAGCCACAGGGG + Intronic
906243405 1:44256563-44256585 CTTCATCAACGGAACCTGAGTGG + Intronic
906560644 1:46754381-46754403 CTCCACCAACAGACCCGGAATGG - Intergenic
907014256 1:50996221-50996243 CTGAAGAAAAAGAACCAGAGAGG + Intergenic
910812379 1:91251755-91251777 CTGCACCAACAAAGCCATAGGGG - Intergenic
912812735 1:112806180-112806202 CTGGACCAACAGAAGCAGCCGGG + Intergenic
913533677 1:119751063-119751085 CTGGACCCACAGAACAAGAGGGG + Intronic
915538238 1:156550590-156550612 CAGCACCTCCAGAACCACAGAGG + Intronic
915721525 1:157989275-157989297 CTGCCCCAACAGAAGCAGGCAGG - Intergenic
916377804 1:164174683-164174705 ATGCACCAACAAATTCAGAGAGG + Intergenic
916459483 1:165008662-165008684 CTGAACCATCAGAACCAGGATGG - Intergenic
916970338 1:170006800-170006822 CTGGACCAACAAAATCAGGGAGG + Intronic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920248006 1:204602765-204602787 CCGCACCCACACAACCACAGAGG - Intergenic
922731502 1:227950791-227950813 CTTCTCCAACAGAAACATAGGGG - Intergenic
923787630 1:237083510-237083532 ATACACCAACACAAGCAGAGAGG - Intronic
924858320 1:247896453-247896475 CTACACCCTCAGAAACAGAGAGG + Exonic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1065834424 10:29644113-29644135 CTGCACGAACAGAACCATGGAGG + Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068773261 10:60845770-60845792 CTGAACTAACAGAATCAGATGGG - Intergenic
1070827105 10:79397702-79397724 CTGCAGAACCAGATCCAGAGTGG - Intronic
1075746984 10:124734872-124734894 CTGCACCAACAGAAGCCAAGCGG + Intronic
1077383271 11:2257342-2257364 CTGGGCCAGCAGAACCACAGCGG - Intergenic
1078447255 11:11413624-11413646 GTGCAGCCACAGACCCAGAGTGG - Intronic
1079145082 11:17843873-17843895 CTAAAACATCAGAACCAGAGGGG + Intronic
1081977290 11:47243770-47243792 CTGCCCCAAGAGAACCACTGGGG - Intronic
1085079855 11:73625143-73625165 CTTCTCCAACAGTACCTGAGAGG + Intergenic
1085768627 11:79305999-79306021 CTGCGCCAGCAGAGTCAGAGAGG - Intronic
1086436696 11:86788288-86788310 GGGCACCAAGAGAAGCAGAGAGG + Intergenic
1086825741 11:91493645-91493667 CAGCACCAACACAGCTAGAGGGG - Intergenic
1086926206 11:92643255-92643277 CTGCACCGTCAGAAGCAAAGGGG + Intronic
1088683968 11:112269534-112269556 CTGCAACAACAGAACCAACACGG - Intronic
1090029638 11:123195767-123195789 TTACACTAACAGAACCAGACGGG - Intergenic
1090130974 11:124141888-124141910 CTCCACCCACAGAACCAGCCTGG + Intronic
1090500102 11:127252805-127252827 CTGCACCAGCACAGTCAGAGTGG + Intergenic
1091409866 12:232319-232341 CTGCCCCTCCAGAACCACAGTGG + Intronic
1091562772 12:1627650-1627672 CTTCACCATCACAACCAAAGAGG - Intronic
1091689146 12:2583947-2583969 CTCCACCAACAGAAACACTGTGG - Intronic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096809837 12:54162208-54162230 CTGCACCCCCAGATCCAGTGTGG + Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1101525590 12:105526018-105526040 CTCCACAAACAGAAGCAGAATGG - Intergenic
1110272319 13:73604616-73604638 CTGCCCCAACACAACCACAGAGG - Intergenic
1111036597 13:82682302-82682324 CTCCACCAACAGCACCAAAGAGG + Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1111756331 13:92400335-92400357 CTACAGCAACAGCAACAGAGGGG + Intronic
1117756248 14:58977416-58977438 CTGCACCCACAGAGCTAGAATGG - Intergenic
1118170183 14:63380944-63380966 AAGCACCAAGGGAACCAGAGAGG + Intronic
