ID: 961414149

View in Genome Browser
Species Human (GRCh38)
Location 3:126745195-126745217
Sequence TTATTAAAGAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 731}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961414143_961414149 0 Left 961414143 3:126745172-126745194 CCCCAAACAAAATCAGGATTATG 0: 1
1: 1
2: 4
3: 42
4: 294
Right 961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 81
4: 731
961414144_961414149 -1 Left 961414144 3:126745173-126745195 CCCAAACAAAATCAGGATTATGT 0: 1
1: 1
2: 10
3: 73
4: 402
Right 961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 81
4: 731
961414145_961414149 -2 Left 961414145 3:126745174-126745196 CCAAACAAAATCAGGATTATGTT 0: 1
1: 2
2: 7
3: 54
4: 323
Right 961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 81
4: 731
961414141_961414149 16 Left 961414141 3:126745156-126745178 CCTGGACACGTGACTGCCCCAAA 0: 1
1: 0
2: 2
3: 6
4: 100
Right 961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG 0: 1
1: 0
2: 4
3: 81
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961414149 Original CRISPR TTATTAAAGAAGAGGGAAGA GGG Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901811623 1:11770118-11770140 TTTTTAAAAAAAAGGGAAAATGG + Intronic
902768201 1:18630746-18630768 TTATTCATGAGGAGGGAAGGGGG - Intergenic
902846443 1:19114401-19114423 ATATTAAAGAACAGTGAAAAAGG - Intronic
902971548 1:20056083-20056105 TTTTAAAAGAAGGGGAAAGAGGG - Intronic
902972825 1:20067337-20067359 TGTCTAAAGAAGAGAGAAGAGGG + Intronic
903660950 1:24978302-24978324 TCATGAGAGAAGAGGGAATAGGG - Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904294776 1:29512727-29512749 TTATTAACGAGGAGGGTAAAGGG + Intergenic
905235998 1:36548696-36548718 TTATTAAAGAAGTTGGAGGGAGG + Intergenic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
905826624 1:41030446-41030468 TTATTCAAGAAGCAGAAAGAAGG - Intronic
906094259 1:43210009-43210031 TGAATAAATAAGAGAGAAGAAGG - Exonic
906469295 1:46114289-46114311 TACCTAAATAAGAGGGAAGAGGG + Intronic
906895988 1:49773016-49773038 TGATTAAAAAAGAATGAAGAAGG - Intronic
906980721 1:50625581-50625603 TAATTAAAGAGGAGGGTAGGCGG + Intronic
907814687 1:57906686-57906708 TAAGTGAAGATGAGGGAAGAGGG + Intronic
908278484 1:62502766-62502788 TTTTTAAAGGGGAGGCAAGAGGG + Intronic
908720426 1:67119828-67119850 TTTTTCAAGACAAGGGAAGAAGG + Intronic
908868591 1:68581472-68581494 TTATTAAAGAATAAAAAAGAAGG + Intergenic
908924731 1:69240690-69240712 TTTATAAAGTAGAGGCAAGAAGG + Intergenic
909218720 1:72926857-72926879 TTCCTAAGGAATAGGGAAGAAGG - Intergenic
909254407 1:73401169-73401191 TTATGAGAGAAAAGGGAAAAAGG + Intergenic
910147093 1:84093141-84093163 TTCTTAAAGAAGACCGAGGAAGG - Intronic
910168648 1:84354508-84354530 TTTTTAAAGAAGTGGGAAAAGGG + Intronic
910257979 1:85268467-85268489 TTATTAAAGACGAGAAAAAAGGG + Intronic
910799113 1:91128254-91128276 TTATTAATGAACGGGGAACATGG - Intergenic
911891042 1:103372187-103372209 TGCTTAAATAAGAGGGAGGAAGG - Intergenic
911957870 1:104261104-104261126 TTGACAAAGAAAAGGGAAGATGG - Intergenic
911976415 1:104502447-104502469 GTAACAAAGAAAAGGGAAGATGG + Intergenic
912069066 1:105785234-105785256 GCATTAAAGATGAAGGAAGATGG + Intergenic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
913223133 1:116675415-116675437 ATCTGAGAGAAGAGGGAAGAAGG + Intergenic
913457982 1:119053213-119053235 TTAAAAAAGAAGAGGAAAAATGG + Intronic
913646908 1:120865721-120865743 CTATTAACAAAGAAGGAAGAGGG + Intergenic
913667118 1:121058577-121058599 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
914018810 1:143845729-143845751 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
914079740 1:144397142-144397164 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914174641 1:145265680-145265702 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914432580 1:147632385-147632407 TAAATAAATGAGAGGGAAGAAGG + Intronic
914529368 1:148507168-148507190 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914657362 1:149753932-149753954 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
914909172 1:151770329-151770351 TTTTTAAAGACAGGGGAAGAGGG - Intronic
915059245 1:153166527-153166549 GTATCAAGGAAGAGAGAAGAAGG - Intergenic
917917242 1:179714727-179714749 ATTTTAAAAAAGAGTGAAGAAGG - Intergenic
918056450 1:181025647-181025669 TGATGAAAGAAGAGGGAGGAAGG + Intergenic
918664063 1:187126313-187126335 TTATTAAAGAAGCAAGAAAATGG + Intergenic
919229761 1:194758819-194758841 TTATTCAGGAAGATGGAAGGAGG - Intergenic
919438201 1:197590824-197590846 TTATTGAAGAAGAGGAAGAAAGG - Intronic
919466061 1:197922383-197922405 TTTTTAATGAAGAGAGAAGGTGG - Intronic
919644940 1:200086257-200086279 TTATTAATGGAGAGGTAAGAGGG + Intronic
919645991 1:200095103-200095125 TTATTAAAAAGGAGGTCAGATGG - Intronic
919722943 1:200860159-200860181 TTATTAATGCAGAAGGAATATGG + Exonic
920142113 1:203823970-203823992 TTAAAAAAGGAGAGGGAAGCCGG + Intronic
920333454 1:205228444-205228466 TTATTAACAAGGAGGGGAGATGG - Exonic
920952978 1:210590272-210590294 TCATGAAAAGAGAGGGAAGAAGG - Intronic
920954591 1:210606607-210606629 TTGTTAAAGGAGAGAGGAGAAGG - Intronic
920957448 1:210632522-210632544 TTGGCAAAGAAAAGGGAAGATGG + Intronic
921035902 1:211377839-211377861 GAATTAAAGAAGAGAGAGGAGGG + Intergenic
921382546 1:214539691-214539713 GCAATAAAGAAGAGGGAGGAGGG + Intronic
922009764 1:221571193-221571215 GTGTTAAAGATGAGGAAAGAGGG - Intergenic
922277756 1:224095001-224095023 TTCTTTAATAAGAGGGAATAAGG - Intergenic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
1062782425 10:226448-226470 ATATTAAAGAGGAGGAAATAGGG - Intronic
1063143023 10:3272686-3272708 TTTTTAAAGAACATGGACGAAGG - Intergenic
1063297178 10:4818185-4818207 AAATAAAGGAAGAGGGAAGAAGG + Intronic
1063595912 10:7435442-7435464 ACAATAAAGAATAGGGAAGAGGG - Intergenic
1063688259 10:8258908-8258930 TAACTAGAGCAGAGGGAAGAAGG + Intergenic
1064215956 10:13400818-13400840 TTGATAAAGAAAAGGGAAAAGGG + Intergenic
1064836279 10:19534609-19534631 TTATTAGAGAAGGGGGAAAAAGG - Intronic
1064952861 10:20873517-20873539 AGATTAAAGAAGAAGAAAGAAGG + Intronic
1065316088 10:24465326-24465348 TTATTAAAGAAGGGGGCAAATGG - Intronic
1065496855 10:26338073-26338095 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1066660463 10:37734579-37734601 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1067032444 10:42887131-42887153 TTATTGAGGAAGAGAGTAGAAGG - Intergenic
1067230486 10:44404853-44404875 TTATTCAGGAAGAGGGAATATGG - Intergenic
1068468358 10:57426163-57426185 TTATTAAAGAATATGGATGATGG + Intergenic
1068748113 10:60558550-60558572 TTATTTAGGAGGAGGGAATAGGG - Intronic
1068850529 10:61734495-61734517 TTATTCAAGAAGTAGGAAGGGGG + Intronic
1069200802 10:65613425-65613447 TTAATGAAAAAGAGGGAAGCAGG - Intergenic
1069287700 10:66736553-66736575 TTATTAATAAACAGGTAAGATGG - Intronic
1069338191 10:67378580-67378602 TTATGAAAGAACAGGAAAGATGG - Intronic
1069489410 10:68848457-68848479 ATATTTAAGAAGGGGGAGGAGGG + Intronic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1071240646 10:83701142-83701164 TTGACAAAGAAAAGGGAAGATGG - Intergenic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071794207 10:88988181-88988203 ATAGTTAAGAAGAGGGGAGAGGG + Intronic
