ID: 961412329

View in Genome Browser
Species Human (GRCh38)
Location 3:126731380-126731402
Sequence GGCCCCAGTGGAGCACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961412321_961412329 19 Left 961412321 3:126731338-126731360 CCTGTCGCCGGAGAAGTTTTAGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG 0: 1
1: 0
2: 3
3: 54
4: 406
961412320_961412329 26 Left 961412320 3:126731331-126731353 CCTGCTTCCTGTCGCCGGAGAAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG 0: 1
1: 0
2: 3
3: 54
4: 406
961412322_961412329 12 Left 961412322 3:126731345-126731367 CCGGAGAAGTTTTAGCAAAGTGG 0: 1
1: 1
2: 1
3: 17
4: 151
Right 961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG 0: 1
1: 0
2: 3
3: 54
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961412329 Original CRISPR GGCCCCAGTGGAGCACAGGG TGG Intronic
900154610 1:1198931-1198953 TGTCCCTGTGGAGCGCAGGGTGG - Intergenic
900156358 1:1204793-1204815 GGACCCAGTAGAACAGAGGGTGG + Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900255668 1:1697274-1697296 GGCCCCTGCGGAGAGCAGGGTGG - Intronic
900264338 1:1749897-1749919 GGCCCCTGCGGAGAGCAGGGTGG - Intergenic
900559425 1:3296398-3296420 GGCCCCAGTTCCGCACAGAGTGG - Intronic
901678473 1:10900206-10900228 GAGCCCAGTGGAGCCCAGAGAGG - Intergenic
902623320 1:17662876-17662898 GGACCCAGTGGAGGGCAGGTGGG + Intronic
902633293 1:17718708-17718730 GGCCCGGGTGGAGGTCAGGGAGG + Intergenic
903125150 1:21242683-21242705 GGAGCAAGTGGGGCACAGGGAGG - Intronic
904320081 1:29690889-29690911 GGACCCAGCGGAACCCAGGGAGG + Intergenic
904835162 1:33331084-33331106 GGTGCCAGTGGAGCCCAGGAGGG + Intronic
905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG + Intergenic
906511225 1:46411419-46411441 GGCCCCAGAGGGGCACAGGCTGG - Intronic
906667382 1:47631507-47631529 AGCCCCAGGGGAGGACAGAGGGG - Intergenic
907389949 1:54151681-54151703 GGCTCAAGTGGGGCTCAGGGAGG - Intronic
907399013 1:54213054-54213076 GGCAGAAGTGGAGCACAGGCAGG + Intronic
910237219 1:85048327-85048349 GGCGCCCGCGGCGCACAGGGAGG - Intronic
912933463 1:113983558-113983580 GGCACACGTGGTGCACAGGGAGG + Intergenic
913335172 1:117703216-117703238 GGCCACAGTGGAGGGCGGGGAGG + Intergenic
917786644 1:178466042-178466064 GGCCCGACTGGAGGACAGCGAGG + Exonic
917790035 1:178493566-178493588 GGGCCCGGTGGAGCACAAGGAGG + Intergenic
917965475 1:180176005-180176027 GGCTCCAGTGGGGGACAGGCTGG - Exonic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
919919708 1:202160735-202160757 GGCCCCAGAAGGGCACAGGCGGG - Exonic
920054901 1:203184628-203184650 GGTTCCTGTGGAGCACAGGGAGG + Exonic
922605794 1:226889105-226889127 GTCCCCAGTGCTGCACAAGGAGG + Intronic
922714477 1:227859794-227859816 GGCCCCACAGGGGCACACGGGGG + Intergenic
924787100 1:247209176-247209198 GCACCCAGTGGGGCACAGTGTGG - Intergenic
1065319959 10:24499984-24500006 GGCCCCAGTGGAGCTCAAAGTGG - Intronic
1065658592 10:27980743-27980765 GGCCCCCGTGGAAAACAGGTTGG + Intronic
1065920235 10:30386842-30386864 GGCCCCAGTGGGGCACACGTGGG - Intergenic
1067064707 10:43097230-43097252 GGCCCCAGAGGAGCACCTGTGGG + Intronic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1070437922 10:76411801-76411823 TGCCCCAAAAGAGCACAGGGAGG - Intronic
1070590147 10:77795404-77795426 TGCCCCAGTGGAGCATCTGGGGG - Intronic
1070728217 10:78807017-78807039 GGCCTCAGTGGAGGGCAGGAAGG - Intergenic
1071974338 10:90939994-90940016 GGCCCCTGTGGAGCAGAGGTGGG + Intergenic
1073104915 10:101027038-101027060 GGCTGCAGTGGAGCACCTGGGGG - Intronic
1073321473 10:102618809-102618831 TGCCCCTGTGGAGAACAGGGAGG + Intronic
1073816641 10:107214557-107214579 GGCTGCAGTGGAGCACAGCCAGG - Intergenic
1075434675 10:122426987-122427009 GGCGCCATTGTAGCACAGCGGGG + Exonic
1076113958 10:127882410-127882432 GGCCCCAGCACAGCACAGGTAGG - Intronic
1076309383 10:129493297-129493319 GGCCCCAGTGGAGCGTCTGGAGG + Intronic
1076497216 10:130904997-130905019 GGCCACAGTGGGTCACAGGGTGG + Intergenic
1076814824 10:132909563-132909585 GGCCCTAGTGGGGCCCAGGGAGG - Intronic
1077173584 11:1178976-1178998 AGTTCCAGTGGAGCTCAGGGAGG - Intronic
1077271151 11:1682129-1682151 GGCCCCAGGGAAACACAGGCTGG + Intergenic