1119495745 14:75077307-75077329 CTTTCCCAACAGAACCTGAGAGG - Intronic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1126009522 15:44289070-44289092 CAGCACCACCAGCACGAGAGAGG - Exonic
1126589574 15:50325403-50325425 CAGCAGAAACAGAACCAGACAGG - Intronic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128260683 15:66230912-66230934 GTGGACCCACAGAACCAGAGAGG + Intronic
1128484005 15:68067128-68067150 CTGGAACAACTGAACCAGAGAGG - Intronic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132323225 15:100942804-100942826 TGCTACCAACAGAACCAGAGGGG - Intronic
1133068012 16:3223859-3223881 CAGCACCATCAGACCCAGAAAGG + Exonic
1133529193 16:6638767-6638789 CTGCACCAACCAAACCAGCATGG - Intronic
1136599727 16:31277000-31277022 CTTCATCAACATGACCAGAGTGG + Exonic
1137591080 16:49694363-49694385 CTGTGCCAAGAGAAACAGAGAGG + Intronic
1140476877 16:75243408-75243430 CTGGACCAACACAAGGAGAGCGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141583851 16:85019810-85019832 CTAGACAAACAGGACCAGAGAGG + Intergenic
1141873576 16:86806347-86806369 CTGCACCACCCGCACCACAGGGG - Intergenic
1142495511 17:304535-304557 CACCAACAACATAACCAGAGGGG + Intronic
1145836250 17:27956456-27956478 CTGCAGCTACACAAACAGAGTGG - Intergenic
1146533507 17:33630339-33630361 CTGCACAGACAGGAGCAGAGGGG - Intronic
1147924723 17:43939203-43939225 CTGCACAGACAGCACCAGTGTGG + Intergenic
1150509660 17:65737194-65737216 ATGCACCAACAGAACAATATCGG + Intronic
1150581054 17:66474196-66474218 CTGCAGCAACACACCCAGATGGG + Intronic
1151842329 17:76627231-76627253 CTGCACCACTGGAACAAGAGTGG + Exonic
1152743303 17:82028028-82028050 CTGCTCCGACAGAGCCAGGGCGG - Exonic
1153071009 18:1104664-1104686 CTGCACCAACAAAACGACATGGG - Intergenic
1155349080 18:24888441-24888463 TTGCCCCACCAGAAACAGAGAGG - Intergenic
1161985229 19:7649744-7649766 CAGCACCAATAGAACAGGAGAGG + Intergenic
1164556703 19:29258623-29258645 CTGAACCAGCAGAACCACTGGGG - Intergenic
1165318792 19:35073793-35073815 CTGCTCCAAGAGAACCAGCAGGG + Intergenic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1168351653 19:55679549-55679571 GTGCACCAAGACACCCAGAGCGG - Intronic
925292320 2:2756015-2756037 CTGCATCACCCCAACCAGAGAGG + Intergenic
933522874 2:83394898-83394920 CTGCAGCAATAGACCCAGAATGG + Intergenic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
934579092 2:95424204-95424226 ATGCTCCAATAGAAACAGAGGGG + Intergenic
934600355 2:95652499-95652521 ATGCTCCAATAGAAACAGAGGGG - Intergenic
941027006 2:160467935-160467957 CTGCATCCACACAACCAGTGTGG + Intronic
941819509 2:169829899-169829921 CTGCACCAAGAGAAACTAAGCGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
948075352 2:235161480-235161502 CTGCACCAAGTGTGCCAGAGAGG - Intergenic
948175331 2:235938660-235938682 CTGCACTAAGAGGACGAGAGAGG + Intronic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1172197569 20:33102513-33102535 CTGCAGCCACAGAGCCAGGGAGG - Intronic
1172698254 20:36836846-36836868 GTGCACCAACAAGACCACAGGGG + Intronic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1173470924 20:43323043-43323065 CTGCAGTCAGAGAACCAGAGAGG + Intergenic
1175586307 20:60143147-60143169 CTTCACCATCAGAACCTGAAGGG + Intergenic
1176300548 21:5096973-5096995 CTGCACCCACAGGACCCCAGGGG + Intergenic
1177905091 21:26965337-26965359 CAGCACCAACACAACCAGCTGGG - Exonic
1178310735 21:31527917-31527939 CTACACAAACAGGAACAGAGTGG + Intronic