1071852669 10:89590882-89590904 TTAGCAAAAAAGAGGGAAGAAGG + Intronic
1071955275 10:90751102-90751124 TTATTAAGGAAAAGGGGAGGCGG - Intronic
1072017975 10:91368703-91368725 TTATTCAAAAAGAAGGAAGGAGG + Intergenic
1072120651 10:92402956-92402978 TTGACAAAGAAAAGGGAAGATGG - Intergenic
1072498504 10:95987775-95987797 TTATTACTGAAGAGGAAAGTGGG + Intronic
1072701790 10:97647340-97647362 ATATTAAAGAAGAGAGTGGATGG + Intronic
1072988933 10:100170932-100170954 ATTTCAAAGAAGGGGGAAGATGG + Intronic
1074016948 10:109544004-109544026 TTTTTAAAGACAAGGGCAGAAGG + Intergenic
1074276672 10:112009098-112009120 TTTTTAAAGATGAGGGAACTGGG - Intergenic
1074691716 10:116011678-116011700 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1074863237 10:117529100-117529122 GCATTAAAGAAGAGGGAGGCTGG + Intergenic
1075064357 10:119279478-119279500 TGATGAAAGAAGATGGAAGGAGG + Intronic
1075499580 10:122960638-122960660 TTAGTAAAGAAGGGAAAAGATGG + Intronic
1075828925 10:125387050-125387072 TTAGTAAAGACGAGTAAAGATGG + Intergenic
1076238426 10:128883726-128883748 TTATTAGTGAAGCAGGAAGAAGG - Intergenic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1076617238 10:131763464-131763486 TGATGCAAGAAGAGTGAAGATGG + Intergenic
1077473137 11:2774155-2774177 ATCTTACAGAAGAGAGAAGAAGG + Intronic
1077794315 11:5475706-5475728 ATATTAAAGAATAGGAGAGATGG - Intronic
1078005018 11:7526156-7526178 TTATGAAATAACAGGGAGGAAGG + Intronic
1078155601 11:8797476-8797498 GGAAGAAAGAAGAGGGAAGAAGG - Intronic
1078197279 11:9146470-9146492 TATTTACAGAAGAGGGAAGAGGG - Intronic
1078286712 11:9963682-9963704 GAATTAAAGAAGAGAGAAGCTGG + Intronic
1078685264 11:13524296-13524318 TTAGCAAAGAAGTGGGAGGAAGG - Intergenic
1078969736 11:16394169-16394191 TCATTGAAGAAGATGGAAAAAGG + Intronic
1079674578 11:23209799-23209821 TTATTACAGAAAAAGGATGAGGG - Intergenic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1079794400 11:24781604-24781626 TTTTTAAAGAAAATGGAAAATGG - Intronic
1079864270 11:25715830-25715852 TTTTAAAAGAAGAGGAAATAGGG + Intergenic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1080280678 11:30553251-30553273 TTTTTAAAAAAGAAGGCAGAAGG + Intronic
1080449296 11:32365418-32365440 TTGATAAAGGAAAGGGAAGATGG + Intergenic
1080678359 11:34449077-34449099 AAATTAAAAAAGAGGGCAGATGG + Intronic
1080714014 11:34780611-34780633 TTAAAGAAGAAGAGGAAAGATGG - Intergenic
1080968035 11:37236641-37236663 TTATTAAAGTGAAGGGAAAATGG + Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081183745 11:40017285-40017307 CTACTAAAGAAGAGGGTAGTGGG + Intergenic
1081271712 11:41093166-41093188 TTATTAAAGAACAGAGGAGTTGG - Intronic
1081308230 11:41539678-41539700 TTTTTAAAAAATAGGAAAGAAGG + Intergenic
1081944700 11:46980103-46980125 TTAGGAAAGAGAAGGGAAGAGGG + Intronic
1082120979 11:48379374-48379396 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1082121694 11:48385912-48385934 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1082178302 11:49087650-49087672 TTATTTAAGGAGAGTGCAGAGGG + Intergenic
1082555678 11:54560167-54560189 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1083511026 11:63209523-63209545 TTAGAAAAAAACAGGGAAGATGG + Intronic
1084327627 11:68410972-68410994 TGCTAAAAGAAGAGGGAAGGAGG + Intronic
1084670540 11:70604168-70604190 TTATTAAAGGAGGGAGGAGAAGG - Intronic
1085039644 11:73319360-73319382 TTCTTAAAGAAGGAGGAAGGAGG - Intronic
1086518887 11:87646427-87646449 GTATCAAAGAAGAAAGAAGAAGG - Intergenic
1086686772 11:89742179-89742201 TTATTTAAGGAGAGTGCAGAGGG - Intergenic
1086855017 11:91855692-91855714 TTAGTGAAGAGAAGGGAAGAAGG - Intergenic
1086941411 11:92801948-92801970 TTATAAAGAAAGATGGAAGATGG + Intronic
1087090117 11:94261607-94261629 TGAATAAAAAAGAGTGAAGAAGG - Intergenic
1087197500 11:95315807-95315829 TTTTTAAATAAGTGCGAAGAGGG - Intergenic
1087654107 11:100902046-100902068 TTATTAAAAAAGAAAAAAGAGGG - Intronic
1087990970 11:104744869-104744891 TAAGGAAAGAAGAGGCAAGAAGG + Intergenic
1088102697 11:106172529-106172551 TTTTTAAAGCAAAGGGAACAAGG - Intergenic
1088150708 11:106741478-106741500 GTATCAAAGGAGAAGGAAGAAGG + Intronic
1088296617 11:108304289-108304311 ATATGATAGAAGAGGGAAAAAGG - Intronic
1088799843 11:113295676-113295698 CTGTTAAAGAGAAGGGAAGATGG - Intergenic
1088891678 11:114049589-114049611 TGATTAATCAACAGGGAAGAAGG + Intergenic
1089522863 11:119077228-119077250 TCATAAAACAAGAGGGGAGATGG - Intronic
1089927414 11:122272989-122273011 TTATGAAAGAGGAGAGAACATGG + Intergenic
1090619325 11:128547789-128547811 TTTTTAAAAAATAGGGATGATGG + Intronic
1090847346 11:130541885-130541907 GCATTAAAGAAGAGGCCAGAAGG - Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091385386 12:91463-91485 TTCTTAAAGAACCAGGAAGATGG - Intronic
1091678020 12:2505399-2505421 TTATTTAAGAATAGAGGAGATGG + Intronic
1091684833 12:2554368-2554390 TTCTTGAAGAAGAGCGAGGAGGG - Intronic
1091988235 12:4931702-4931724 TTATTAATGATGAGGTAGGAGGG - Intergenic
1092480632 12:8856082-8856104 GTTTTACAGAAGAGGAAAGAAGG - Intronic
1092955178 12:13542943-13542965 TTTTTAAAAAGGAGGGAGGATGG - Exonic
1092989673 12:13883584-13883606 CTACTAAAGAAGAGATAAGATGG - Intronic
1093086434 12:14870487-14870509 ATATTAAGGAAGAGTCAAGATGG + Intronic
1093378165 12:18456635-18456657 TTGACAAAGAAAAGGGAAGATGG + Intronic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094488267 12:30941910-30941932 ATTTAAAAGAAGTGGGAAGAAGG - Intronic
1094596607 12:31871923-31871945 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1095361413 12:41345357-41345379 TCAGTAAAGAAGTGAGAAGAGGG - Intronic
1095381275 12:41596198-41596220 TAACAAAAGAAGAGGGAAAAGGG - Intergenic
1095381497 12:41599328-41599350 TTTTGAAAGTAGAGGAAAGAAGG - Intergenic
1095394323 12:41744731-41744753 CTATTAAAGAAGAAGAAAGTAGG + Intergenic
1095726635 12:45460958-45460980 GGATTAGAGAAGAGGGAAGATGG + Intergenic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1095916648 12:47486680-47486702 GTATGAAAGGAGAGGGCAGAGGG - Intergenic
1095929106 12:47607925-47607947 TTCTTCAAGACAAGGGAAGAAGG - Intergenic
1096014125 12:48252151-48252173 TTAGTAAAGAAGATGGAAGGAGG - Intergenic
1096393280 12:51246381-51246403 TTCTTAAAGAAACGGGAAGGAGG + Intronic
1096756876 12:53806947-53806969 TTATGATAGAAGAGTGAAGGGGG + Intergenic
1096958533 12:55552365-55552387 TTATTAGAGAAGAGTGAATGGGG + Intergenic
1097331656 12:58338310-58338332 TTTTGATAGAAGAGGGAAGAAGG - Intergenic
1097628886 12:62035484-62035506 AAATGAAAGAAGTGGGAAGAGGG + Intronic
1097927868 12:65150448-65150470 AAATTAAAGGAGAGGGAAGAAGG - Intergenic
1098217096 12:68232349-68232371 TTATTAATCCAGAGGCAAGATGG - Intergenic
1099448310 12:82778319-82778341 AAATTGAAGAACAGGGAAGATGG - Intronic
1099767815 12:87012070-87012092 CTAGTAAATAAGTGGGAAGAAGG - Intergenic
1100045025 12:90369207-90369229 TTTTCAAAGAAGATAGAAGAGGG + Intergenic
1100052033 12:90460618-90460640 ATATTAAAGAAGGAGGACGAAGG + Intergenic
1100815761 12:98385749-98385771 TTGACAAAGAAAAGGGAAGAGGG - Intergenic
1101057335 12:100932144-100932166 TCATTGAAGAAGACAGAAGAGGG - Intronic
1101060170 12:100962856-100962878 GTATTCAAGAAGAGAGATGATGG + Intronic
1102225624 12:111226247-111226269 TTATCAAAGAGGAGGGAGGATGG - Intronic