1077333500 11:1993535-1993557 AGCCCCAGGGGTGCCCAGGGTGG - Intergenic
1077377684 11:2212894-2212916 GGCCACAGTGGCTCCCAGGGAGG - Intergenic
1077460833 11:2708557-2708579 GACCCCTGGGGTGCACAGGGTGG + Intronic
1077498195 11:2896867-2896889 GCCCACAGTGGAGCCCAGTGAGG + Intronic
1077638399 11:3859377-3859399 AGCCCCAGAGTAGCACAGGCAGG - Intronic
1078251848 11:9623068-9623090 GGGCGCCGTGGAGCAGAGGGTGG + Intergenic
1080889671 11:36398459-36398481 CTCCCCAGAGCAGCACAGGGAGG - Intronic
1081428436 11:42950213-42950235 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1081794394 11:45809624-45809646 GGCTGGAGTGGAGGACAGGGAGG + Intronic
1082765457 11:57164033-57164055 GTCCTCAGTGGAGCACATGAGGG - Intergenic
1083075701 11:60034794-60034816 GGACAAAGTGGGGCACAGGGAGG + Intergenic
1083282901 11:61638433-61638455 GACCCCAGGGGAGGACAGGAGGG + Intergenic
1083455442 11:62775761-62775783 GGCCCCAGTGGAGCTGGGAGTGG - Exonic
1083647619 11:64181809-64181831 GGACTCAGAGGAGGACAGGGAGG - Intergenic
1083693969 11:64430280-64430302 GGCCCCGGTGGAGCTCAGATGGG - Intergenic
1084154311 11:67305013-67305035 GGCCCATGTGGAGCTCCGGGGGG + Intronic
1084831774 11:71775022-71775044 GGGCGCAGTGGAGCAGGGGGCGG - Intergenic
1085245640 11:75098492-75098514 GGCCGCACAGGAGCCCAGGGAGG - Intergenic
1087675655 11:101158409-101158431 GCCCCCACTGGAGCACAGCCTGG + Intergenic
1090643329 11:128747478-128747500 GGCCTCACTGGAGCAAAGGTGGG - Intronic
1090652156 11:128816232-128816254 AGCCCAAGTGGGGCACTGGGAGG - Intergenic
1202816480 11_KI270721v1_random:48717-48739 AGCCCCAGGGGTGCCCAGGGTGG - Intergenic
1092033000 12:5305505-5305527 GGCCCCAGTGGAGTACATTAGGG - Intergenic
1092137481 12:6159801-6159823 GGTGCCAGTGGAGCAGCGGGCGG - Intergenic
1093652601 12:21661855-21661877 GGGCGCAGTGGAGCAGGGGGCGG - Intronic
1093653860 12:21674040-21674062 GGGCGCAGTGGAGCAGGGGGCGG + Intronic
1096216136 12:49798395-49798417 TCCCTCAGTGGAGCTCAGGGAGG + Exonic
1096262302 12:50100368-50100390 GTCCCCAGTGTAGAACAGGGAGG - Exonic
1096770541 12:53933525-53933547 TCCCCCAGTAGAGGACAGGGTGG + Intergenic
1096804026 12:54129440-54129462 GGTTCCTGAGGAGCACAGGGAGG + Intergenic
1097664149 12:62461307-62461329 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1098032677 12:66270781-66270803 GGTGCCATTGGAACACAGGGAGG + Intergenic
1100211843 12:92406593-92406615 GGCCGCAGAGGAGCCCATGGAGG + Intergenic
1100674085 12:96847342-96847364 TGCACAAGTAGAGCACAGGGAGG - Intronic
1100734585 12:97512818-97512840 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1101445481 12:104734138-104734160 GGCGCCAGAGGGGCACAGGGAGG + Intronic
1101724144 12:107375523-107375545 TGCCCCACTGGCCCACAGGGAGG - Intronic
1101765188 12:107691462-107691484 GGCAACAGTGGAGAACAGGTTGG + Intronic
1102571482 12:113829612-113829634 GGCCACACTGGGGCTCAGGGTGG + Intronic
1103794589 12:123494586-123494608 GGCCCCACGGGAGCTCAGGCTGG - Intronic
1103915148 12:124372305-124372327 GCCCCCAGTGGAGGAGGGGGAGG - Exonic
1104253885 12:127123508-127123530 GGCTTGAGTGGAGCAGAGGGTGG + Intergenic
1104805435 12:131586539-131586561 GGCCTCAGGGGAGCACACTGGGG + Intergenic
1106216759 13:27708613-27708635 GGCACCGGTGCAGCTCAGGGAGG + Intergenic
1106422045 13:29592935-29592957 GGCGGCAGGGGAGCAAAGGGAGG + Intronic
1108684802 13:52809485-52809507 GGCCCCAGGTGACCACAAGGTGG - Intergenic
1108996039 13:56735848-56735870 GGCCGCACAGGAGCCCAGGGAGG - Intergenic
1110095491 13:71513891-71513913 GGCCCCTGTGGAGGACAGAGGGG - Intronic
1111556127 13:89883899-89883921 GGCCGCCGTGGAGCAGGGGGCGG + Intergenic
1111747722 13:92291173-92291195 GGGCACAGTGGAGCAGGGGGTGG - Intronic
1112533129 13:100224124-100224146 GGCCCCACAGGAGCCCAGGGAGG + Intronic
1112746930 13:102536984-102537006 TGCCTCAGTTGAGCCCAGGGTGG - Intergenic
1113522045 13:110948016-110948038 GGCTCCCGTGGAGCTCAGGCGGG + Intergenic
1113600372 13:111563994-111564016 GTCCACAGTGGAGCTCAGGCTGG + Intergenic
1113705835 13:112432639-112432661 GGCTCCTGTGGAGCTCAGGTAGG - Intronic
1113876479 13:113597857-113597879 TGCCCCAGTGTTGCACAGAGGGG + Intronic
1113904894 13:113814712-113814734 GGCCCCAGCGGAGCCCAGAGAGG - Exonic
1114560260 14:23584914-23584936 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