1178787169 21:35664374-35664396 CTCCACCCACAGAAGGAGAGGGG + Intronic
1179723037 21:43326028-43326050 CTGCAACAACAGCACCCTAGGGG - Intergenic
1179856495 21:44165008-44165030 CTGCACCCACAGGACCCCAGGGG - Intergenic
1179879573 21:44287733-44287755 CTGCACCACCAGACCCAGGAAGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1181115544 22:20630934-20630956 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1181541473 22:23575232-23575254 CAGCACCAACAGTTTCAGAGAGG - Intronic
1181551355 22:23640591-23640613 CAGCACCAACAGCTTCAGAGAGG - Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181796908 22:25318070-25318092 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1182805995 22:33070885-33070907 GTGCAACAACAGAACAGGAGTGG + Intergenic
951393310 3:22133778-22133800 CTGCACTAAGACAAGCAGAGGGG + Intronic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
954445791 3:50546150-50546172 CTGGACCAAAAGAATCAGGGAGG + Intergenic
954498663 3:50988933-50988955 CTGCAGAAACAGTGCCAGAGAGG - Intronic
955212428 3:56954555-56954577 ATTCACCAAGAGAAGCAGAGAGG - Intronic
955398558 3:58574775-58574797 GGTCACCAACAGAACCAGGGAGG - Intronic
956213189 3:66822892-66822914 CTGCATTAACAGAAACAAAGAGG - Intergenic
957038379 3:75316032-75316054 CTGCAAAAACATACCCAGAGAGG + Intergenic
959552567 3:107679687-107679709 ATGAACAAACAGAACCAGAAAGG + Intronic
960008525 3:112807402-112807424 TTGCACCTACAGACCCTGAGAGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
962015467 3:131434802-131434824 CAGCAACAACAAAAACAGAGTGG + Intergenic
967050143 3:185775577-185775599 GTGCACCAACAGAATAGGAGAGG + Intronic
967602382 3:191405257-191405279 CTGCACCAGCAAATCCACAGGGG - Intergenic
970996313 4:22271062-22271084 CTCCACTAACAGAACTAGACAGG + Intergenic
973342845 4:49023919-49023941 CTGCACTGACAGCACTAGAGAGG - Intronic
975942631 4:79665615-79665637 CTTCACCAAGAGAACTAAAGAGG - Intergenic
977289530 4:95149034-95149056 CTGCATCAACAGAAATAAAGGGG - Intronic
982352677 4:154433157-154433179 CTTCAGTTACAGAACCAGAGAGG + Intronic
984530130 4:180905899-180905921 GTTCACCAACACAAGCAGAGAGG - Intergenic
985607910 5:868535-868557 CTCCAACAACAGGAGCAGAGTGG + Intronic
986334587 5:6744060-6744082 CTGGACTCACAGAACCAGACGGG - Intronic
988854362 5:35213665-35213687 CTGCACCAAAAGGAACAGTGAGG - Intronic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
996249651 5:121313938-121313960 CTGAAAAAACAGAACCAGAGAGG - Intergenic
997019994 5:129988883-129988905 CTGTACCAACATCATCAGAGGGG + Intronic
999039057 5:148386366-148386388 ATGAACAAACAGAACCAGAGAGG - Intronic
999337732 5:150737181-150737203 CTCCACCAACAGCACTAGACAGG + Intronic
999801052 5:155036941-155036963 CTCCACCAACAGCACTAGACAGG - Intergenic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1007325526 6:41056579-41056601 CTGCATCCAAAAAACCAGAGAGG + Intronic
1010065577 6:71679201-71679223 CTGCATCAACATATCAAGAGTGG + Intergenic
1013600868 6:111703807-111703829 CAGCACCAAAAGAACTACAGAGG - Intronic
1016409992 6:143772784-143772806 CTTCAACAACAGGCCCAGAGTGG - Intronic
1018793085 6:167164722-167164744 CTGCACCCCCAGGGCCAGAGAGG - Intronic
1018939368 6:168298431-168298453 ATGAACCAATAGAAACAGAGAGG + Intronic
1019046890 6:169156317-169156339 CTGCCCCCACAGACACAGAGTGG + Intergenic
1019919216 7:4152245-4152267 CTACAGCAACAGAACTCGAGGGG + Intronic