1103236612 12:119378223-119378245 TTGACAAAGAAAAGGGAAGATGG + Intronic
1103759544 12:123238398-123238420 TTCTTAAGGAAGAGACAAGACGG + Intronic
1103886603 12:124207143-124207165 ACATTAAAGAAGAGAGGAGAAGG - Intronic
1104097141 12:125568225-125568247 TAAAAAAAGAAAAGGGAAGAGGG - Intronic
1104098294 12:125581635-125581657 TCACTAAAGAGGAAGGAAGAGGG + Intronic
1104781758 12:131426013-131426035 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1105340404 13:19517831-19517853 TCATTAAAGATGAGGGAGAAGGG + Intronic
1105609204 13:21953145-21953167 TTAATAAAGAAGGGCTAAGAAGG + Intergenic
1105756370 13:23467649-23467671 TCATGAAAGAAGACAGAAGACGG + Intergenic
1105924217 13:24992330-24992352 TTATTAAAGGAGGGGGAATAGGG - Intergenic
1105943598 13:25171390-25171412 TTATTCAAGAAGAGGAAATCGGG - Exonic
1106036202 13:26047681-26047703 TTGCTAAGGAAGAGTGAAGAGGG - Intronic
1106865069 13:33955171-33955193 TTAATGAACAAGAGTGAAGAAGG + Intronic
1106875500 13:34067614-34067636 TTAATAAAGAAAAGAGAGGAGGG + Intergenic
1107062912 13:36179939-36179961 TTCTTACAGAAGTGGGAGGAGGG - Intronic
1107704966 13:43093187-43093209 TTAAGAAAACAGAGGGAAGATGG - Intronic
1107762289 13:43692774-43692796 TTATTGAAGACGTGGGAAAATGG + Intronic
1108153553 13:47562105-47562127 CTATTAAAGAAAAAAGAAGATGG + Intergenic
1108634969 13:52323994-52324016 TCATTAAAGATGAGGGAAAAGGG + Intergenic
1108652838 13:52499194-52499216 TCATTAAAGATGAGGGAAAAGGG - Intergenic
1108691657 13:52864512-52864534 TTATTAAAACAGGTGGAAGATGG + Intergenic
1109379408 13:61540214-61540236 TTAGTAAATGAGAGGGATGAAGG + Intergenic
1109444002 13:62409036-62409058 TTAATAAAGCTGAGGGAAAAAGG + Intergenic
1109588901 13:64448973-64448995 TTATCTGAGAAGAGGTAAGATGG + Intergenic
1109825598 13:67716837-67716859 TTGATAAAGAAAAGAGAAGATGG + Intergenic
1110107352 13:71694070-71694092 TTATGAATGCAGAGGCAAGATGG + Intronic
1110240469 13:73260903-73260925 TTATGAAAGAAAAGGGAATGAGG + Intergenic
1110352854 13:74529943-74529965 TTAATGAAGAAGGAGGAAGATGG - Intergenic
1110745142 13:79043584-79043606 TTAATAATAAAGAGGGTAGAAGG + Intergenic
1111024612 13:82502883-82502905 GTAACAAAGAAAAGGGAAGATGG + Intergenic
1111178372 13:84628816-84628838 TTATTAAATTAGAAGCAAGAGGG - Intergenic
1111325286 13:86686348-86686370 TGATTGAAGAAGAGGGCAGGAGG + Intergenic
1111407720 13:87831728-87831750 TTATTAAAGGAAAAGGAAAAAGG - Intergenic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112317108 13:98372619-98372641 TAATAAGAAAAGAGGGAAGATGG + Intronic
1113124414 13:106960884-106960906 TTTTTAAAGTAGAAGGAAGCAGG + Intergenic
1113934004 13:113983836-113983858 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1113934357 13:113985834-113985856 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1113934701 13:113987824-113987846 TTCTTCAAGACGAGGGAAGAAGG + Intronic
1115117959 14:29905537-29905559 TTATTAAAGAACTGAGAAGCTGG - Intronic
1115122113 14:29949993-29950015 TCAGTAATGAAGAGGGAATAGGG + Intronic
1115141156 14:30172820-30172842 TAAATATGGAAGAGGGAAGAAGG + Intronic
1115342258 14:32305055-32305077 TTAGTAAAGAAAATGGAAGCTGG + Intergenic
1115539935 14:34411096-34411118 TTATTTAAATAGAGTGAAGAAGG + Intronic
1115709271 14:36032461-36032483 TTATGAAAGTAGAGGGAAAGGGG + Intergenic
1115752024 14:36503622-36503644 TTATTTTTGAAGGGGGAAGAGGG - Intronic
1116174503 14:41450274-41450296 TTCATAAGGAAGGGGGAAGAGGG - Intergenic
1116851162 14:49910814-49910836 TTATTAAACTAGAGGGAAGAAGG - Intergenic
1117870124 14:60191889-60191911 TTGTTAGAGAAGAAGGAAAAGGG + Intergenic
1117993693 14:61459096-61459118 GTATCAATGAAGAGGGAAAATGG + Intronic
1119490617 14:75029494-75029516 TGAGTACAGAAGAGGGGAGAAGG - Intronic
1119584880 14:75823872-75823894 TTGTTGAATAAGAGGGCAGAAGG - Intronic
1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG + Intronic
1120153603 14:81065409-81065431 ATATCTAAGAAGATGGAAGATGG + Intronic
1120415789 14:84216704-84216726 TTCTTCAAGATAAGGGAAGAAGG + Intergenic
1120434680 14:84466342-84466364 TTCTTTAAGATGAGGAAAGAGGG + Intergenic
1120815577 14:88854312-88854334 GTATTAAAGAACAGAAAAGAAGG - Intronic
1120928176 14:89819333-89819355 TTATCTGAGAAGAGGGAAGGGGG + Intronic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1122134285 14:99623957-99623979 TTATTGAAGGAAAAGGAAGATGG + Intergenic
1123393416 15:19899944-19899966 TTATTAAAGAAGAACTAAGTTGG + Intergenic
1123792328 15:23734265-23734287 AGAAGAAAGAAGAGGGAAGATGG + Intergenic
1124274699 15:28316277-28316299 TTATTAAAAAAAAAGGAAAAGGG - Intronic
1124376717 15:29133243-29133265 TTGGTAAAGAGGAGAGAAGATGG - Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124877125 15:33605440-33605462 TAATTGGAGAAGTGGGAAGAAGG + Intronic
1125002933 15:34790322-34790344 TGATGAAAGATGAGGGAAGGTGG + Exonic
1125006619 15:34824202-34824224 ACATTGAAGAAGAGGGCAGAGGG + Intergenic
1125220630 15:37329607-37329629 TTATTAATGAAGAAAAAAGATGG + Intergenic
1125419412 15:39489117-39489139 CTAGTAAGGAAGAAGGAAGAAGG + Intergenic
1125427904 15:39568064-39568086 TTTTTAATGAAGAGGGTATAAGG - Intergenic
1126332411 15:47547602-47547624 CTATTAAAGAAGAACAAAGATGG - Intronic
1126885959 15:53150311-53150333 TTGACAAAGAAAAGGGAAGATGG - Intergenic
1127166408 15:56248194-56248216 AGATTACAGAAGAGGGAAGTTGG + Intronic
1127569326 15:60225857-60225879 TTATGAAAGAAGAGGAAACCAGG - Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1127743078 15:61932939-61932961 TTATTAGTGGAAAGGGAAGATGG + Intronic
1128106955 15:65052092-65052114 TTATTAAGGAAGTGGGCAGTGGG + Intronic
1128149930 15:65356293-65356315 TGGGAAAAGAAGAGGGAAGATGG + Intronic
1128182788 15:65619694-65619716 TTATTAAAACAGAAAGAAGAGGG - Intronic
1129227273 15:74177251-74177273 TTAGGAATGAAGAGGAAAGAGGG + Intergenic
1129344072 15:74905780-74905802 TGATTAAATAAGTGGGGAGAGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129593733 15:76942239-76942261 TTATTCTAGAAGACTGAAGAGGG + Intronic
1129821105 15:78602575-78602597 TAATTAAAGAAATGGGAGGAAGG + Intronic
1130677541 15:85966824-85966846 TTCTCTAAGAAGAGGCAAGATGG - Intergenic
1130854027 15:87824980-87825002 TTATTAATGAAGAGGAAAAATGG - Intergenic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131450245 15:92533315-92533337 TTATTAAAGAAGTGGAGAGCAGG + Intergenic
1133260061 16:4543332-4543354 ATATGAAAGAGGAGGGCAGAGGG + Intergenic
1133362846 16:5187628-5187650 TTTACAAAGAAAAGGGAAGATGG + Intergenic
1133545571 16:6802928-6802950 TATTTATTGAAGAGGGAAGATGG + Intronic
1133562506 16:6963078-6963100 TCAGTAAAGGAGAGGGAAGGTGG - Intronic
1133668669 16:7995966-7995988 GCATTAAAGATGAGGGAATATGG + Intergenic
1134168528 16:11949746-11949768 GTGTTAAAGAAGAGGGAGCAAGG - Intronic
1134297716 16:12961614-12961636 TGAAGAAAGAAGGGGGAAGAAGG + Intronic
1134365531 16:13574225-13574247 TTATTTAAATAGAGGGATGAGGG - Intergenic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1135685512 16:24495383-24495405 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1136108451 16:28048915-28048937 TTTTTAAAAAAGATGGAGGAGGG + Intronic
1136562679 16:31049680-31049702 TTTGTAAGGAAGAGGGCAGACGG + Intergenic
1137279921 16:46967387-46967409 TTATTAAAGAAAAAGGAGGCCGG - Intronic
1137467145 16:48720176-48720198 GTATAAAAGAAGAGGGATAAAGG + Intergenic
1137902609 16:52285313-52285335 TTATCAAAGGTGAGGGAACATGG - Intergenic
1138662834 16:58534592-58534614 TTAATGTAGAACAGGGAAGATGG + Intronic
1138847776 16:60587585-60587607 ATATAAAACAAGAGGGAAAAGGG - Intergenic
1139152726 16:64403317-64403339 TTACTAAAGAAGTAGGAGGAGGG + Intergenic
1139263549 16:65618648-65618670 TAATTAAAGCACAGGGCAGAGGG + Intergenic
1139401466 16:66685222-66685244 TTATTAGAGAATAGAGCAGAAGG - Intronic
1139541467 16:67620548-67620570 CAAATAATGAAGAGGGAAGAAGG + Intronic
1139642393 16:68301819-68301841 ATATTAAAGAAGAGAGAAGAAGG - Exonic
1140162331 16:72510631-72510653 TTATTACAAAAGAAGGGAGAAGG + Intergenic
1140765852 16:78156420-78156442 TTATTATAAAGGAAGGAAGAGGG + Intronic
1140768405 16:78181036-78181058 TTATGAAACAAAAAGGAAGAAGG - Intronic
1140850302 16:78929407-78929429 TTACTAAAGAATAGGAAAGAAGG + Intronic
1141052370 16:80782124-80782146 TTAATAAAGAAAAATGAAGAAGG + Intronic
1141413819 16:83854740-83854762 TCAAGAAAGAAAAGGGAAGATGG + Intergenic
1141966092 16:87444735-87444757 TCATGAAAGACAAGGGAAGATGG + Intronic
1143888994 17:10087971-10087993 TCAGTAAATAAAAGGGAAGAAGG + Intronic
1145118038 17:20230048-20230070 TTATTCAGGAAGAGGAAAAAAGG + Intronic
1145212691 17:21026622-21026644 TTTTTAAAGAAGTGAGATGAGGG - Intronic
1145410148 17:22653188-22653210 TTATAAAAGAAGCAGGAATATGG + Intergenic
1145749592 17:27345724-27345746 TTGGCAAAGAAAAGGGAAGATGG + Intergenic
1145774467 17:27518374-27518396 TTCTTAAAGAAAAAGGCAGAAGG + Intronic
1146105217 17:30028861-30028883 TTCTTAAAGAAGAGGAAATTTGG - Intronic
1146130292 17:30267608-30267630 TTAATAATGAAGATGGAAGAAGG - Intronic
1146785564 17:35717814-35717836 TTATTAAAGGTGAGGCAAAATGG + Intronic
1147845957 17:43403982-43404004 CTAATCAAGGAGAGGGAAGAGGG - Intergenic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1149116924 17:53108561-53108583 TTATTAGAGAAGAGGGGTAAAGG + Intergenic
1149691162 17:58578063-58578085 TTAATAAAGAAGGGGGCAGATGG + Intronic
1150929903 17:69573183-69573205 TTCTTAAAGGAGGAGGAAGAGGG - Intergenic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1151095084 17:71488153-71488175 TTTTTAAAAGAGAGAGAAGATGG - Intergenic
1151140831 17:71990733-71990755 TTCTAAAAAAAGAGAGAAGAAGG - Intergenic
1152506269 17:80750774-80750796 TTTTTAAACAAGAGGGAAGAGGG - Intronic
1153036330 18:766079-766101 TTATCAAAGAAGAGGAAGAATGG - Intronic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153445533 18:5168409-5168431 GTATTGTAGAAGAGGAAAGATGG + Intronic
1154046931 18:10915052-10915074 TTATTAGAGAGGAGGGAAAATGG - Intronic
1154061437 18:11064387-11064409 TGGTAAAAGAGGAGGGAAGAAGG - Intronic
1154174731 18:12077976-12077998 TTATTAGAGAGGAGGGAAAATGG + Intergenic
1155218568 18:23664020-23664042 TTAATTGAGAAGAGGGAAGGAGG - Intergenic
1155448907 18:25943103-25943125 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1155468360 18:26164294-26164316 TAATAAAAGAAAAGGGGAGAGGG + Intronic
1156284738 18:35680683-35680705 TTATTAAAGAAGTATGAAGTAGG + Intronic
1156715644 18:40006718-40006740 TTAGAAAGGAAAAGGGAAGATGG - Intergenic
1156939017 18:42742355-42742377 TTAGGGAAGAAGAGGGATGAGGG - Intergenic
1157508666 18:48251612-48251634 TTGACAAAGAAAAGGGAAGATGG - Intronic
1157704486 18:49791785-49791807 TTACTAAAGAACAAGGAAAAGGG + Intronic
1158089467 18:53693992-53694014 ATAGTCAAGAAGAGGCAAGAAGG + Intergenic
1158091950 18:53725384-53725406 TTATTAAAAAATACAGAAGAAGG + Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158402930 18:57137480-57137502 TTAATAAAGAAAAGCGAACATGG + Intergenic
1158915453 18:62122033-62122055 TTAGAAAAGTAGAGGGGAGAAGG + Intronic
1159197059 18:65130935-65130957 TAATTAAAAACAAGGGAAGATGG - Intergenic
1159283546 18:66318837-66318859 TTAATTAAGAAGAGAGAAAATGG - Intergenic
1160044677 18:75375758-75375780 TTATTTAGGAAGAGGTCAGAAGG - Intergenic
1161365526 19:3877190-3877212 TGAATAAAAAAGAGGGAGGAAGG - Intergenic
1161873041 19:6885423-6885445 TTGATAAAGAAAAGGGAACATGG - Intergenic
1161878375 19:6929491-6929513 TTTACAAAGAAAAGGGAAGACGG + Intronic
1162258802 19:9515841-9515863 TTACGAAAGAAGAAGGAACAAGG + Intergenic
1162294538 19:9804040-9804062 ATATTAAGGGAAAGGGAAGATGG + Intergenic
1162494391 19:11015171-11015193 TTATGAAAGAATGGGGAAGATGG - Intronic
1163137535 19:15323519-15323541 TGTGTAAAGAAAAGGGAAGAGGG - Intronic
1163295274 19:16407782-16407804 TTTTCAATGAAGGGGGAAGACGG - Intronic
1164236177 19:23336519-23336541 TTTACAAAGAAAAGGGAAGATGG + Intronic
1164300571 19:23958326-23958348 TTTACAAAGAAAAGGGAAGATGG - Intergenic
1164787544 19:30945521-30945543 GCAAAAAAGAAGAGGGAAGAGGG - Intergenic
1165341180 19:35213324-35213346 ATATCAAAGAAGAAGGAAGAGGG + Intergenic
1165375961 19:35442174-35442196 TTAGAAAAGAAGAAGGAAGTTGG + Intergenic
1166400940 19:42479493-42479515 ATATTAAAGTAGAGGGATAAGGG - Intergenic
1168444279 19:56398330-56398352 TTGACAAAGAAAAGGGAAGATGG + Intronic
1168461850 19:56566511-56566533 TTATTAAAAAAGAGGAAGGAGGG - Intergenic
925299698 2:2802415-2802437 TTAGAAGAGAAGAGTGAAGATGG - Intergenic
925988310 2:9233808-9233830 TGTTTAAAGAAGAGGGGAGTGGG + Intronic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
926965567 2:18406200-18406222 TAAGGAAAGAAGAGGCAAGAAGG + Intergenic
927019569 2:19002624-19002646 TTATGAACTAAGAGAGAAGAAGG - Intergenic
927139379 2:20119276-20119298 ACATTAAAGGAGAGAGAAGAAGG - Intergenic
927166186 2:20324480-20324502 TTTTTAAATAACAGGAAAGAGGG - Intronic
927246276 2:20959409-20959431 GGATTAAAGGAGAAGGAAGATGG - Intergenic
927291130 2:21405991-21406013 TTGTCAAAGAAGGGGGAACAGGG + Intergenic
927545060 2:23945074-23945096 TTATTAAAAAAAAGGGGGGAGGG + Intronic
927814589 2:26203478-26203500 TTATTAATTCAGAGGTAAGATGG + Intronic
927863222 2:26573423-26573445 ATATTAAAGATGACGGAAGAAGG + Intronic
928014943 2:27647347-27647369 TTATTTAAGAAGAGGAGGGAGGG - Intronic
928498349 2:31859365-31859387 TTATTAAAGATTAAGGAATATGG - Intergenic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928574638 2:32642561-32642583 TTTTAAAAGAAGAGGTTAGAAGG + Intronic
930899494 2:56486334-56486356 TCATCACAGAAGTGGGAAGAGGG + Intergenic
930953220 2:57170480-57170502 TAATTATAGAAGAGGGAAATTGG + Intergenic
931000778 2:57779929-57779951 TTATTTCAGAAGACAGAAGAAGG - Intergenic
931690069 2:64828175-64828197 TTTTTAAAGGAGAGCCAAGAGGG - Intergenic
932295382 2:70620108-70620130 TTGACAAAGAAAAGGGAAGAAGG - Intronic
932501929 2:72190026-72190048 TTAGGAAAAAAGAGAGAAGAAGG - Intronic
933021214 2:77194773-77194795 TATCTACAGAAGAGGGAAGATGG + Intronic
933212817 2:79590994-79591016 TTATAAGAGAAGACAGAAGAAGG - Intronic
933213539 2:79599595-79599617 TTATTAAAGAATGCTGAAGAAGG - Intronic
933363453 2:81317373-81317395 ATGTTAAATAAGAGGTAAGAAGG - Intergenic
933489614 2:82969061-82969083 TTATTAAAAAAGAAAAAAGATGG - Intergenic
934581636 2:95445690-95445712 TTATTTAAGGAGAGGGCAGAGGG - Intergenic
934597814 2:95631024-95631046 TTATTTAAGGAGAGGGCAGAGGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
935352633 2:102166749-102166771 TTGTTACAGAAGAGGAAACAGGG - Intronic
936093747 2:109516619-109516641 TTACTGAAGAAGTGGGAAGGAGG + Intergenic
936651331 2:114429866-114429888 ATACTAAAGAAGAGCAAAGAGGG - Intergenic
936805591 2:116328064-116328086 TTTTCAATGAAGAGGAAAGAAGG + Intergenic
937403867 2:121610134-121610156 TTAGAAAATAAGAGGGAAAAAGG + Intronic
937484473 2:122300228-122300250 GGATGAAAGAAGAAGGAAGAAGG - Intergenic
937688269 2:124722805-124722827 TCATTCAAGGAAAGGGAAGAAGG - Intronic
937702220 2:124876455-124876477 TTTTTTAAGAGGAGAGAAGAGGG + Intronic
937827197 2:126379944-126379966 GTAACAAAGAAAAGGGAAGATGG + Intergenic
938645042 2:133321620-133321642 TTATAAAAGAAGAGAAAAGCGGG + Intronic
938694942 2:133826533-133826555 TTGTTAAAGAGAAGGGAAGCAGG + Intergenic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
940152427 2:150616974-150616996 TTATAAAAGAAGAGGGTTTAAGG - Intergenic
940499856 2:154480656-154480678 TAATTAAGGAAAAGGCAAGATGG - Intergenic
940558448 2:155263296-155263318 TTATAAGAGGAGAGGAAAGAAGG + Intergenic
941087636 2:161136182-161136204 TTATTACAGATGAGGGAAACAGG - Intergenic
941582216 2:167313264-167313286 TTTTTATAGAAGAAGGCAGAGGG + Intergenic
942586242 2:177481178-177481200 TTTTTAAAAAAGAGTAAAGACGG - Intronic
942623959 2:177878756-177878778 TTATTAAAGCAGTGAGAAGTGGG - Intronic
943509467 2:188806057-188806079 CTATTATAGAAAAGGAAAGATGG + Intergenic
944017304 2:195057525-195057547 ATATTAAAGAATAGAGAATAAGG + Intergenic
944116564 2:196193216-196193238 TTGTTATTGAAGGGGGAAGAGGG - Intergenic
944429797 2:199620657-199620679 TTTCAAAAGAAGATGGAAGAAGG - Intergenic
944601483 2:201308071-201308093 TTATCAAACAAGAGGAAGGAGGG + Intronic
945166827 2:206955287-206955309 TTGTTAAAGAAAGGGAAAGATGG + Intronic
946723800 2:222640853-222640875 TTATCACAGAAGAGGTAATAAGG - Exonic
947073240 2:226314910-226314932 TCAGCAGAGAAGAGGGAAGAAGG + Intergenic
947256648 2:228173160-228173182 TTATTAAATAAAAAGGAAGAGGG - Intronic
947282748 2:228473650-228473672 TTGGTAAAGAGAAGGGAAGATGG + Intergenic
947416773 2:229904574-229904596 TTATTAAAACAGAGGCTAGAAGG + Intronic
947848980 2:233268995-233269017 TTATCAAAGAAGAGAGAGTAAGG + Intronic
948056229 2:235010959-235010981 TTCTCCTAGAAGAGGGAAGAAGG - Intronic
948289927 2:236817284-236817306 TTAATGAAAAAGAGGAAAGAAGG - Intergenic
948554805 2:238801251-238801273 TTATTACAGAAGAGTCAAAAAGG + Intergenic
1168732020 20:92689-92711 TGTCTAAAAAAGAGGGAAGATGG - Intronic
1169050756 20:2576055-2576077 TTATTGCAGAACAGGGAAAAAGG - Intronic
1170096567 20:12651820-12651842 TTTTTATAGAAGAAGGAAGAAGG + Intergenic
1170808280 20:19653445-19653467 ATAATAGAGATGAGGGAAGAAGG + Intronic
1171321079 20:24244991-24245013 TTAGGAAAGAAAAGGGGAGAAGG - Intergenic
1171387839 20:24782105-24782127 TTTTTAAAGATGGAGGAAGAAGG - Intergenic
1171975093 20:31589244-31589266 GTCTTAGAGAAAAGGGAAGAGGG - Intergenic
1173017287 20:39237148-39237170 TTATGACAGAAGACAGAAGAGGG - Intergenic
1173388750 20:42612346-42612368 TTCTGAAAGAATGGGGAAGAGGG + Intronic
1173465409 20:43276934-43276956 ATATTAGAGAAGAGGAAAGGAGG - Intergenic
1173650147 20:44658467-44658489 TTACTAAAGAAGAGGATAGTAGG + Intergenic
1173912876 20:46683382-46683404 TGGTAAAAGAAAAGGGAAGATGG - Intronic
1174462602 20:50693410-50693432 TTTTTTAAAAAGAAGGAAGATGG - Intergenic
1175277909 20:57784362-57784384 ATATTTAAGAAAGGGGAAGAGGG - Intergenic
1175648197 20:60693939-60693961 ATAATAAAGAAGAGGGAATGTGG + Intergenic
1176513398 21:7765477-7765499 TTATTAGAAAAGAGGAAAGAAGG - Intronic
1176703717 21:10092979-10093001 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1176720227 21:10386717-10386739 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1176733724 21:10523256-10523278 TCATTAAAGATGAGGGAGAAGGG - Intronic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1178095903 21:29215359-29215381 TAATAAATGAAGAGGGTAGATGG - Intronic
1178647511 21:34396001-34396023 TTATTAGAAAAGAGGAAAGAAGG - Intronic
1178684410 21:34700040-34700062 TTGATAAAGCAAAGGGAAGATGG + Intronic
1178819755 21:35964220-35964242 CTATCAAAGAAAAGGGAAGATGG + Intronic
1179490201 21:41736311-41736333 TTATGAAAGAAGGGAGAAGCAGG + Intergenic
1179907382 21:44430289-44430311 TTTGTAAAGAAGAGAAAAGAAGG - Intronic
1179954546 21:44730956-44730978 TTCTTCAAGACAAGGGAAGAAGG - Intergenic
1180301426 22:11039477-11039499 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1180561474 22:16618731-16618753 TCATTAAAGATGAGGGAGAAAGG - Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181670389 22:24423238-24423260 TTCTTAAAAAAGAGGGAGGCTGG + Intronic
1182032741 22:27172703-27172725 TTATAAAAGATGGGGGAAGGTGG - Intergenic
1182085414 22:27557832-27557854 GTATTAATGAAAAGGGAGGAGGG - Intergenic
1182686746 22:32126652-32126674 TATTTAGAGAAGAGGGAAGTAGG + Intergenic
1183225971 22:36550127-36550149 TTAATTCAGAATAGGGAAGACGG + Intergenic
1183534178 22:38386291-38386313 TCATTAAAGATGAGGGAGAAGGG + Intronic
1184298159 22:43539273-43539295 TAAGTAGAGCAGAGGGAAGAGGG - Intronic
949339716 3:3016313-3016335 TAATAACAGAAGAGGGAAGGGGG - Intronic
950095389 3:10326489-10326511 TGATCAAAGAAGTGGGGAGATGG + Exonic
950712330 3:14821226-14821248 CTATAAAAGATGAGGGAGGAGGG - Exonic
950945363 3:16940208-16940230 TTTTTGAAGAAGAGGCAGGAAGG - Intronic
951104870 3:18731016-18731038 TTATGAATGAAGAGAGGAGAGGG + Intergenic
951324918 3:21289937-21289959 TTATGAAGAAAGAGGGTAGAGGG + Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
953462370 3:43091963-43091985 TCATAAAAGACAAGGGAAGATGG + Intronic
953781386 3:45874128-45874150 ATATTAATGAAGAATGAAGATGG - Intronic
953839979 3:46382166-46382188 TTGACAAAGAAAAGGGAAGATGG - Intergenic
955044404 3:55346445-55346467 TTCTAAAAGATGAGGGAAGCAGG + Intergenic
955271138 3:57500505-57500527 TAGTTAAAGAATAGGGAACAGGG - Intronic
955524851 3:59809528-59809550 GTATAAAAGAAGAGGGAATTGGG - Intronic
955574370 3:60343505-60343527 GTATTAAAGATGAGGAAAGGTGG + Intronic
955955438 3:64284587-64284609 TTATTTAAGAAGAAGGAAAATGG - Intronic
955982657 3:64542605-64542627 TTATTAAAGCAGTGTGTAGAGGG + Intronic
956054856 3:65288037-65288059 TTATTACAGAAGCTGGAACACGG - Intergenic
956161051 3:66352890-66352912 TGATTACAGAGGAGGGAGGAGGG - Intronic
956734616 3:72228609-72228631 TTTGTAGAGAACAGGGAAGAAGG + Intergenic
957215995 3:77320187-77320209 TTTTAAAACAAGAGGGTAGAGGG - Intronic
957292050 3:78290530-78290552 TTAATAAAGAACAGGAAAGAGGG - Intergenic
957414735 3:79886741-79886763 TTATTCCAGAAAAGGGGAGAAGG - Intergenic
958116392 3:89224483-89224505 TTATTTCTGAAGAAGGAAGATGG + Intronic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
959178462 3:102948199-102948221 TTAGTAGAGAAGAGGAAAGTAGG - Intergenic
959204851 3:103293384-103293406 TTATTAAGGAAAAAGGAGGAGGG - Intergenic
959514975 3:107255482-107255504 TGATTAGAGAAGCAGGAAGAAGG + Intergenic
959871616 3:111335137-111335159 TTATCAAAGAGGATGGAAGGAGG + Intronic
960171666 3:114469179-114469201 TAATTAAAGAAAGGGCAAGACGG + Intronic
960216220 3:115041239-115041261 TAATTGAAGAAGAGGACAGATGG - Intronic
960520737 3:118652066-118652088 TTGTCAAAGCAGAGGGAAAAGGG + Intergenic
960665533 3:120105194-120105216 ATATTAAAGAAAAGGCATGAAGG + Intergenic
960718175 3:120598352-120598374 TTCTTAAAGATTAGGCAAGATGG - Intronic
960842264 3:121972175-121972197 TTGGTAAAGAAAAGGGGAGATGG - Intergenic
961057968 3:123804847-123804869 TGATTGGAGGAGAGGGAAGAAGG + Intronic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
961922089 3:130437778-130437800 AATTCAAAGAAGAGGGAAGATGG - Intronic
962480850 3:135797027-135797049 AGATTCAAGAAGAGGGAATATGG - Intergenic
964366144 3:155952658-155952680 TTGGCAAAGAAGAGGGAAGATGG + Intergenic
964830385 3:160877875-160877897 TTGGCAAGGAAGAGGGAAGATGG + Intronic
965087364 3:164115941-164115963 TTGACAAAGAAAAGGGAAGATGG - Intergenic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
966060687 3:175750430-175750452 TAATTAAAGAGGAAGAAAGAAGG - Intronic
966096113 3:176205194-176205216 TTCTTAGAGATGAGTGAAGAAGG + Intergenic
966211974 3:177462975-177462997 TTCCTTAAGAAGAGGGAAAAGGG + Intergenic
966369650 3:179235547-179235569 TTATAAAAGAGAATGGAAGACGG - Exonic
966616142 3:181914745-181914767 TTATAAAAGTAGTGGGATGAAGG + Intergenic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
967138446 3:186532479-186532501 GGATGAAAGAAGGGGGAAGAGGG - Intergenic
967411683 3:189172517-189172539 TAATAGAGGAAGAGGGAAGAAGG - Intronic
968309557 3:197672416-197672438 TTATTCAAGAGGGGGGAAGTGGG - Intronic
968326148 3:197818423-197818445 TTATTAACAAAGATGGAAGATGG + Intronic
970039310 4:11778197-11778219 TCACTAGAGAAGAGAGAAGAAGG + Intergenic
970315339 4:14823825-14823847 GTATTAAGGAGGTGGGAAGAGGG + Intergenic
970320047 4:14866596-14866618 TTATTAAGGGAGGGGGAAAAAGG + Intergenic
970422425 4:15918103-15918125 ATATTACAGAGGAGGGAAGGAGG + Intergenic
970794438 4:19893945-19893967 TCATTACAGAAAAGGGAAAAGGG - Intergenic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972754617 4:42032649-42032671 AGATCAAGGAAGAGGGAAGAGGG + Intronic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
972922673 4:43963508-43963530 TTAGTAAAGTAGAGGTAAAAAGG + Intergenic
973541634 4:51941231-51941253 TGATAAGAGAAGAGGGGAGATGG + Intergenic
974419869 4:61659603-61659625 TTATTACAGAAAAAGGAAGCAGG + Intronic
974681136 4:65163330-65163352 ATATTAATGAAAAGGAAAGATGG + Intergenic
974888841 4:67853725-67853747 TGGATAAGGAAGAGGGAAGAAGG + Intronic
975566700 4:75763776-75763798 TGATTAATGATGAGAGAAGATGG + Intronic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
975681792 4:76884811-76884833 TTGTAAAAGAAGAGGAAACAAGG + Intergenic
975884153 4:78944365-78944387 TTGCTAAGGAAGAGGGGAGATGG - Intergenic
976652071 4:87446531-87446553 TAATTAGATAAGAGGAAAGACGG - Intronic
976929701 4:90550677-90550699 TAATTGAAAAAGAAGGAAGAGGG + Intronic
976934917 4:90618670-90618692 ATATTAAAGGGAAGGGAAGAAGG + Intronic
977831029 4:101593155-101593177 TTACTAAGGAACAGGGAACAAGG - Intronic
977926888 4:102710863-102710885 TTATTGAAGAGGATTGAAGAGGG - Intronic
978512062 4:109530974-109530996 ACATTAAAGAAGAGAGAATATGG - Intronic
978674159 4:111290549-111290571 TAATACAAGAAGAGGGAAGGAGG + Intergenic
978679748 4:111365539-111365561 TTATTAAAGAAAAAAGGAGAAGG + Intergenic
979228212 4:118315953-118315975 TTATTCAAGAAGAGGGGTCATGG + Intronic
979306846 4:119155533-119155555 TTAGTAAAGAACAGAAAAGAGGG + Intronic
980089113 4:128423430-128423452 TGATTAAATAAAAGGGAAAATGG - Intergenic
980174018 4:129323369-129323391 TTATGAAAGAAAAGGGAAAAGGG - Intergenic
980218956 4:129889994-129890016 TTTTTAAAAAAGAAGGAAGAGGG - Intergenic
980375935 4:131949332-131949354 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
980545334 4:134254460-134254482 ATATTTAAAAAGAGTGAAGAAGG - Intergenic
980709340 4:136543862-136543884 TTCTGAGAGAGGAGGGAAGACGG + Intergenic
981010385 4:139919233-139919255 TCATTGAAGAAGGGGGAGGAAGG + Intronic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981401729 4:144321667-144321689 TAGTTAAAGAAGAGCCAAGACGG + Intergenic
981730849 4:147896244-147896266 TTATGAAAAAACAGTGAAGAAGG - Intronic
981815932 4:148830352-148830374 ATTTTAAAGATGAGGAAAGAGGG + Intergenic
983249264 4:165326683-165326705 TTAATAAAGAAGGAGGAAAAAGG + Intergenic
983781285 4:171673635-171673657 TAATTAAAGAAAAGGCAAGATGG + Intergenic
983783732 4:171705724-171705746 TGATCAAGGAAGAGTGAAGAGGG + Intergenic
984858888 4:184219513-184219535 TTATTAAAAAATAAGGAAAAGGG + Intronic
986100296 5:4602240-4602262 TTTCTAAAGCAGATGGAAGAAGG - Intergenic
986329628 5:6708048-6708070 TTAGTAAAGAAGCAGGAAGTGGG - Intergenic
986364006 5:7011415-7011437 TTTTCAAAGAAGAGAGAAAATGG - Intergenic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
989034697 5:37157976-37157998 TTATTAAAAACAAGGAAAGAAGG + Intronic
989135191 5:38147265-38147287 ACATCAAAGAGGAGGGAAGAGGG - Intergenic
989157299 5:38356313-38356335 ATATTACAGAAGAGGAAATAGGG - Intronic
989199453 5:38749207-38749229 TTACTAAAAAAGAGGAAATATGG + Intergenic
990102824 5:52214310-52214332 TTATTACAGAGGAGTCAAGAAGG + Intergenic
990109944 5:52310262-52310284 TTATGCAAGAAGTGGAAAGAAGG - Intergenic
990534922 5:56711930-56711952 TTAATATAGAGGGGGGAAGAAGG + Intergenic
991322646 5:65392061-65392083 TTATTAAAAGAAAGGGAAGATGG - Intronic
991483266 5:67106531-67106553 TGATTATAGAACAGGAAAGAAGG - Intronic
991568183 5:68026858-68026880 TAAATAAAGAAGAAGGAAGAAGG - Intergenic
991776518 5:70090553-70090575 TTATGAAAGAAAAGGAAGGAAGG + Intergenic
991855805 5:70966000-70966022 TTATGAAAGAAAAGGAAGGAAGG + Intergenic
991869820 5:71098778-71098800 TTATGAAAGAAAAGGAAGGAAGG + Intergenic
992015833 5:72574375-72574397 GTTTTGAAGAAGCGGGAAGAAGG - Intergenic
992071519 5:73153335-73153357 TTGACAAAGAAAAGGGAAGATGG + Intergenic
992141497 5:73801539-73801561 TTATTAAATAACAGCCAAGAGGG - Intronic
992530633 5:77648559-77648581 GTATTAGAGAAGACTGAAGATGG - Intergenic
993011986 5:82493099-82493121 TTATTAAAGGGCAGGCAAGAGGG - Intergenic
993158809 5:84262296-84262318 TTATTCAAGAAGAAGGAGAAAGG + Intronic
993501705 5:88673834-88673856 TTAAGAAAGGAGAGGAAAGAAGG - Intergenic
993525507 5:88960823-88960845 TTCATAAAGAAGAAAGAAGAAGG + Intergenic
993878006 5:93330513-93330535 TACTTAAATGAGAGGGAAGAAGG - Intergenic
994439481 5:99784264-99784286 TTATTAAATAAGAGTGAAATGGG + Intergenic
994641339 5:102413130-102413152 TTTTTACAGAACAGGGAAGTTGG - Exonic
994687226 5:102970423-102970445 TTGTAAAGGAAGAGAGAAGATGG + Intronic
995119305 5:108519085-108519107 TTGATAAGGAAAAGGGAAGATGG - Intergenic
995344003 5:111090906-111090928 AAATTAAAAAAGAGGGGAGAGGG - Intergenic
995973674 5:118004681-118004703 TTAGTAAGGAAGAGGACAGAAGG - Intergenic
996001771 5:118372747-118372769 TTCTTAATGAGGAGGGAGGAAGG - Intergenic
996269500 5:121585578-121585600 TCTTTCAAGAAAAGGGAAGAAGG - Intergenic
996837472 5:127809750-127809772 GTAATGTAGAAGAGGGAAGATGG + Intergenic
997068177 5:130588444-130588466 CTACTAAAGAAGAATGAAGAAGG + Intergenic
997954206 5:138265647-138265669 GGAAGAAAGAAGAGGGAAGAAGG - Intronic
998364551 5:141620815-141620837 TTATGAAAGGAGAGGGAAATGGG - Intergenic
998540572 5:142977684-142977706 TTAAGAAAGAAGATGGAAGGTGG + Intronic
999649813 5:153754493-153754515 TTAAAAGAGAACAGGGAAGAAGG + Intronic
999938106 5:156510124-156510146 TTAGTAAAAGAGAGGGAACAAGG + Intronic
999964299 5:156791613-156791635 ATTTTAAAAAAGAGGGAAAATGG + Intergenic
1000668450 5:164028446-164028468 TTATTAAAAAATAGGTAAAATGG + Intergenic
1000829190 5:166082343-166082365 GTCTTATGGAAGAGGGAAGATGG - Intergenic
1001029857 5:168254411-168254433 AATTTAAAGAAGAGGAAAGAGGG + Intronic
1001320840 5:170680150-170680172 TTATTTAAGAAGAGGAAACTGGG + Intronic
1001464762 5:171953691-171953713 TTTTTAAAGATGAGGAAACAGGG + Intronic
1001763580 5:174226978-174227000 TTATAAAAGAAGAGCAAAAAAGG - Intronic
1003595069 6:7467293-7467315 TTTCTAAATAAGAGGGTAGATGG - Intergenic
1003626656 6:7747375-7747397 TGATGGAAGAAGAGGCAAGAGGG + Intronic
1003786940 6:9497339-9497361 TTATTCAAGAACAGTGAATAGGG - Intergenic
1004688673 6:17972987-17973009 TTTTGAAAGAAAGGGGAAGAGGG + Intronic
1004867522 6:19868806-19868828 ATATTAAAGAAAAGGGATGGAGG + Intergenic
1005262579 6:24077732-24077754 TGATTACAGAACAGGGAAGAGGG - Intergenic
1006482009 6:34302990-34303012 TTGTTAAAGAAGAGCAGAGAAGG - Intronic
1006994285 6:38243872-38243894 TTAAAAAAGAAGAAGGAAAAGGG - Intronic
1008228492 6:48953427-48953449 TTTTCAAAAAAGAGGAAAGAAGG + Intergenic
1008385180 6:50880935-50880957 TTAATAAAGAGGAGGCAGGATGG - Intergenic
1008710264 6:54217082-54217104 TTACCAAAGAGGTGGGAAGATGG + Intronic
1008712425 6:54244118-54244140 TTATTAATGAAGAGGTTTGAGGG - Intronic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1009445089 6:63733102-63733124 TGATTAAAGAACAGGAAGGAGGG + Intronic
1009601245 6:65803068-65803090 TTATTAAAAAATAGGGAAATAGG - Intergenic
1009754122 6:67912954-67912976 ATATTAAAGAAGAGCAAAGCTGG - Intergenic
1010085877 6:71917539-71917561 AGACTAAAGAAGAGGGAAGAAGG + Intronic
1010835612 6:80584396-80584418 TTCCTAAAGAGGAGGGAAAAGGG - Intergenic
1010897917 6:81388792-81388814 TTTTTAAAAAAGAGGGAGGGTGG + Intergenic
1011602431 6:89072051-89072073 TAACTCAAGAAGAGGGTAGAGGG + Intergenic
1012375749 6:98559857-98559879 TTAGAAAGGAAGAGGGAGGAAGG - Intergenic
1012709373 6:102580640-102580662 TTATTAAAGTAGAGAAAGGAGGG - Intergenic
1012755081 6:103219623-103219645 TTTTTAAAGAAGATGGAATAAGG - Intergenic
1013039458 6:106419077-106419099 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1013278861 6:108615672-108615694 TCATAAAAGAAGAGGAAAGAGGG - Intronic
1013653012 6:112215219-112215241 TTATTTAAGAAGATGGGGGAAGG + Intronic
1013761599 6:113524831-113524853 TAATGAGAGAAGAAGGAAGAGGG + Intergenic
1013912150 6:115289046-115289068 TAATTAAAGGAGGGGCAAGAAGG - Intergenic
1014229699 6:118889555-118889577 TTATAAAACATGAAGGAAGATGG + Intronic
1014450720 6:121578264-121578286 ATATTTAAGAAAAGGGAAGAAGG + Intergenic
1014469015 6:121792026-121792048 TTTTTAAAGCATAGAGAAGAAGG - Intergenic
1015276905 6:131391546-131391568 TTTTTAAAAAAGGGGAAAGAGGG + Intergenic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016425762 6:143934381-143934403 ATATTGAAAGAGAGGGAAGATGG - Intronic
1016565507 6:145448452-145448474 TTATTAAAGAAGAGAAAGGAAGG + Intergenic
1016631919 6:146242788-146242810 TTTTTAAAGAGGAGGGGAAATGG - Intronic
1016870867 6:148815181-148815203 TCTTTAAAGAAAAGGAAAGAGGG + Intronic
1016950866 6:149578219-149578241 GTATAAAAGAATAGGAAAGATGG + Intronic
1017052224 6:150403926-150403948 TTATTAGAGTAGAAGGAAGTTGG - Exonic
1017076423 6:150622953-150622975 CTATTAGAGAAGAGGGGAGGCGG + Intronic
1017316758 6:153039913-153039935 CTTATAAAGAAAAGGGAAGAAGG + Intronic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1018083904 6:160285003-160285025 TCCCTAAAGAAGAGTGAAGAGGG - Intergenic
1018730835 6:166649247-166649269 TGATCTAAGAAGAAGGAAGAGGG - Intronic
1019366880 7:637848-637870 TAAATAAATAACAGGGAAGATGG + Intronic
1019470491 7:1217866-1217888 TCAATAAAGAAGAGCGAAAATGG - Intergenic
1020014882 7:4825100-4825122 TTGTTCTAGAAGAGGGCAGAGGG + Intronic
1020795595 7:12675438-12675460 ATACTAAAGAAGACAGAAGACGG - Intergenic
1020990956 7:15195571-15195593 TTAGCAAAGAAAAGGGAACATGG + Intergenic
1021404953 7:20254471-20254493 TTATTATAGAAAAGGTAGGAAGG - Intergenic
1021416130 7:20387213-20387235 TTATAAATGAGGAGGGAAAAAGG + Intronic
1022169179 7:27806874-27806896 TTAATAAAGAACAGGCAATATGG + Intronic
1022356067 7:29615699-29615721 GTATTCAAGAAGCGGTAAGAAGG - Intergenic
1022770698 7:33469496-33469518 TTACTAAATAAGATGGAAAATGG + Intronic
1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG + Intronic
1023455143 7:40330434-40330456 TTAGGAAAGAAGGGTGAAGAGGG + Intronic
1024331203 7:48157020-48157042 TTAGTAAAGACGAGGCAAGCTGG + Intergenic
1024752112 7:52478593-52478615 CTGTTAAAGAGAAGGGAAGATGG + Intergenic
1026211658 7:68311307-68311329 TTGACAAAGAAGAGAGAAGATGG + Intergenic
1026922038 7:74162891-74162913 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027424658 7:78050395-78050417 TTACAAAAAAAGAGAGAAGATGG + Intronic
1028047301 7:86138713-86138735 TTATTAAATATGAGGTAACATGG - Intergenic
1028469381 7:91187912-91187934 TTAGCAAAGAGAAGGGAAGACGG + Intronic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1029519482 7:101051054-101051076 TCATGGCAGAAGAGGGAAGAAGG + Intronic
1029585396 7:101467563-101467585 TTGACAAAGAAAAGGGAAGATGG + Intronic
1030164982 7:106544955-106544977 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1030247864 7:107405094-107405116 TTACTAAAGAAGGGGGAAGCAGG + Intronic
1030694141 7:112566560-112566582 ATATTACAGAAGAGGGAAAGAGG - Intergenic
1031774359 7:125888565-125888587 TTATTTAAGAAAAGAAAAGATGG - Intergenic
1031949459 7:127877278-127877300 TTAGCAAAGGAGAAGGAAGAAGG - Intronic
1032010060 7:128340044-128340066 TTATCAAGAAAGGGGGAAGAAGG - Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1033375493 7:140757670-140757692 TTATTAAAGAAAAATGAAGCAGG - Intronic
1033421760 7:141210161-141210183 TCATTAAAAAATAGGGATGAGGG + Intronic
1033646166 7:143306227-143306249 GTCTTAAAGAACAGGGAAGTTGG - Exonic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1034186614 7:149182850-149182872 TTATTAATGAAAAGGGAAGTAGG - Intergenic
1035016278 7:155769327-155769349 ACATTAAAGCAGCGGGAAGAAGG + Intronic
1035482198 7:159196382-159196404 TTATTACAGAAGTGGTAAGAAGG - Intergenic
1035710576 8:1710217-1710239 GTATTAAAAAAGAGGGAGGCCGG + Intergenic
1035920406 8:3669882-3669904 TTAAGAAAGAAGAAGGAAGGAGG - Intronic
1036427661 8:8661116-8661138 GTAATAAAGAGAAGGGAAGATGG - Intergenic
1037143746 8:15548789-15548811 TTATTAAAACATAGGGTAGAAGG - Intronic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1037766995 8:21778203-21778225 TTATCAAGGAACAGGGAGGAAGG + Intronic
1037816048 8:22112549-22112571 TTATCAGAGAAAAGGAAAGAAGG + Intergenic
1038338975 8:26668383-26668405 GTAACAAAGAAAAGGGAAGATGG - Intergenic
1038655225 8:29444674-29444696 CTTTTAAAGAAGAGGGAAAATGG + Intergenic
1038858742 8:31362031-31362053 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1039155655 8:34554003-34554025 TTCTTTAAGATAAGGGAAGAAGG + Intergenic
1039767184 8:40641273-40641295 TTTTAAAAGAAAAGAGAAGATGG + Intronic
1039849269 8:41348239-41348261 GTAATAAAAAAAAGGGAAGATGG + Intergenic
1039907075 8:41794483-41794505 TTATTGAGGGAGAGGGAAGCGGG - Intronic
1040297383 8:46163236-46163258 TTAATTAAGAAGTTGGAAGAAGG - Intergenic
1040872438 8:52114417-52114439 TTTTTAAAAAGGAGGGAAAATGG - Intronic
1041162237 8:55057357-55057379 TTAGTGAAGAAGAGGAAAAAAGG + Intergenic
1041340322 8:56838974-56838996 TTGATAAAGAAGAGGGAAGTAGG - Intergenic
1041597745 8:59676929-59676951 TTGGCAAAGAAAAGGGAAGACGG - Intergenic
1041656342 8:60354516-60354538 TTATTAAACAACCAGGAAGACGG - Intergenic
1042409068 8:68441493-68441515 ATTTTAAAGAAGAAGAAAGAAGG - Intronic
1042504740 8:69548198-69548220 TTATTATAGAAGGGAGAAGGTGG + Intronic
1042885935 8:73551765-73551787 TTAAAAAAGAAGAAGGAAAATGG + Intronic
1042949123 8:74182763-74182785 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1043250915 8:78071935-78071957 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1043407525 8:79953176-79953198 TTTTTAAAAAAGAGAGAAAACGG - Intronic
1043491237 8:80751134-80751156 TTATTAGAAAAGAGGCAAGGTGG + Intronic
1043722277 8:83559697-83559719 CTACTGAAGAAGAGGGAAGGGGG + Intergenic
1043873665 8:85463188-85463210 TTTTTAAAGAGGAGGAAAGTAGG + Intergenic
1044125646 8:88456188-88456210 TTATTTAAGAAAAGGATAGAAGG + Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044667468 8:94644807-94644829 TCGTTAAAGAAAAGGGAAAATGG + Intronic
1044803618 8:95982076-95982098 TGATTTGAGAAGTGGGAAGAGGG + Intergenic
1045092267 8:98758008-98758030 TTATTAAAGGTTAGGGAAGAAGG + Intronic
1045483261 8:102609982-102610004 TTAACAAAGAACAGGGAAGGAGG + Intergenic
1045534648 8:103016045-103016067 TTATTAAAGCTCTGGGAAGATGG + Intergenic
1045644115 8:104283611-104283633 TTGACAAAGAAAAGGGAAGATGG - Intergenic
1045733374 8:105267220-105267242 TGTGGAAAGAAGAGGGAAGAGGG - Intronic
1045744542 8:105402558-105402580 TTAATAGAGAATAGGGAAGTGGG - Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046622345 8:116541659-116541681 TTATAAGAGAAGAAAGAAGAGGG - Intergenic
1046733342 8:117749634-117749656 TCATTATAGAAGAAGGAATAAGG + Intergenic
1046751798 8:117934347-117934369 TTATAAGAGAAGGGGGAAGCAGG + Intronic
1046884443 8:119348680-119348702 ATATTGAAGAAGAGTGAAGTTGG - Intergenic
1047018678 8:120751184-120751206 TTATCTCAGGAGAGGGAAGAAGG + Intronic
1047056645 8:121172251-121172273 TTAAGGAAGAAGAGGCAAGAAGG + Intergenic
1047179961 8:122577955-122577977 TTATTAAATAAGAGGAAACCAGG + Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047789320 8:128186526-128186548 TTAAAAAAAAAAAGGGAAGAGGG - Intergenic
1048164355 8:132049083-132049105 TTGTTAATGAAGAGGGGAAAGGG + Intronic
1048715368 8:137262969-137262991 TTTAGAAAGAAGAGGGGAGAAGG - Intergenic
1048903792 8:139067305-139067327 TTATTAAAGAAAAGGAGAAATGG - Intergenic
1049131287 8:140845134-140845156 TCATTAAAGAAGATTGAAAATGG - Intronic
1049956337 9:696402-696424 TTAGGAAACAAGAGGGAAGAAGG + Intronic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1050701171 9:8340873-8340895 TTATGAAAGAAGAGTGCAGAAGG + Intronic
1050853674 9:10322661-10322683 ATATTCAAAAAGAGGGGAGATGG + Intronic
1051804216 9:20973700-20973722 TGCTGAAAGAAGAGGGAAGTAGG - Intronic
1051973803 9:22924055-22924077 TTATTAAAGCAGAGGCATGAAGG + Intergenic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052042030 9:23749731-23749753 TTAAAAAAGAAGAGAGAAGTGGG + Intronic
1052525658 9:29615642-29615664 TTATTATAGAAGAGAAAAAAAGG - Intergenic
1052597559 9:30579575-30579597 TTAAGGAAGAACAGGGAAGATGG + Intergenic
1053320156 9:37090858-37090880 TTATTAAGAAAGAGGGAAGCTGG - Intergenic
1053640984 9:40079999-40080021 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1053765152 9:41385469-41385491 TTTTTAAAGAAGAAAGAAAAAGG + Intergenic
1054543768 9:66296631-66296653 TTTTTAAAGAAGAAAGAAAAAGG + Intergenic
1055236237 9:74126741-74126763 CTATTAAAGATGAGGAGAGAAGG - Intergenic
1055726779 9:79238671-79238693 TTATTAAAGAAGAGAGAATGTGG - Intergenic
1055752457 9:79521931-79521953 ATTATAAAGAAGAAGGAAGAGGG + Intergenic
1056039241 9:82644478-82644500 ATATTAAAGAAGAAGAAAGCTGG - Intergenic
1057108998 9:92448933-92448955 TAATTTAAGGAAAGGGAAGATGG + Intronic
1057438164 9:95061732-95061754 TTATTAACCAAAAGGTAAGATGG + Intronic
1057517220 9:95731982-95732004 TCATTAAAGAAGAGGATAGTGGG + Intergenic
1057977943 9:99626756-99626778 TTTTTAAAGAAGAGGCAGTATGG - Intergenic
1057994750 9:99811025-99811047 ATAATAAAGAATAGGCAAGATGG + Intergenic
1058768710 9:108209273-108209295 CTTTTACAGAAGAGGGAAGTGGG - Intergenic
1058820465 9:108724651-108724673 TTATTAAAGAAAATGGTACAGGG - Intergenic
1058930681 9:109715850-109715872 TTAACAAAGAAGAAGAAAGAAGG - Intronic
1059590804 9:115659360-115659382 TAATTCAAGAAGGTGGAAGATGG - Intergenic
1060455574 9:123792210-123792232 GTAACAAAAAAGAGGGAAGAGGG - Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061240086 9:129365013-129365035 TTTTCACAGCAGAGGGAAGAAGG + Intergenic
1061992366 9:134166397-134166419 TAACCCAAGAAGAGGGAAGATGG + Intergenic
1062727089 9:138080711-138080733 TTTTTAAAGAAGAGACCAGAGGG + Intronic
1202788754 9_KI270719v1_random:63074-63096 TTTTTAAAGAAGAAAGAAAAAGG - Intergenic
1185540671 X:900786-900808 TTATTTAAATAGAAGGAAGAAGG - Intergenic
1185552037 X:990217-990239 TTGACAAAGAGGAGGGAAGATGG - Intergenic
1185588668 X:1259337-1259359 TTAGTAGAGATGGGGGAAGAGGG - Intergenic
1185808178 X:3079655-3079677 TTTTTAAAGGTGAGGGAAGTGGG + Intronic
1185959923 X:4538436-4538458 TAATTAAGGGAGAGGCAAGATGG - Intergenic
1186016740 X:5204363-5204385 TTAACAAGGAAAAGGGAAGATGG - Intergenic
1186063833 X:5740158-5740180 TTAATAAGGAAAAGGGAAGATGG + Intergenic
1186380461 X:9053408-9053430 TTATGGAAGAAGAGAGATGAAGG + Intronic
1186412543 X:9356628-9356650 TAAGTAAACAAGATGGAAGAGGG + Intergenic
1186663433 X:11693516-11693538 GGAATAAAGAAGAGGGAAGAGGG - Intergenic
1186734780 X:12450305-12450327 CTATTAAAAAAAAGGGAAGTTGG + Intronic
1187596830 X:20782640-20782662 TTATTAGGGAAGAGGCATGAAGG + Intergenic
1188159031 X:26777903-26777925 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1188159760 X:26784808-26784830 TTGACAAAGAAAAGGGAAGATGG + Intergenic
1189074022 X:37897182-37897204 CTATAAAAGATGAGGGCAGAGGG + Intronic
1189263767 X:39697968-39697990 TGATTACAGAAGAGGGAATAGGG - Intergenic
1189953887 X:46259091-46259113 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1190138188 X:47816349-47816371 TAATTAAGGAAAAGGCAAGAGGG - Intergenic
1191167921 X:57411150-57411172 ATAATTAAGAAGAGTGAAGAAGG - Intronic
1192746427 X:73943388-73943410 AAATAAAAGAAGAGGGAAGATGG + Intergenic
1194001399 X:88434091-88434113 TTCTTAAAGATAAGGAAAGAGGG - Intergenic
1194282094 X:91965917-91965939 TTACCAAGGAAGAAGGAAGAAGG + Intronic
1194523795 X:94950902-94950924 TAATTAAGGAAAAGGCAAGATGG + Intergenic
1194546892 X:95247115-95247137 TTAGTAAACACAAGGGAAGAAGG + Intergenic
1195375425 X:104222795-104222817 TTAGTAGTAAAGAGGGAAGAAGG + Intergenic
1195858682 X:109357982-109358004 TGAATAAAGAAGAGAGAAAAAGG - Intergenic
1196602250 X:117615925-117615947 TTAGTAATGTAGGGGGAAGAAGG + Intergenic
1196676789 X:118428582-118428604 TTATTAAAACAAATGGAAGAGGG + Intronic
1196874959 X:120148413-120148435 TTATAAAAAAACAAGGAAGATGG + Intergenic
1197005766 X:121495469-121495491 CAATGAAAGAAGAGAGAAGATGG - Intergenic
1197458531 X:126708927-126708949 TTATGAAAGAAGATGCAAGTAGG + Intergenic
1197574448 X:128192941-128192963 TTATTACAGAAGATGAAACATGG - Intergenic
1197784367 X:130185967-130185989 TTGGTAAAGGAGAGGGAAGCGGG + Intergenic
1197884087 X:131200114-131200136 TTGTGAAAGGAGAGGGGAGAAGG + Intergenic
1198085334 X:133277133-133277155 TTATTTAATAACAGGCAAGAAGG - Intergenic
1199372134 X:147062237-147062259 TTATAGAAGTAGAGGGTAGAGGG + Intergenic
1200677542 Y:6168399-6168421 ATATTAAAGAAGAGCAAATATGG - Intergenic
1200967613 Y:9111732-9111754 TTATTAAAGAAAAGCTAACAAGG - Intergenic
1202591778 Y:26492725-26492747 TCATTAAAGATGAGGGAGAAGGG - Intergenic