1116992815 14:51293661-51293683 GAGACAAGTGGAGCACAGGGTGG + Intergenic
1117907540 14:60605899-60605921 GTCCCCACTGGGGCACTGGGTGG + Intergenic
1117908196 14:60611857-60611879 GTCCCCACTGGGGCACTGGGTGG - Intergenic
1119058055 14:71443833-71443855 GTCCCCAGTGGGGGACAGTGTGG - Intronic
1119428528 14:74551228-74551250 GGCCCTAGTGGAGAACAGCGTGG - Exonic
1119805937 14:77482493-77482515 GGCCCCAGGGGAGAAGGGGGAGG - Exonic
1121121124 14:91376535-91376557 AGCCCTGGTGGGGCACAGGGAGG + Intronic
1121145445 14:91578301-91578323 GGGCGCCATGGAGCACAGGGTGG - Intergenic
1122744759 14:103891161-103891183 GCCCCCAGTGCCACACAGGGTGG - Intergenic
1124007143 15:25803353-25803375 GGATACAGTGGGGCACAGGGTGG + Intronic
1124629202 15:31327446-31327468 CGCCCCGGCGGAGCGCAGGGAGG + Exonic
1125885502 15:43226621-43226643 GGGCGCCGTGGAGCAGAGGGCGG + Intergenic
1126414885 15:48407117-48407139 GGGCACAGGGGAGCACAGAGAGG + Intergenic
1127267893 15:57376292-57376314 GGGCCCAGCGGAGCCGAGGGCGG + Intronic
1127660674 15:61097455-61097477 AGCCCCCTTGGAGAACAGGGTGG - Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1128075083 15:64820909-64820931 GGCCACAGTGGAACACAGAGAGG - Intronic
1128338014 15:66800849-66800871 GTGCCCACTGGACCACAGGGAGG - Intergenic
1128549607 15:68589942-68589964 GGCCACTGTGGAGGCCAGGGGGG - Intronic
1129656202 15:77527162-77527184 GGGGACAGTGAAGCACAGGGAGG + Intergenic
1130510014 15:84581724-84581746 GGCCCCAGTGGGGCACACATGGG - Intergenic
1131032475 15:89197731-89197753 GGCCCCTGTGGAGGACAGGCAGG + Exonic
1131153749 15:90062506-90062528 GGCCCCAGTGGGGCCCCAGGCGG + Intronic
1131371555 15:91886035-91886057 GGCCCCTGTGAGCCACAGGGAGG + Intronic
1132104929 15:99056639-99056661 GCCCCCTGAGGAGCACAGGAGGG - Intergenic
1132230811 15:100182507-100182529 AGCCACAGTGTAGCACAGAGAGG - Intronic
1132590207 16:723293-723315 GGCGCCACAGGAGCACGGGGGGG - Intronic
1132640832 16:977609-977631 GGCCTCTGAGAAGCACAGGGAGG - Intronic
1132711226 16:1268885-1268907 AGCCACAGTGGAGCCCAGGGCGG + Intergenic
1133332270 16:4982123-4982145 GGCCCTGGTGGAGGACAGGCAGG + Intronic
1133681472 16:8124216-8124238 GGCCCCAGAAGATCACAGTGGGG + Intergenic
1134231967 16:12436566-12436588 GGCACCAGGGGAGCTCAGAGAGG - Intronic
1134841639 16:17406401-17406423 GACCTCACTGGAGCACAGAGAGG - Intronic
1136551576 16:30985092-30985114 GATGCCAGTGGAGCACAGAGCGG + Exonic
1137508310 16:49076049-49076071 TGCCCAGGTGAAGCACAGGGAGG - Intergenic
1138516987 16:57541601-57541623 GGCCCCAGTGAGGCAGAGAGCGG + Intergenic
1139825621 16:69754886-69754908 GGCTCCAGTGGAGCACGTTGTGG - Exonic
1141619996 16:85232255-85232277 GGCCCCTGGGGAGCACACTGTGG - Intergenic
1141625537 16:85259286-85259308 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141625545 16:85259308-85259330 GGCCAGGGTGGAGCACAGGGTGG - Intergenic
1141788893 16:86219585-86219607 GTCCCCTGGGCAGCACAGGGTGG - Intergenic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1141989498 16:87602287-87602309 GGCCCCGGGGAAGCCCAGGGCGG + Intronic
1142486648 17:251823-251845 GCCCACGGTGGAGGACAGGGAGG - Intronic
1142590508 17:1003369-1003391 AGCCCCCGTGGGCCACAGGGAGG + Exonic
1142595927 17:1030023-1030045 GGCGTCAGTGCAGCTCAGGGTGG - Intronic
1143323054 17:6080525-6080547 GACCCCAGGCGAGCACAGGCAGG + Exonic
1143329340 17:6121952-6121974 GGCCTCTGTGGAGGTCAGGGAGG + Exonic
1144956863 17:19023066-19023088 GGCCCAGGTGGTGAACAGGGAGG + Intronic
1144958979 17:19034281-19034303 GGCCCCAGAGGAGGGCAGAGTGG - Intronic
1144976180 17:19140243-19140265 GGCCCCAGAGGAGGGCAGAGTGG + Intronic
1145102121 17:20086142-20086164 GGCAGCAGTGGTGCCCAGGGTGG - Intronic
1146459323 17:33033302-33033324 GCTCCCAGAAGAGCACAGGGAGG - Intronic
1146617356 17:34367583-34367605 GGCCCCAGTAGGGGAGAGGGTGG - Intergenic
1146740424 17:35278989-35279011 GGCCGCACTGGAGCCCACGGAGG + Intergenic
1146790657 17:35748797-35748819 GGCTACAGTGGAGGAGAGGGAGG + Intronic
1146798772 17:35801857-35801879 GGCTCCAGTGCAGGAGAGGGAGG - Intronic
1146913532 17:36663594-36663616 GGCCCCAGAGAAGCTCTGGGGGG - Intergenic
1148531841 17:48400656-48400678 GGCCTCATTTGAGCCCAGGGAGG + Intronic
1148697587 17:49570451-49570473 GTCCCCAGTGAAGCACTGGCGGG - Intergenic
1149866919 17:60156311-60156333 AGCCCCAGTGTGGAACAGGGTGG - Intronic
1150294936 17:64002482-64002504 GGCCCCTGTGAAGGAGAGGGTGG + Exonic
1150616358 17:66775415-66775437 GGCCCCAGTGGGACACAAAGAGG + Intronic
1151415693 17:73961162-73961184 GGGCACAGTGGTGCAAAGGGTGG - Intergenic
1151524161 17:74652384-74652406 AGCCCCAGTGCAGCACAGCCAGG - Intergenic
1151722114 17:75863130-75863152 AGACCCAGTGGAGAACAGAGTGG + Intergenic
1151914251 17:77105786-77105808 GGGCCCAGAGGAGCACAGGTGGG + Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152643964 17:81460426-81460448 GGACACAGTGGAGCCCAGGCAGG - Intronic
1154134278 18:11762087-11762109 AGCCCCAGCTGAGGACAGGGAGG + Intronic
1154315387 18:13299979-13300001 GGCACCAGGGGAACACAGGTGGG - Intronic
1155228552 18:23751841-23751863 GGCACCAGTAGATCAGAGGGTGG - Intronic
1155785910 18:29899131-29899153 GGCCACACTGGAGCCCACGGGGG + Intergenic
1157447747 18:47758003-47758025 GGCCCCATTGGAGAACAAGATGG - Intergenic
1157614013 18:48976196-48976218 GGCGGCAGAGGAGCGCAGGGCGG + Intergenic
1158099909 18:53819211-53819233 GGCTGCAGTGGAGCACAGCCAGG + Intergenic
1159472904 18:68880070-68880092 GGCCCCACGGGAGCCCATGGAGG + Intronic
1159718188 18:71851138-71851160 AGCCCATGTGGAGCACAGTGTGG - Intergenic
1160176568 18:76600163-76600185 GGGCCCCGTGGAGCAGGGGGTGG + Intergenic
1160406091 18:78647244-78647266 GGGGCCTGTGGAGCACTGGGTGG - Intergenic
1160805239 19:989702-989724 AGCCCCAGGGGAGGAAAGGGGGG - Intronic
1160858013 19:1226104-1226126 TGCCCCAGGGGAGCACGGGAGGG + Intronic
1160960548 19:1718819-1718841 GGCCCCCGCGGAGAGCAGGGGGG - Intergenic
1161044572 19:2128401-2128423 GGCCCCAGTGCGGTACAGCGGGG - Intronic
1161059545 19:2208114-2208136 GGACCCTGGGGAACACAGGGAGG - Intronic
1161261178 19:3338689-3338711 AGCCCCAGGGTGGCACAGGGTGG + Intergenic
1161372163 19:3918860-3918882 GGCACCAGTGGAAAACAGGTAGG + Exonic
1161642451 19:5432784-5432806 GTCCCCTGGGGAGCTCAGGGGGG + Intergenic
1161799890 19:6411777-6411799 GGCCCCAGTGTAGCACTCGTCGG - Intergenic
1161824218 19:6551676-6551698 GGCCCCCCAAGAGCACAGGGAGG + Intergenic
1162003169 19:7760897-7760919 GAGCGCAGTGGAGCACAGTGGGG - Intergenic
1163019518 19:14474928-14474950 GACCGCAGTGGAGCAGAGGCAGG - Intronic
1163394110 19:17049088-17049110 AGTCCCAGTGGAGCACAGATGGG + Intergenic
1163505049 19:17700638-17700660 GGCCCCTTAGGAGCTCAGGGAGG + Intergenic
1163557092 19:17999010-17999032 GGCCCCAGCGGGGCCCATGGGGG + Exonic
1163699980 19:18782107-18782129 GGGCACAGAGGAGCACAGGCAGG - Exonic
1164527452 19:29022515-29022537 GGGCCCAGGTGAGCACATGGTGG + Intergenic
1164807353 19:31127286-31127308 GCCCCAAGGGGAGAACAGGGTGG - Intergenic
1165094412 19:33402573-33402595 GGCCCAAGGGGAGGGCAGGGAGG + Intronic
1166069824 19:40380580-40380602 GGCCCGAGTCGGGCACATGGTGG + Exonic
1166185608 19:41137025-41137047 AGCCCATATGGAGCACAGGGTGG - Intergenic
1167320750 19:48796062-48796084 GGCAGCAGAGGATCACAGGGAGG + Intronic
1167782399 19:51607531-51607553 GGCCTCAGTGGACCACAGGATGG - Intergenic
925147034 2:1588487-1588509 GAGCCAAGTGGAGCCCAGGGTGG - Intergenic
926196365 2:10765837-10765859 GGGCCCCCTGGAGCACATGGAGG + Intronic
928174665 2:29025656-29025678 CACCCCAGTGGAACACAGTGGGG - Intronic
928572400 2:32622570-32622592 TGACCCAGAGGAGTACAGGGAGG - Intergenic
929175212 2:38968963-38968985 GGCCCCAGTGTAGCACAGGAAGG + Intronic
932417310 2:71581270-71581292 GGCCCCTGGGGAGCTGAGGGTGG - Intronic
932431668 2:71679253-71679275 AGCCCCAGTGGAGGGCATGGGGG + Intronic
933759822 2:85665635-85665657 GGGCCCCGGGCAGCACAGGGAGG + Exonic
933811516 2:86035664-86035686 GGCCCAAAGGGTGCACAGGGTGG - Intronic
933812301 2:86040364-86040386 GGGCACAAGGGAGCACAGGGTGG - Intronic
934736723 2:96693405-96693427 GGACCCAGTGGGGCCCAGGAGGG - Intergenic
935111496 2:100098739-100098761 GGCCCCAGAGGATACCAGGGAGG - Intronic
935735003 2:106099501-106099523 GGCCTCAATGGAGCACAGAGGGG + Intronic
935953696 2:108353642-108353664 GTCCCCAGAGGGACACAGGGAGG - Intergenic
936123472 2:109766425-109766447 GGCCCCAGAGGATACCAGGGAGG + Intergenic
936221213 2:110605039-110605061 GGCCCCAGAGGATACCAGGGAGG - Intergenic
936257255 2:110927420-110927442 GGCCTCAGTAGAGGACAGAGAGG - Intronic
937903810 2:127041985-127042007 GGCCGCTGTGGAACACAGGCCGG - Intergenic
938160831 2:128983182-128983204 AGCCCCAGAGGAGAACAGGCTGG - Intergenic
938163701 2:129008650-129008672 GGCCCCATGGGAGCCCAGGGAGG + Intergenic
938401073 2:130991772-130991794 GGGCGCTGTGGAGCACGGGGTGG - Intronic
938931166 2:136088103-136088125 GGCACCCGTGGAGCAGGGGGCGG + Intergenic
939509578 2:143089630-143089652 GGGTGCGGTGGAGCACAGGGTGG + Intergenic
940849235 2:158672531-158672553 GGGCCCAGCTGAGAACAGGGTGG + Intronic
943494702 2:188606427-188606449 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
945401422 2:209387620-209387642 GGCCGCACAGGAGCCCAGGGCGG - Intergenic
946057174 2:216912426-216912448 GGCCCGAGTGCTGCACAGGTAGG - Intergenic
946861551 2:224004285-224004307 GGCCTCAGTGGTTCACAGTGGGG - Intronic
947464093 2:230326088-230326110 GGCCCAAGGTGAGCAGAGGGTGG - Intergenic
947472996 2:230415123-230415145 GGCCCAAGGTGAGCAGAGGGTGG - Intergenic
947643102 2:231718110-231718132 GGCCCGATGGGAGCACTGGGAGG - Intergenic
947793587 2:232880919-232880941 GGCTCTAGGGGAGGACAGGGAGG + Intronic
948240593 2:236429774-236429796 GGCTCCAGTGGGGGACAGGTAGG + Intronic
948275583 2:236705562-236705584 GACCCCAGCGGAGCACATGGAGG - Intergenic
948956921 2:241300243-241300265 GGCCCAGATGGAGCACCGGGGGG - Intronic
1169227340 20:3864890-3864912 GGCCACAGAGCAGCACAGGCTGG - Intronic
1171048734 20:21836055-21836077 GGCCCCACTGGAGTACAAGGAGG + Intergenic
1172360748 20:34311389-34311411 GGCCCCAGTGGAGCTTCTGGCGG + Intronic
1172511381 20:35503512-35503534 GGCCCAAGTAAAGCACAGCGCGG + Exonic
1172649934 20:36495734-36495756 TGGACCAGTGGAGAACAGGGAGG + Intronic
1174388361 20:50200638-50200660 GGCCTCAGTGGAGCAGGTGGTGG - Intergenic
1174389356 20:50208306-50208328 GGAGTCAGTGGAGCAAAGGGTGG + Intergenic
1175418371 20:58816269-58816291 GGCCCCAGTGGGGGGCAGAGGGG + Intergenic
1175773266 20:61636888-61636910 GGCCCTGGTGCAGCTCAGGGAGG - Intronic
1175914995 20:62422179-62422201 AGCCCAAGTGGATCACAGAGCGG + Intronic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176053221 20:63131480-63131502 GGCCTCACCAGAGCACAGGGTGG + Intergenic
1176057373 20:63155792-63155814 GGACACAGTACAGCACAGGGCGG + Intergenic
1178638037 21:34322422-34322444 GGCTCCAGGAGAGCTCAGGGTGG - Intergenic
1179505039 21:41834601-41834623 GTCCCCAGCGGGGCACAGAGGGG - Intronic
1179613470 21:42566886-42566908 GGCGCCTGGGGAGCACAGGGAGG - Intronic
1180853360 22:19032389-19032411 GGCACCAGCAGGGCACAGGGAGG - Intergenic
1181170861 22:21009094-21009116 GGCCCCATCGAATCACAGGGAGG + Intergenic
1181180909 22:21067739-21067761 GGCCCCAACGAATCACAGGGAGG - Intergenic
1181182906 22:21079696-21079718 GGCCCAAGTGGGGTACAGGCAGG + Intergenic
1181330473 22:22086944-22086966 GAGCCCAGTGGTGCCCAGGGAGG - Intergenic
1181392674 22:22594975-22594997 GGCCCCAGTGATGGTCAGGGTGG - Intergenic
1181464636 22:23104266-23104288 GTCCCCAGTGTGGCCCAGGGTGG + Intronic
1182075984 22:27495687-27495709 GGCCCCAGTGCTGGGCAGGGAGG + Intergenic
1182984453 22:34703168-34703190 AACCCGAGTGGAGCACATGGAGG + Intergenic
1183284138 22:36952041-36952063 GGCCCCAGTGGTGGGCAGAGGGG + Intergenic
1183624879 22:38995830-38995852 ACCCCCAGTGGAGCACAGTTAGG + Intergenic
1184106699 22:42371564-42371586 GGCCCCAGGGCTGCACAAGGTGG + Intergenic
1184425334 22:44405938-44405960 GGTCCCAGGGGGGCACAGGGAGG - Intergenic
1184430843 22:44440903-44440925 GGCCCAAGTGCAGCCCTGGGTGG + Intergenic
1184584306 22:45437056-45437078 GGGCGCCGTGGAGCACGGGGCGG - Intergenic
1184768785 22:46586301-46586323 GGCGCCAGTGGGGCCCAGTGAGG - Intronic
1185044834 22:48523641-48523663 GGCCCAAGTTGGGCACAGAGGGG - Intronic
1185126031 22:49011297-49011319 TGCCACGGTGGAGCACAGGCAGG + Intergenic
1185243995 22:49763674-49763696 GGCCCCAGGGCTGCACAGAGAGG - Intergenic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
949770046 3:7568920-7568942 GGCACCGGTGGAGCAGGGGGCGG - Intronic
950068911 3:10136468-10136490 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
950142028 3:10622124-10622146 GGGCCCAGGGGAGCCTAGGGGGG - Intronic
950263007 3:11555462-11555484 GCCCACAGTGGAGGACAGGCTGG - Exonic
952593679 3:34988663-34988685 GGCCGCACAGGAGCCCAGGGAGG - Intergenic
953002940 3:38951479-38951501 GGGCGCCGTGGAGCAGAGGGCGG - Intergenic
953983586 3:47425448-47425470 GGCTCCACTGGGCCACAGGGTGG - Intronic
954121194 3:48501109-48501131 TGCACCAGTGGGTCACAGGGTGG - Intronic
954315444 3:49798920-49798942 GGCCAGAGTGGAGGTCAGGGAGG + Intronic
954594842 3:51815589-51815611 GGCTGCAGTGGAGCCCTGGGGGG - Intergenic
954800933 3:53186532-53186554 GGCCCCAGTGGCCCTCAGTGAGG + Intronic
956195774 3:66651813-66651835 GGCCGCACAGGAGCACATGGAGG - Intergenic
956987014 3:74712357-74712379 GGGCGCCGTGGAGCACGGGGCGG - Intergenic
959863784 3:111243311-111243333 GGCCCCCCAAGAGCACAGGGAGG + Intronic
960199362 3:114812729-114812751 GGGCGCCGTGGAGCAGAGGGCGG + Intronic
960754978 3:121001489-121001511 GGCTGCAGTGGAGCACAGCCAGG - Intronic
961385136 3:126518861-126518883 GGCCCTTTTGCAGCACAGGGAGG + Intergenic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
961825363 3:129596479-129596501 GGTCCCAGAGGAGCACAGTGTGG + Intronic
962147633 3:132857068-132857090 GATCCCAGGGGAGCACAGAGTGG + Intergenic
964271165 3:154958283-154958305 GGCCACAGTGATGCAAAGGGTGG + Intergenic
965109382 3:164401964-164401986 GGCCGCACTGGAGCCCACGGAGG + Intergenic
966881631 3:184354108-184354130 GGCCCCAGCCGAGCTCAGGCAGG + Exonic
966933602 3:184691471-184691493 GTCCCCAGTGGGCCACAGAGAGG - Intergenic
967649967 3:191973878-191973900 GGCCCCTCAAGAGCACAGGGAGG + Intergenic
968583428 4:1405209-1405231 GGCCCTACTGAAGCACAGGGAGG - Intronic
968619129 4:1595807-1595829 GGCCCCAGTAGACCACAGATGGG - Intergenic
968753180 4:2401058-2401080 GTCCCCAGGTGAGCACAGTGGGG + Intronic
968816983 4:2827376-2827398 GGCCGCTGTGGAGGAGAGGGAGG + Intronic
968894385 4:3390151-3390173 GGCACCATTGGAGACCAGGGTGG - Intronic
969161242 4:5260897-5260919 GGCTTCAGTGGACCCCAGGGTGG + Intronic
969604961 4:8197774-8197796 GGCCTCAGTGGGGCGGAGGGAGG + Intronic
969689970 4:8698910-8698932 GACCCCTATGGAGCACGGGGTGG - Intergenic
970182630 4:13415669-13415691 GGCCACACAGGAGCCCAGGGTGG - Intronic
972782857 4:42301177-42301199 GGCCCTCTTGAAGCACAGGGAGG - Intergenic
973533017 4:51851651-51851673 GTCCCAGGTGGGGCACAGGGAGG + Intronic
973951133 4:56015479-56015501 TGCCCCTGTGGGACACAGGGTGG + Intronic
975131817 4:70839309-70839331 GGCCCAATAGGAGCACAGGGTGG + Intronic
980628643 4:135406947-135406969 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
981466239 4:145075835-145075857 GGCTACAGTGGAGCACAGCCAGG + Intronic
982770208 4:159390283-159390305 GGCGCCATTGGAGCAGGGGGTGG - Intergenic
984019966 4:174473743-174473765 GGACCCGGAGGAGCAAAGGGGGG + Intergenic
984238769 4:177193228-177193250 GGGCGCAGTGGAGCAGGGGGTGG + Intergenic
985636490 5:1038226-1038248 TGCCACAGTGGAGCACGAGGTGG + Exonic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
985848048 5:2368441-2368463 GGCCGCAGTGCAGCACAGAGGGG - Intergenic
985893951 5:2738490-2738512 GGCCCAAGCGGGGAACAGGGGGG - Intergenic
986428052 5:7654305-7654327 AGCCTCACTGCAGCACAGGGAGG + Intronic
986698046 5:10375485-10375507 GGGCGCCGTGGAGCAGAGGGTGG - Intronic
987109564 5:14672525-14672547 AGACCCAGTGGAACACAGGAAGG - Intronic
987543882 5:19288073-19288095 GGGCGCCGTGGAGCAGAGGGCGG - Intergenic
987908071 5:24105214-24105236 GTCCCCAGTGATGCAAAGGGTGG + Intronic
988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG + Intronic
990323125 5:54649050-54649072 GGCCGCTGTGGAGCAGGGGGCGG + Intergenic
991427128 5:66503563-66503585 GGGCGCAGTGGAGCAGGGGGTGG - Intergenic
991471151 5:66970265-66970287 TGCTCCAGAGGAGGACAGGGTGG + Intronic
991533274 5:67638474-67638496 GGCCCCATTGGAGCACTATGGGG - Intergenic
991995867 5:72386164-72386186 GGCCCCACTGTAGTACAGGGGGG + Intergenic
992865426 5:80952828-80952850 GGGTCCAGTGCAGCACAGAGTGG - Intergenic
993944043 5:94097075-94097097 GGCTACAGTGGAGCACAGCCAGG + Intronic
994251460 5:97541908-97541930 GGGCGCCATGGAGCACAGGGTGG + Intergenic
995745061 5:115394176-115394198 GGCCCCCCAAGAGCACAGGGAGG + Intergenic
997196607 5:131984613-131984635 GGCCCCAGTGGTGCAGAGAGAGG + Intronic
998394780 5:141811655-141811677 GGGCCCAGTGGAACCCATGGGGG + Intergenic
998904434 5:146889305-146889327 GGCTCCAGTGGAACTTAGGGTGG + Intronic
999124054 5:149233450-149233472 GGATCCAGTGGGGTACAGGGAGG + Intronic
999253587 5:150196852-150196874 GGCCTCAGTGGTCCCCAGGGAGG + Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001541273 5:172541430-172541452 GGCCCCACTCAATCACAGGGAGG - Intergenic
1002575405 5:180171167-180171189 GGAGCCAGGGGAGCACAGGGAGG + Intronic
1002789329 6:426232-426254 GGGCGCCGTGGAGCACGGGGCGG + Intergenic
1002897870 6:1389774-1389796 AGCCCCAGAGGAGCTGAGGGAGG + Intergenic
1003641388 6:7878405-7878427 GGCCCCTGTGCTGCACAGGGTGG + Intronic
1003908181 6:10720918-10720940 GGGCCCTGTGGAGCAGGGGGTGG - Intergenic
1004513524 6:16302537-16302559 GGCCACACTGGGGCAGAGGGGGG - Exonic
1005956095 6:30664540-30664562 GGCCACGTTGGAGCATAGGGAGG + Intronic
1005990444 6:30898782-30898804 GGCCTGAGTGGAGCCCAGAGTGG + Intronic
1006457330 6:34139306-34139328 TGCCCCAGAGGAGAGCAGGGAGG + Intronic
1006581293 6:35079214-35079236 GACCTCAGCGGAGCTCAGGGCGG + Intronic
1006646888 6:35521113-35521135 GGGCCCAGTGGACCACAGAGGGG - Intergenic
1006841667 6:37032305-37032327 GGGCCTGGTGGAGCACACGGAGG - Intergenic
1006929821 6:37680958-37680980 GGCCCCAGTAGGGGACAGGGAGG - Intronic
1007826794 6:44606882-44606904 TGGCCCAGTGGAGTACAGAGAGG + Intergenic
1009355560 6:62740177-62740199 GGCTGCAGTGGAGCACAGACAGG + Intergenic
1013025668 6:106269438-106269460 GGGCGCCGTGGAGCAGAGGGCGG + Intronic
1013473491 6:110486842-110486864 GGGCCAAGGGGAGGACAGGGTGG - Intergenic
1013692926 6:112667334-112667356 GGCCCCCTACGAGCACAGGGAGG - Intergenic
1013692962 6:112667507-112667529 GGCCCCTCAAGAGCACAGGGAGG - Intergenic
1014788522 6:125644781-125644803 GGCACCAGTGGAGCAGGGGGTGG - Intergenic
1015749876 6:136549736-136549758 GGGCCCAGTGCAGCACGGTGGGG - Intronic
1016001766 6:139048974-139048996 GGCCCCAGTGCAGTAAAGGCTGG - Intergenic
1016859014 6:148698654-148698676 GGGCGCCGTGGAGCAGAGGGCGG + Intergenic
1017325129 6:153133909-153133931 GGCCGCAGGGGAGCCCATGGAGG - Intergenic
1018064194 6:160114575-160114597 GGCCGCACAGGAGCCCAGGGAGG + Intergenic
1018180171 6:161216479-161216501 TTCCACAGTGGAGCCCAGGGAGG - Intronic
1018434646 6:163749327-163749349 CGCCCCAGTGGAGGCCAGGAAGG + Intergenic
1018628903 6:165805448-165805470 GCCCCCAGTGGAGGACAAAGGGG + Intronic
1018724207 6:166598193-166598215 GGCCAAATTGGAGCACAGGACGG + Intronic
1022588085 7:31634836-31634858 GGCCCCACTGGAGCAGAGTAAGG + Intronic
1022750484 7:33219302-33219324 GGCCGCGGTGGAGCACGGGGCGG - Intronic
1023034053 7:36115572-36115594 GGCATCAGTGGAGCACAGGCTGG + Intergenic
1023079359 7:36513213-36513235 CACCCCTGGGGAGCACAGGGAGG - Exonic
1024229312 7:47352404-47352426 GGCCGTGTTGGAGCACAGGGTGG - Intronic
1024508661 7:50185194-50185216 GGCCCAGGTGGAGCACAAAGAGG - Intergenic
1024886844 7:54152089-54152111 GGCCCCAGTGAAGTTAAGGGAGG + Intergenic
1024967054 7:55033345-55033367 GCTCCCTGTGAAGCACAGGGAGG + Intronic
1026849457 7:73715971-73715993 GGCCCCAGAGTGGCTCAGGGAGG + Intronic
1027175415 7:75899939-75899961 GGGCCTTGTGGAGCACAGAGAGG + Intronic
1027674524 7:81142067-81142089 GGGCCCCGTGGAGCAGGGGGCGG - Intergenic
1031972798 7:128076164-128076186 GAACCCAGGGGAGCACAGGGAGG + Intronic
1032068850 7:128791679-128791701 GGCCCCGGTGGAGGCCAGGATGG - Intronic
1032670103 7:134074563-134074585 GGAGCCAGAGGAGCAAAGGGAGG + Intergenic
1034274196 7:149816918-149816940 ACCCACAGTGGAGGACAGGGAGG - Intergenic
1034275099 7:149820579-149820601 GTCCCCAGTAGGGCAGAGGGAGG + Intergenic
1034500625 7:151448422-151448444 GGCCCCAGCGGAGCTCGGCGGGG + Intergenic
1034850496 7:154488859-154488881 GGTCCCAGTGATGCACAGGATGG - Intronic
1035227234 7:157440452-157440474 GCCCGCAGTGGAGGACAGGCGGG - Intergenic
1035362469 7:158322573-158322595 GGCCCCAGTGGGCAACGGGGAGG + Intronic
1035598875 8:882995-883017 AGCCCGTGTGGAGCACAGGGAGG - Intergenic
1036601425 8:10264544-10264566 GCTCCCAGTGGAGCCCAGGTGGG + Intronic
1040529521 8:48255067-48255089 GACCTCAGTGGAGCACAGCCTGG - Intergenic
1040723169 8:50350246-50350268 GGCTCCGGTGGAGCAGGGGGCGG - Intronic
1041239342 8:55835922-55835944 GGCCCCAGGGGAGCCAAGAGTGG + Intergenic
1041696653 8:60742966-60742988 GGCTGCAGTGGAGGACAGGTTGG - Exonic
1042976812 8:74478680-74478702 GGCTACAGTGGAGCACAGCCAGG - Intronic
1046285006 8:112083051-112083073 GGGCACCGTGGAGCAGAGGGTGG + Intergenic
1047571237 8:126100623-126100645 GGCACCAGTTGTGCACAGGTAGG + Intergenic
1048519621 8:135141545-135141567 GACCCCAAGGGAGAACAGGGAGG + Intergenic
1048971048 8:139645160-139645182 GTCCAGAGTGGAGCACTGGGAGG + Intronic
1049039402 8:140100603-140100625 GGCCCCAATGGTGCCCAGGAAGG - Intronic
1049206063 8:141364116-141364138 GGCCGGAGTGGAGCAGAGTGCGG + Intronic
1049457374 8:142700504-142700526 GTCCCCAGCGGTGCCCAGGGAGG - Exonic
1049740568 8:144239066-144239088 GGCCCCAGTGAAGCGCACAGGGG - Exonic
1049853212 8:144845422-144845444 GGCCCAGGTGGAGCACGGTGGGG + Intronic
1051194312 9:14546835-14546857 GGCCACACTGGGGCAAAGGGTGG + Intergenic
1053010299 9:34629023-34629045 GCCGCCAGAGGAGCACAGGGCGG - Intergenic
1056743790 9:89282711-89282733 GGCCCCACAGGAGCCCATGGAGG - Intergenic
1056986017 9:91364303-91364325 GGCCCCCTAAGAGCACAGGGAGG - Intergenic
1057186566 9:93060375-93060397 AGGCCCAGTGGAGCCCAGGGAGG + Intronic
1057276974 9:93681166-93681188 GGCCCGAGTGCAGCACAGGGCGG - Intergenic
1057561723 9:96133102-96133124 GGCCACAGAGGACCAAAGGGTGG + Intergenic
1059033823 9:110731709-110731731 GGCTCCAGTGTGGCACAGGCAGG - Intronic
1059380528 9:113919981-113920003 GGCCCCTGTGTAGCCCAGGCTGG - Intronic
1060015361 9:120081915-120081937 TGCCCCAGTGGATAAGAGGGAGG + Intergenic
1060713349 9:125892922-125892944 AGCCACAGGGGAGCACAGCGAGG - Intronic
1061295010 9:129672215-129672237 TGCGCCAGTGGAGCAGAAGGGGG + Intronic
1061563235 9:131420014-131420036 ACCCCCAGTGGAGAACTGGGGGG - Intronic
1061798702 9:133102905-133102927 GGCCAGAGGGAAGCACAGGGCGG + Intronic
1062052275 9:134453802-134453824 GGCCCCAGGTGAGCACTGGCCGG + Intergenic
1062146166 9:134991065-134991087 GGGCACAGTGGAGCAGGGGGCGG + Intergenic
1062212314 9:135371808-135371830 GGCCCCAGAGCAGCCCACGGAGG + Intergenic
1062250525 9:135591648-135591670 GGCCCCAGTGCTGCCCAGAGCGG + Intergenic
1062270476 9:135705931-135705953 GGCCTCACTGGAGCAGAGGTGGG + Intronic
1062292559 9:135803361-135803383 GGCCTCAGTGGAGCTCACGGGGG - Intergenic
1062339235 9:136086551-136086573 GGTCACAGTGGAGCCCGGGGTGG - Intronic
1062693211 9:137856442-137856464 GGCCCTAGAGGAGCACATGCAGG + Intronic
1062711261 9:137976352-137976374 CTCCCCAGTGGAGCTCAGGGGGG + Intronic
1185595094 X:1301493-1301515 TTTCCCAGTGGAGCAGAGGGAGG - Intronic
1186505931 X:10092189-10092211 GGCCCTAGTGCTGCACATGGTGG + Intronic
1187486079 X:19705610-19705632 GTCCCCAGTGTGGCACTGGGAGG - Intronic
1190594833 X:52042071-52042093 GGCCACAGAGGAGAAAAGGGAGG + Intergenic
1190595890 X:52052417-52052439 GGCCACAGAGGAGAAGAGGGAGG + Exonic
1190612934 X:52201656-52201678 GGCCACAGAGGAGAAGAGGGAGG - Exonic
1190613991 X:52212002-52212024 GGCCACAGAGGAGAAAAGGGAGG - Intergenic
1190741572 X:53292216-53292238 GGGCCTAGTGGATCACAGTGAGG + Intronic
1190973739 X:55379253-55379275 GGCTGCAGTGGAGCACAGCCAGG + Intergenic
1191218968 X:57965360-57965382 GGACTGAGAGGAGCACAGGGAGG + Intergenic
1191714136 X:64182560-64182582 GGCCCTGGTGGAGTCCAGGGTGG - Intergenic
1192224430 X:69218467-69218489 GGCCCCAGAGGCGCCCAGGTGGG + Intergenic
1193170834 X:78333628-78333650 GTTCCCAGTGCAGTACAGGGTGG - Intergenic
1194268234 X:91780161-91780183 GCCCCCAGAGGAGCGCAGGGAGG - Intronic
1194890445 X:99372104-99372126 GGGCGCAGTGGAGCAGGGGGCGG + Intergenic
1196741558 X:119029842-119029864 GGCGCCAGTGGAGCAGGGGGTGG - Intergenic
1197340097 X:125255975-125255997 GGGCGCCGTGGAGCAGAGGGCGG - Intergenic
1197865748 X:131014859-131014881 GGTCCCAGTGCAGCAATGGGGGG + Intergenic
1198683403 X:139204520-139204542 GGCCCGCGCGGAGCCCAGGGAGG - Intronic
1199331491 X:146565833-146565855 GGCCCCAGGGGAGCACTGGGAGG - Intergenic
1199615503 X:149652180-149652202 GGCCTCAGGGGAGCAGAAGGTGG - Intergenic
1199912996 X:152307946-152307968 GGCTACAGTGGAGCACAGCCAGG + Intronic
1200018059 X:153180520-153180542 GGCCTCAGGGGAGCAGAGGGAGG + Intronic
1200158214 X:153989540-153989562 GGCCCCAGTGGAGGTCAAGTGGG - Intergenic
1200585436 Y:5001082-5001104 GCCCCCAGAGGAGCGCAGCGAGG - Intronic
1201887952 Y:18907191-18907213 GCTCCCAGTGCAGAACAGGGAGG - Intergenic
1202137059 Y:21676738-21676760 GGCCGCACAGGAGCCCAGGGAGG + Intergenic