1022405249 7:30083571-30083593 ATGCATCAACTGTACCAGAGAGG - Exonic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1025813793 7:64891415-64891437 CAGCACAGCCAGAACCAGAGGGG + Intronic
1025818927 7:64945517-64945539 CAGCACAGCCAGAACCAGAGGGG - Intergenic
1028559554 7:92159004-92159026 CTGCAGCAACTAAACCTGAGTGG - Exonic
1029101066 7:98130380-98130402 CTGCAAGGACAGAAACAGAGTGG - Intronic
1030127745 7:106170661-106170683 CCACACCAATAAAACCAGAGTGG - Intergenic
1030285965 7:107827233-107827255 TAGCACCATCAGGACCAGAGGGG - Intergenic
1032146807 7:129390602-129390624 CAGCTCCAAGAGAATCAGAGAGG - Intronic
1032310898 7:130786465-130786487 CAGCACCAACATCTCCAGAGAGG - Intergenic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1033036160 7:137878271-137878293 CTGCTGCAACTGAACCAGACTGG - Exonic
1033641419 7:143265634-143265656 CCTCACCAACACATCCAGAGTGG + Intronic
1034048040 7:147950581-147950603 CTGCACAAACACAAACAGACTGG + Intronic
1036776574 8:11617101-11617123 ATGAACAAACAGAATCAGAGAGG + Intergenic
1037665585 8:20966885-20966907 CTTAACCAACAAAACCACAGTGG + Intergenic
1037741429 8:21612166-21612188 GTGAACCAAGAGAAGCAGAGGGG + Intergenic
1039478723 8:37856089-37856111 CTGGGCAAACAGACCCAGAGAGG - Intergenic
1046485346 8:114880489-114880511 ATGCACCCACAGATGCAGAGAGG - Intergenic
1046881521 8:119314113-119314135 CTGAACTAATAGAAGCAGAGAGG + Intergenic
1047619101 8:126588163-126588185 TTGCACCAACATAACTAGTGTGG - Intergenic
1049029407 8:140023268-140023290 CTACTCCAACATCACCAGAGGGG + Intronic
1049241260 8:141538390-141538412 TGCCACCAACAGAACCAGTGAGG - Intergenic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1049777865 8:144414781-144414803 CTGCTCCAACAGCAGCTGAGTGG - Exonic
1049869510 8:144963232-144963254 CTCCACCAACAGCACTAGATAGG - Intergenic
1050687130 9:8184392-8184414 CTGCACAAATACAAGCAGAGGGG - Intergenic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1052417065 9:28189825-28189847 CAGTACACACAGAACCAGAGTGG - Intronic
1053279453 9:36808388-36808410 CAGCCCCAGCAGAACCAGATGGG - Intergenic
1053897461 9:42757193-42757215 CTGCAGCAACAGAAGGAAAGTGG - Intergenic
1055764959 9:79652519-79652541 CTGCCCCAAGAGAAACAGAAAGG - Intronic
1056572701 9:87829714-87829736 CTTCACCAACTGAGCTAGAGAGG + Intergenic
1056795989 9:89659346-89659368 CTGAAGCAACAGGACCACAGAGG - Intergenic
1059472183 9:114514005-114514027 CTGAGGAAACAGAACCAGAGGGG - Intergenic
1059874244 9:118616407-118616429 CTGCAGCAACAGAGCTGGAGAGG + Intergenic
1060009290 9:120029218-120029240 CTGCACAAACAGAACAGCAGAGG - Intergenic
1060707266 9:125815451-125815473 ATACAACAACAAAACCAGAGAGG - Intronic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1186145175 X:6617588-6617610 CAGCAGCAAGAGAGCCAGAGGGG - Intergenic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1188040306 X:25364167-25364189 CTCCACCAACAGCACTAGACAGG - Intergenic
1188110475 X:26192335-26192357 CTGCACCCACAGAACACAAGGGG + Intergenic
1188673888 X:32914552-32914574 CTGCAACATCAAAAACAGAGAGG + Intronic
1189280391 X:39816839-39816861 CTCCTCCAAGAGAAGCAGAGCGG - Intergenic
1194794004 X:98187560-98187582 CTGCACCATCTGAACCATAAAGG - Intergenic
1195577629 X:106468484-106468506 CTGGCCCAACATAGCCAGAGTGG - Intergenic
1196804469 X:119572340-119572362 CAGCAACAGCAGAACCAGAACGG - Intergenic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic