ID: 961414730

View in Genome Browser
Species Human (GRCh38)
Location 3:126749039-126749061
Sequence AAGGAGACAAAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1923
Summary {0: 1, 1: 0, 2: 14, 3: 180, 4: 1728}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961414724_961414730 0 Left 961414724 3:126749016-126749038 CCGCGACCTAGAGGGTAAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 57
Right 961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG 0: 1
1: 0
2: 14
3: 180
4: 1728
961414727_961414730 -6 Left 961414727 3:126749022-126749044 CCTAGAGGGTAAGTGGGAAGGAG 0: 1
1: 0
2: 1
3: 35
4: 307
Right 961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG 0: 1
1: 0
2: 14
3: 180
4: 1728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961414730 Original CRISPR AAGGAGACAAAGAATGAGGA GGG Intronic
900234414 1:1580620-1580642 AGGGACACAAACACTGAGGAAGG + Intergenic
900433444 1:2613660-2613682 TTGGAGTCAAAGCATGAGGAGGG + Intronic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901202843 1:7476372-7476394 AAGGAGACACAGAATGGGCGGGG + Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901305160 1:8227464-8227486 AATGAGACTAAGAATGAAGTAGG + Intergenic
902502726 1:16921781-16921803 AGGGAGCCAAAGGAAGAGGAAGG - Intronic
902774724 1:18667373-18667395 AAGGAGAGAAGGAAGGAGAAAGG + Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903331732 1:22600124-22600146 AAGGAGAGAAGGAAGGAGGAGGG + Intronic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903850939 1:26305769-26305791 AAGGAGAGAAAAAATGTGGTTGG - Intronic
903964317 1:27076995-27077017 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904480702 1:30791581-30791603 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
905014359 1:34767085-34767107 GAGGAGACAATGTTTGAGGAGGG - Intronic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905076911 1:35280227-35280249 AAAGAGAGAAAGAAAGAGAAAGG - Intronic
905128246 1:35731305-35731327 AGTCAGACAAAGAAGGAGGATGG + Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905295389 1:36951416-36951438 AAGAAGACAAAGGAGAAGGAAGG - Intronic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905362039 1:37427582-37427604 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905908559 1:41638267-41638289 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906691200 1:47793784-47793806 AAGGAAACAAAGAGTGAGGGAGG + Intronic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907044133 1:51289365-51289387 AAGGAGGGATAGAATGAGAAGGG - Intronic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907413104 1:54296106-54296128 AAGCAGACAAATAAGGAAGAAGG - Intronic
907799421 1:57750091-57750113 AAGGAGAGAAAGAATCAGGTGGG - Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
907977392 1:59445137-59445159 AGGGAGAGAAAGAGGGAGGAGGG + Intronic
908261085 1:62339610-62339632 TAGGAGACATAGGATGAGGATGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908572967 1:65428381-65428403 AAGGAGACACAGAGAGGGGAAGG - Intronic
908581711 1:65524259-65524281 ATGGAGACAAAAATTGAGGTAGG - Intronic
908762174 1:67522475-67522497 AAGGAGAGAAAGAAAGAAAAGGG - Intergenic
908826075 1:68133996-68134018 AAGGAGAGAAAGAAATAGGGAGG + Intronic
909041483 1:70658093-70658115 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909437451 1:75659402-75659424 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
909471453 1:76033430-76033452 GAGGAGAGAAAGAATTAAGAAGG + Intergenic
909550365 1:76893216-76893238 AAGGAAGGAAAGAAAGAGGAAGG + Intronic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
909802200 1:79823834-79823856 GAGGAGACAGAAGATGAGGAAGG - Intergenic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910103185 1:83600113-83600135 AAGGAGAGAAAGAAAGGGGCGGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910540486 1:88350489-88350511 AAAGAGGGAAAGAAAGAGGAGGG + Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910718422 1:90257858-90257880 ACGGGGACAAAGAAGCAGGAAGG + Intergenic
910735040 1:90444360-90444382 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911292942 1:96080291-96080313 AAGGAAACAAAGAAAAAGAAAGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911719893 1:101179320-101179342 AAGGAGACAAAGGAAGAAGTAGG + Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912164568 1:107028123-107028145 AAGGAGAAAAAGAAAAAGAAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912415122 1:109502964-109502986 GAGGAGCCAAAGAATCAGCATGG + Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
912782306 1:112562542-112562564 AAGGAGACAACAGATGAGCAGGG + Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913220294 1:116654580-116654602 CAGGAGGCAAAGTATGAGGTGGG + Intronic
913330100 1:117659946-117659968 AAGCAGATAAAGAATGCAGAAGG + Intergenic
913537127 1:119783815-119783837 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
913598632 1:120402568-120402590 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
914088749 1:144477050-144477072 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914309863 1:146457153-146457175 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
914592246 1:149115980-149116002 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914953802 1:152144288-152144310 AAGGACACAAACACTGCGGAAGG - Intergenic
915446150 1:155976094-155976116 AATGAGGCAAGGAATGGGGAGGG + Intronic
915453491 1:156023333-156023355 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
915664785 1:157434547-157434569 AAAGAGAGAAAGAAGGAGAAGGG - Intergenic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
916028476 1:160855843-160855865 AAGGAGACAAGTACAGAGGATGG + Intronic
916034928 1:160913419-160913441 AAGGACACAAACACTGCGGAAGG + Intergenic
916040947 1:160960950-160960972 CAGGAGAGAAAGAGTGAGGCAGG + Intergenic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916222375 1:162457744-162457766 AGGGACACAAAGACTGCGGAAGG + Intergenic
916300823 1:163272017-163272039 AGGGAGACAGAGAGAGAGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916655534 1:166872350-166872372 AAGGAAACAAGAAATGGGGAAGG - Intronic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917015337 1:170525119-170525141 AAGGAGTCAGAAAATGAGTAAGG + Intergenic
917143843 1:171866381-171866403 AAGGAGAGAAAGTACAAGGACGG - Intronic
917147943 1:171912597-171912619 AGGGAGACAAAAGAAGAGGAAGG + Intronic
917149921 1:171932115-171932137 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917534738 1:175866051-175866073 AAGGAGACAAACATTGAAGATGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918213687 1:182374537-182374559 AAAGAAACAGAGAATTAGGAAGG - Intergenic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918433989 1:184492002-184492024 AAAGTTACAAAGAATGAAGATGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918730800 1:187993581-187993603 AAGGAGGCAAATAAAAAGGAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919572032 1:199260946-199260968 AAGGACACACAGAATGAGTTAGG - Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
919867090 1:201790513-201790535 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920251970 1:204627934-204627956 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920603576 1:207355358-207355380 GAGGAAAGAGAGAATGAGGATGG + Intronic
920673166 1:208020301-208020323 AAGGAAGCAAAGGAAGAGGATGG - Intergenic
921109207 1:212015553-212015575 AGGGACACAAACACTGAGGAAGG + Intronic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921356850 1:214292896-214292918 AAGGAGGCAGAGGATAAGGAAGG - Intronic
921391269 1:214616830-214616852 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
922114526 1:222599051-222599073 GAAGAGAGAAAGAATGATGATGG - Intergenic
922117773 1:222631101-222631123 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923161682 1:231319842-231319864 AAGCAGTCAAAAAATGAGTAGGG - Intergenic
923222380 1:231907091-231907113 AAGGAGAGAAGGAAGGAGGGAGG - Intronic
923222389 1:231907126-231907148 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
923541031 1:234888333-234888355 AAGATGGCAAAGAAGGAGGAAGG + Intergenic
923806888 1:237267357-237267379 AAGAATACAAAAAATGAGCAGGG + Intronic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924091263 1:240503552-240503574 AAGAAGACAAAGATTGCAGAAGG - Intronic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924686875 1:246301960-246301982 ACAGAGACAGATAATGAGGAAGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063023728 10:2156515-2156537 AAAGAGAGAAAGAAAAAGGAAGG + Intergenic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063697973 10:8356325-8356347 AAGGAGGGAAAGAATGAAGGAGG - Intergenic
1063713116 10:8500003-8500025 AAGGAAATAAAGAAAGAGAAAGG - Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063717757 10:8545478-8545500 GAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1063785092 10:9373300-9373322 AAGGAGAGAAAAAAAGAGTATGG - Intergenic
1063814750 10:9759160-9759182 AAGGATGCTAAGAACGAGGACGG - Intergenic
1063929103 10:11011321-11011343 GAGTAGACAGTGAATGAGGAGGG + Intronic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064266593 10:13830347-13830369 AAGGAGTCAAGGAATTGGGAAGG + Intronic
1064272573 10:13878797-13878819 AAGGAGAGAAAGAGAGAGGGAGG + Intronic
1064347176 10:14542613-14542635 AAGGAGCCAAAAACTGAGTAGGG + Intronic
1064603116 10:17013167-17013189 AAGGAGTCAAAGAGAGAGAAAGG - Intronic
1064707064 10:18084091-18084113 AAGAAGTGAGAGAATGAGGAAGG - Intergenic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1064927277 10:20582694-20582716 AAGCAGAGAAAGTAGGAGGAGGG - Intergenic
1065360031 10:24880950-24880972 AAGGAAAGAAAGAAAGAAGAAGG - Intronic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065692299 10:28347056-28347078 AAAGGGAGAAAGAAAGAGGAAGG + Intergenic
1065709034 10:28497721-28497743 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065782453 10:29182772-29182794 AAGGAGAGAAAGAGAGAGGGTGG - Intergenic
1065871697 10:29961246-29961268 GAGGAGGCAGAGAATAAGGAAGG - Intergenic
1066036230 10:31489016-31489038 AAGTAGACAAAAAATTAGCAAGG - Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066370701 10:34815708-34815730 AAAGTGACAAAGAAAGGGGAAGG - Intergenic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066459867 10:35603687-35603709 AAAAAGACAAGGAATGGGGATGG + Intergenic
1066502434 10:36007104-36007126 AGGGAGAGAGAGAATGAGGGTGG - Intergenic
1066588882 10:36970461-36970483 AATGAGAAAAAGAATAAGGTTGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067513880 10:46920325-46920347 AAGAAATCAAAGAATGAGGCAGG + Intronic
1067648374 10:48131509-48131531 AAGAAATCAAAGAATGAGGCAGG - Intergenic
1067723463 10:48748328-48748350 AAGGAAACAAAGGCTGAGAAAGG + Intronic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068089759 10:52418898-52418920 AAAGAGACAAAGAAACAGAAGGG - Intergenic
1068099443 10:52533089-52533111 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068431681 10:56941407-56941429 AAAGAAAGAAAGAAAGAGGATGG + Intergenic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068614376 10:59096486-59096508 AAGGAACCAAGGAATGAGAAAGG - Intergenic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069021279 10:63491129-63491151 AAGTTGGCAAAGAATGAAGATGG + Intergenic
1069124287 10:64609830-64609852 ATGAAAACAAAGAAAGAGGAAGG - Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069817976 10:71210556-71210578 AAGGAGAGAGAGAAAGAGGTTGG + Intergenic
1069893730 10:71667752-71667774 AAGGGGACAAAGAGACAGGAGGG + Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070330101 10:75410266-75410288 AAGGAAAGAAGGGATGAGGATGG - Intergenic
1070363624 10:75714822-75714844 AGGGAGGGAAAGAAGGAGGAAGG - Intronic
1070606160 10:77899823-77899845 AAAGAGACCATGAAAGAGGAAGG + Intronic
1070655795 10:78270209-78270231 AAGGGGACCAAGCATGGGGATGG + Intergenic
1070658256 10:78285950-78285972 AGAGAGACAGACAATGAGGAGGG - Intergenic
1070686674 10:78489874-78489896 AAGGATTCAAAGAATGAAGGAGG + Intergenic
1070692071 10:78534245-78534267 GAGGAGACAGAGGAGGAGGAGGG - Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071166171 10:82810177-82810199 AAGCACACAAAGAATTAGGATGG - Intronic
1071361689 10:84852382-84852404 AAGGAGACAAACAATAAGCACGG - Intergenic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071453270 10:85819952-85819974 AGGGAGAGAAAGAGAGAGGAAGG + Intronic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071468456 10:85961733-85961755 AAGGAAAGATAGAAGGAGGATGG - Intronic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071793274 10:88978850-88978872 AAGGACAGAAAGAATAAGGAAGG - Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072480761 10:95808871-95808893 AAGGACACAAACACTGCGGAAGG - Intronic
1072761927 10:98063747-98063769 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1072846814 10:98840602-98840624 GAAGAGACAAAAAATGAGGAGGG + Intronic
1073018296 10:100419603-100419625 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1073234880 10:102005548-102005570 AAGGAGAGAAAGAATAAAGAAGG + Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073638301 10:105221900-105221922 AAGAAGAGAAAGAAGGAGGGAGG + Intronic
1074218749 10:111414418-111414440 AAGGAGACAGAAAAAGAGAAAGG + Intergenic
1074300638 10:112230561-112230583 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1074300648 10:112230593-112230615 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
1074313602 10:112343044-112343066 AAAGAGACATAGGAAGAGGAGGG - Intergenic
1074375853 10:112940214-112940236 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1074404548 10:113169650-113169672 AAGGAAAGAAGGAATGAGGTTGG + Intergenic
1074712868 10:116192197-116192219 ATAGAGACAAGGAATGGGGATGG - Intronic
1074724133 10:116289932-116289954 AAGGAGACAGGGAAGCAGGAAGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1074828022 10:117228571-117228593 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075284458 10:121171711-121171733 AAAAAGAGAAAGAAAGAGGAAGG + Intergenic
1075545026 10:123348713-123348735 AAGCAGACAAAGAAGGTGGGTGG - Intergenic
1075933807 10:126322697-126322719 AAGGAAACAAAGCCTGAGCAAGG + Intronic
1076068176 10:127465121-127465143 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076342114 10:129756327-129756349 AAGGAGACAAGGGAAGTGGAGGG + Intronic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076511712 10:131018970-131018992 AATGAGATAAAGAATGTGAAAGG + Intergenic
1076523320 10:131094669-131094691 AGGGAGAGAAGGAAGGAGGAAGG - Intronic
1076558701 10:131346976-131346998 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076558713 10:131347023-131347045 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076802774 10:132839038-132839060 AAGGAGACACTGATTGAAGATGG - Intronic
1077202357 11:1317088-1317110 AAAGAGACAAAGAAGGTGGCTGG - Intergenic
1077272224 11:1686739-1686761 AAGGAGGCAGAGAAGGAGGGAGG - Intergenic
1077372050 11:2186956-2186978 GAGGAGACAAAAGATGAGGGCGG + Intergenic
1077564942 11:3291716-3291738 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077570828 11:3337533-3337555 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077734220 11:4771467-4771489 CAGGAGACAGCGAATGAGAAGGG + Intronic
1077839810 11:5961594-5961616 AGGGACACAAACACTGAGGAAGG + Intergenic
1077841158 11:5976156-5976178 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1078991324 11:16649060-16649082 ACGGAGACAAAGAAAAAAGAAGG + Intronic
1079154530 11:17932598-17932620 AAGGAGCCATAGAAGGAGAAAGG + Intronic
1079205755 11:18413002-18413024 AAAGAGAGAAAGAAAAAGGAAGG - Intronic
1079327915 11:19510377-19510399 AAGGAGACAAGAAATCAGTATGG - Intronic
1079572339 11:21959408-21959430 AAGGATAGAAAGAATGAACAAGG + Intergenic
1080289198 11:30651935-30651957 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1081154863 11:39677499-39677521 GAGGAGACAGAGAAAGAGAAAGG + Intergenic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1083213247 11:61202550-61202572 AAGGAGCAAAAGAAAGAGAAGGG + Intergenic
1083569154 11:63747426-63747448 AAGGAGAGAAAGAATTGGGAGGG - Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1083630122 11:64091036-64091058 AAGAAGACAGAGGAGGAGGAGGG + Intronic
1083728434 11:64640510-64640532 AAGGAGACAATGAAAGGGGGAGG + Intronic
1084010582 11:66346385-66346407 AAGGAGGCAATGAAGCAGGAGGG - Intronic
1084576094 11:69988900-69988922 AAGGAGGGAGGGAATGAGGAAGG + Intergenic
1084638914 11:70412712-70412734 AAGGAGACAAGGGATCAAGAAGG - Intronic
1085336752 11:75702388-75702410 CAGGAGCCAGGGAATGAGGAGGG + Intergenic
1085653410 11:78289752-78289774 ATGAACACAAACAATGAGGAAGG + Intronic
1085750850 11:79160038-79160060 AAGGATAGAAAGAATGAAAATGG - Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086072968 11:82819468-82819490 AAGGAGTCAAAGAATGGGTTGGG - Intergenic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087202282 11:95357805-95357827 AAGTAAACCAAGAAGGAGGAGGG - Intergenic
1087234087 11:95698842-95698864 GAAGAAACAAAGAAAGAGGAAGG + Intergenic
1087423237 11:97959230-97959252 AAGGAGAAAAGGATGGAGGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088535379 11:110854610-110854632 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1089128451 11:116193680-116193702 AAGGAGACAAAGGCAGAGAAAGG - Intergenic
1089199565 11:116715624-116715646 CAGGAGACAAACACTGAGGGTGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089639661 11:119839358-119839380 AAGAAGAGAAAGAAGGTGGAGGG - Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089878506 11:121749930-121749952 AATGAGAGAATGAAGGAGGATGG + Intergenic
1089910314 11:122092404-122092426 AAGGAGAGAAATAAAGAAGAAGG + Intergenic
1089997045 11:122918376-122918398 AAGGAGACAAATAATAAGGCTGG + Intronic
1090043366 11:123310078-123310100 CAGGAGACAAAGAATGAGTTAGG - Intergenic
1090066211 11:123505841-123505863 AGGGAGAGAAAGAAAGAAGAAGG - Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090557553 11:127892946-127892968 AAAGAGCTAATGAATGAGGAAGG + Intergenic
1090654423 11:128832128-128832150 AAGTAGGCAAGGAAGGAGGAGGG - Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1091012568 11:132018189-132018211 AAGGAGGCAGTGAATGAGGGAGG - Intronic
1091362382 11:134987708-134987730 AAGGAAGCAAAGAGGGAGGAAGG + Intergenic
1092042959 12:5401514-5401536 AAGGTGACAAAGAATAAAGGTGG + Intergenic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092359809 12:7827023-7827045 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092597903 12:10027562-10027584 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092791344 12:12073200-12073222 ACGGAGACAAAGGATTAAGAGGG - Intronic
1092826132 12:12400717-12400739 AAGGATATAAAGGATGGGGAGGG - Intronic
1092968458 12:13668893-13668915 AAGGAAAGAAGGAATGAAGAAGG + Intronic
1093472936 12:19524105-19524127 AAAGAGAGAAAGAAAAAGGAAGG - Intronic
1093734592 12:22606239-22606261 AAGGAGAGAAGGAAGGAGGAAGG - Intergenic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1093783057 12:23159089-23159111 AAGGAAACAAATAGTGAGGATGG - Intergenic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094129918 12:27063717-27063739 AAAGAAAGAAAGAAAGAGGAGGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094285301 12:28786029-28786051 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1094292171 12:28863730-28863752 AAAGAGAGAAAGAAAAAGGAAGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095113734 12:38329887-38329909 AAGGACACAAACACTGCGGAAGG - Intergenic
1095180295 12:39140094-39140116 AAGGGGAAAAATAATGATGAAGG - Intergenic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095298607 12:40556254-40556276 AAGGAGAGTAAGAATAAGGGTGG + Intronic
1095514961 12:42995338-42995360 ATGGAGACAAATACAGAGGAAGG + Intergenic
1095651447 12:44615282-44615304 AAAGAGACAAAGTATGTGAATGG - Intronic
1096064112 12:48725412-48725434 AGGGACACAAACACTGAGGAAGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096197063 12:49655603-49655625 AAGGAGGGAAAGAAGGAGGAAGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096630205 12:52921579-52921601 AGGGACACAAAGAGAGAGGAAGG - Intronic
1096691279 12:53323437-53323459 AAGGAAAGAAAGAAAGAGAATGG + Intronic
1096786543 12:54020050-54020072 AGGGAGAGAAAGAAGGAGAAGGG - Intronic
1096830880 12:54313165-54313187 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1097006977 12:55926933-55926955 TAGGAGAGAATGAATGGGGAAGG + Intronic
1097119673 12:56721474-56721496 AAGGAGATAAAGAAAGGGGGAGG + Intronic
1097564237 12:61248547-61248569 AAGAAGACAAAAAGTGGGGAGGG + Intergenic
1097723879 12:63052548-63052570 AAGGAGCTAGAGAATGAGTATGG + Intergenic
1097787142 12:63773283-63773305 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1098022560 12:66170826-66170848 CAGGTGGCAAAGAATGAGGCTGG + Intergenic
1098460797 12:70731043-70731065 AAGGAGACAGAGAGGAAGGAAGG + Intronic
1098469714 12:70829213-70829235 AAGGAAAGAAGGAAAGAGGAAGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098791844 12:74834240-74834262 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1098980531 12:76951107-76951129 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099493076 12:83309587-83309609 AAGAAGAGAAAGAAGGAAGAAGG + Intergenic
1099595278 12:84655063-84655085 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100430115 12:94524323-94524345 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100588463 12:96001146-96001168 AAGGAGACAGAGGAGGAGAAAGG + Intronic
1100614451 12:96220241-96220263 AAGGAGAGAAAGAAAGAAAAAGG - Intronic
1100765914 12:97865490-97865512 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1100778904 12:98002875-98002897 AAGGAGAGAAGGAAGGAAGAAGG + Intergenic
1100865394 12:98852049-98852071 AAGGAGGGAAAGGATGATGATGG + Intronic
1101135840 12:101742209-101742231 AATGAGGCCAAGAATGAGGCTGG + Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101805063 12:108056429-108056451 AAGGAGACAGGCATTGAGGATGG - Intergenic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102052990 12:109876650-109876672 AAGGAAGGAAAGAAAGAGGAAGG + Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102523866 12:113496954-113496976 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1102570238 12:113823063-113823085 GAGGAGACAGGGGATGAGGAAGG - Intronic
1102669198 12:114602632-114602654 AAGGAAAAAAAGAAAAAGGAGGG + Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102856322 12:116297660-116297682 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1102994958 12:117342121-117342143 AAGGAGAGAAAGAGGGAGGGAGG - Intronic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103231791 12:119337287-119337309 AATGAGGGAAAGAATGAAGAGGG + Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1103832603 12:123791916-123791938 AATGACAGCAAGAATGAGGAAGG - Intronic
1104353453 12:128065044-128065066 AAAGAGGCAAAGAAAGAGAAAGG + Intergenic
1104451655 12:128873896-128873918 AAAGAGAGAAAGAAAGAGAAAGG - Intronic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104938019 12:132376952-132376974 AGGGAGACAGAGAGAGAGGAAGG + Intergenic
1104938032 12:132377024-132377046 AGGGAGACAGAGAGAGAGGAAGG + Intergenic
1104970315 12:132528005-132528027 AGGGGGACAAAGATGGAGGAGGG - Intronic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105429445 13:20324001-20324023 AAAGAGAGAAAGAAGGAGGGAGG - Intergenic
1105611811 13:21975407-21975429 AAGGAGAGAAAGAAAAAGAAAGG - Intergenic
1105907180 13:24823538-24823560 GAAGAGACAGAGAAAGAGGAAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106167480 13:27261696-27261718 AAGGGGACAAATCATGGGGAAGG - Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106295748 13:28412284-28412306 AAAGAGAAAAAGAAAGAGAAGGG - Intronic
1106359968 13:29021962-29021984 AAGGAGAAAAAGCATGAGAGCGG + Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1107138686 13:36974087-36974109 AAGATGTGAAAGAATGAGGAAGG + Intronic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107333087 13:39322696-39322718 AGGGAGAGAAGGAAGGAGGAAGG + Intergenic
1107562817 13:41572640-41572662 AGGGACACAAACACTGAGGAAGG + Intronic
1107794254 13:44033875-44033897 CAGGAACCAAGGAATGAGGATGG + Intergenic
1107806276 13:44156784-44156806 TAAGAAACAAAGAATGAAGATGG - Intronic
1108026905 13:46187511-46187533 AAGTAGACAAAGAAAGTGGATGG - Intronic
1108036596 13:46296643-46296665 CAGGAGAGAAAGAATCAGAAAGG - Intergenic
1108108252 13:47036871-47036893 AATGAGACCTAGACTGAGGAAGG + Intergenic
1108900403 13:55397591-55397613 AAGTAGACAAGGAAAGAGAATGG - Intergenic
1109098708 13:58150883-58150905 AAGGAGTCAATGAATGAAAATGG - Intergenic
1109245815 13:59953537-59953559 TAGGAGATAAAGAATGGGTAAGG + Intronic
1109253004 13:60043453-60043475 AGGGAGGCAAAGAATGAGAAAGG + Intronic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109611226 13:64767109-64767131 AAAGGGACAAAGAAAGAGGGAGG + Intergenic
1109812978 13:67539902-67539924 AGGGAGATAAAGAATGCAGAAGG - Intergenic
1109877494 13:68425215-68425237 AAGCAGACAAAAAATCAGTAAGG - Intergenic
1109910322 13:68902571-68902593 AAGGAAACAAAAAAAGAGAATGG - Intergenic
1110065476 13:71100240-71100262 AAGGAAACAAATAATCAGGTTGG + Intergenic
1110212873 13:72993525-72993547 AAGGAAATAAAGAATCAGGATGG + Intronic
1110678756 13:78283001-78283023 CAAGAGACATAGAATGAGGCAGG - Intergenic
1110716862 13:78715707-78715729 AAGGAGACAAATACTCAAGAAGG + Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110970328 13:81753355-81753377 AAAGAGAGAAAGAATAAGAAAGG - Intergenic
1111384010 13:87499666-87499688 AAGGTGACTAAGAATGTTGATGG - Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1111714306 13:91860485-91860507 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1111858972 13:93677175-93677197 AATGAGACAAAGGCTGAAGAGGG + Intronic
1112006820 13:95260588-95260610 AAGAAGACAAAGGAGGAAGAAGG + Intronic
1112038183 13:95517115-95517137 AGGGAGAGAAAGAAAGAGAAAGG - Intronic
1112143256 13:96670111-96670133 AAGAAGACTAAGAAGGAGCAAGG + Intronic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112380179 13:98881736-98881758 AAGGAGACAAGGAATTAGATGGG + Intronic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112425665 13:99297693-99297715 AAAAAAACAAAGAATGAGGATGG + Intronic
1112633610 13:101189267-101189289 AAGGAGAGAAAGAAGAAGAATGG + Intronic
1112644167 13:101310550-101310572 AAGCAGACAAAGAGAGGGGAAGG - Intronic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1113041840 13:106111972-106111994 AAAAAAAGAAAGAATGAGGAAGG - Intergenic
1113058079 13:106290840-106290862 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113172165 13:107517063-107517085 AAGAAAATAAATAATGAGGAAGG - Intronic
1113348941 13:109509057-109509079 AAGGAAGGAAAGAAAGAGGAGGG + Intergenic
1113387822 13:109866758-109866780 AGGGAGGGAAAGAAGGAGGAAGG + Intergenic
1113478814 13:110605806-110605828 AGGGACACAAACACTGAGGAAGG - Intergenic
1113490241 13:110686015-110686037 AAAGAAAAAAAGAAAGAGGAGGG + Intronic
1113585158 13:111459789-111459811 AAGGAGACGAAGAGAGAGAAGGG + Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113680667 13:112242138-112242160 AAGGAAAGAAACAAAGAGGAAGG + Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113913951 13:113860155-113860177 AGGGAGACAAAGAAAGAGATGGG + Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114040420 14:18673228-18673250 AAAGAGACAGAGAAAGAGAAAGG + Intergenic
1114337616 14:21708340-21708362 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1114350104 14:21841036-21841058 AAGGAGAGAAAGAGAGAGAATGG + Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114593815 14:23893988-23894010 AAAGAGACAAAGACTGCAGATGG - Intergenic
1114594172 14:23897843-23897865 AGGGACACAAACACTGAGGAAGG - Intergenic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1115094788 14:29621799-29621821 AATGAGGCAAAGAATGATTAGGG + Intronic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115118675 14:29913497-29913519 AAGTAAACATAGAGTGAGGATGG - Intronic
1115224878 14:31092202-31092224 GAGGAGAAAATGAATGAAGAAGG - Intronic
1115263443 14:31476356-31476378 AAGGAAAGAAAGAAAGAGAAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115582161 14:34771843-34771865 AAGGAGAGAAAGAAGAGGGAAGG + Intronic
1115700965 14:35952698-35952720 AAGAAGCCAAAGAAAGAGAAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116415981 14:44677477-44677499 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1116688544 14:48074782-48074804 AAGGAGACTAAAAAGAAGGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1117858034 14:60055996-60056018 CATGAGCCAAAGAATGCGGATGG - Intronic
1118253134 14:64182537-64182559 AGGGACACAAACACTGAGGAAGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1118981901 14:70723938-70723960 AAGATGACAGAGGATGAGGAGGG + Intronic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119752043 14:77085708-77085730 AAGTAGACAAAGAAAGACAAGGG + Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120090790 14:80331227-80331249 AAGGAGTGAATGAAAGAGGAAGG - Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120473150 14:84952162-84952184 AAGGAGGGAAAGAAATAGGATGG - Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120768994 14:88358280-88358302 AAGAAGACAAGGAATGATGGAGG + Intergenic
1120806560 14:88757827-88757849 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121551624 14:94807157-94807179 AAGGAGGCTAAGAGGGAGGAAGG - Intergenic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121975599 14:98401144-98401166 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1122387501 14:101359125-101359147 AAGAAGGCAGTGAATGAGGAGGG + Intergenic
1122550623 14:102547254-102547276 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1122597598 14:102903969-102903991 AAGCAGGCAGAGAATGAGGTTGG + Intronic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122957643 14:105078749-105078771 AGGGAGACAAACACTGCGGAAGG - Intergenic
1123046831 14:105521534-105521556 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1202830218 14_GL000009v2_random:19817-19839 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1124035649 15:26051602-26051624 AAGGAGGGAAAGCAGGAGGAAGG - Intergenic
1124609577 15:31199382-31199404 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1124618440 15:31259862-31259884 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
1124703873 15:31943977-31943999 GAGCAGACAAATAATGAGTAAGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124789273 15:32712065-32712087 AAGGAAACAAAGACTGGGAAGGG + Intergenic
1125052548 15:35317403-35317425 AAAGAAAGAAAGAAAGAGGAGGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125260397 15:37817768-37817790 AAGGAGGCAGGGAATGAGGCAGG + Intergenic
1125345095 15:38711230-38711252 AAGGAAACACAGAATTTGGATGG + Intergenic
1125375252 15:39021912-39021934 AAGGAAACTGAGAATGAGAAAGG + Intergenic
1125431533 15:39599530-39599552 AGAGAGAGAAAGAAGGAGGAGGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125621154 15:41063391-41063413 AAGTAGAAAAACAATTAGGAAGG + Intronic
1125989132 15:44088566-44088588 AAGAAGAGAAAACATGAGGAGGG - Intronic
1126096571 15:45094764-45094786 CAAGAGACAGAGAATGGGGAGGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126333169 15:47555973-47555995 AAGGAGAGAAACACTGATGAGGG - Intronic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126487541 15:49198870-49198892 AAGGAAAGAATGAAAGAGGAAGG - Intronic
1126549084 15:49907560-49907582 AAATAGACAAGGAATGAGGAAGG + Intronic
1126552108 15:49943180-49943202 AAAGAGAAAAAGAATGAAAAAGG + Intronic
1126571740 15:50158951-50158973 AAGGACACAAACACTGCGGAAGG + Intronic
1126799582 15:52286787-52286809 AGGGACACAAACACTGAGGAAGG + Intronic
1126970539 15:54106674-54106696 AAGGATAGAATGACTGAGGAAGG - Intronic
1127154696 15:56111494-56111516 AGGGACACAAACACTGAGGAAGG + Intronic
1127232107 15:57007909-57007931 AAAGAAACAAAGAAAGAGGAAGG - Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127920333 15:63489363-63489385 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1127959798 15:63882329-63882351 AAGGAGGGAAAGAAAAAGGAAGG + Intergenic
1128038444 15:64547868-64547890 AATGAGGCAAAGCAGGAGGACGG + Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128313131 15:66644206-66644228 AGGGAGACAAAGAACGCGCAGGG - Intronic
1128408576 15:67369464-67369486 AAGGAGGGAAAGAGAGAGGAAGG + Intronic
1128410332 15:67390401-67390423 AAAGAGGCATAGAATGGGGAAGG + Intronic
1128466242 15:67914965-67914987 GAGGAGGAAAAGAATAAGGAGGG - Intergenic
1128526601 15:68416391-68416413 AGGGAGACAGAGAACGAGCAAGG + Intronic
1128561115 15:68668370-68668392 CAGGAGACAAACAATGAACAAGG + Intronic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128755916 15:70183758-70183780 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1129258141 15:74345922-74345944 AAGGGAACAAAGGATGTGGAAGG - Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129592052 15:76924777-76924799 AAGAAGAAAAAGAATGTGGGAGG - Intergenic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1129914247 15:79254384-79254406 CAGGAGCCAAAGAATGTGGGTGG + Intergenic
1130046201 15:80446848-80446870 AATGAGACAGAGACAGAGGAAGG - Intronic
1130160377 15:81393049-81393071 AAGGAGACAAAACATGTGGATGG - Intergenic
1130191513 15:81740840-81740862 AAGGAAGCAAAGACTCAGGAGGG + Intergenic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130814597 15:87418051-87418073 AAGCAGACAGAGAAGTAGGAAGG + Intergenic
1130820202 15:87487175-87487197 AAGGAGACATAGAATGCAAATGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131126166 15:89859210-89859232 AAGGAAAGAAAGAAAGAGAAAGG - Intronic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131876119 15:96807913-96807935 AAGAAGACAAAGAGTGATGCAGG - Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132077231 15:98831970-98831992 CGAGAGACAAAGGATGAGGAAGG + Intronic
1132299517 15:100767400-100767422 AAGGAGAGAAAGATGGAGGGAGG - Intergenic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132404121 15:101532091-101532113 AAGGAAAGAAAGAAAGAGAAAGG - Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132706679 16:1246962-1246984 AAGGAGAGAAAGAGAAAGGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133368233 16:5228167-5228189 AAAGAGACAAAGAATCAAAAGGG - Intergenic
1133441816 16:5827706-5827728 AAGGGGACTTAGAATTAGGAAGG - Intergenic
1133647206 16:7775433-7775455 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
1133711727 16:8408158-8408180 AAGGAGAGAAGGAATGAAGGAGG - Intergenic
1134263283 16:12671362-12671384 AAGGAAACAGAGATTGAGAATGG + Intronic
1134429975 16:14194343-14194365 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1135037818 16:19092951-19092973 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1135053001 16:19207521-19207543 GAAGAGACAGAGAATGGGGAGGG + Intronic
1135432321 16:22396060-22396082 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1135543340 16:23349002-23349024 AAGGAGAGAAAGGAGAAGGAAGG - Intronic
1135628958 16:24021183-24021205 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1135652327 16:24217119-24217141 AAGGAAAGAAAGAAAGAGAAAGG + Exonic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135827058 16:25738223-25738245 TAGGAGACAGAGGATGAGCAAGG - Intronic
1135892631 16:26371420-26371442 AAGGAAAGATAAAATGAGGAGGG + Intergenic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1137289978 16:47045828-47045850 AAAGAGAGAAAGAAAGAGGTAGG - Intergenic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137689753 16:50414687-50414709 AAAGAGACAGAGAGAGAGGAAGG - Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137899573 16:52252337-52252359 ACGGAGACAAACAATGATGATGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138043734 16:53699236-53699258 AGGGACACAAACACTGAGGAAGG + Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138480386 16:57298923-57298945 GAGGAGCCAAAGAATGTGGGTGG + Intergenic
1138668410 16:58593053-58593075 AAAAACACAAAGAATCAGGATGG + Intronic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139147438 16:64341554-64341576 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1140102731 16:71932450-71932472 GAAGTGACAAAGAATTAGGAAGG - Intronic
1140102830 16:71933180-71933202 AAGGACACAAGAAGTGAGGAAGG + Intronic
1140259056 16:73361634-73361656 AAGGAGACCAAGATTGGGGATGG - Intergenic
1140345110 16:74205945-74205967 AAGGAGCCAAAGAAAGAGCTGGG + Intergenic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140777663 16:78264902-78264924 AAGGAGAAAAAGAAAAAGAAAGG - Intronic
1140801998 16:78496901-78496923 AAGGAGAGAATCAATGAGCAAGG - Intronic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140906687 16:79415316-79415338 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1140994558 16:80244655-80244677 AGGGACACAAACACTGAGGAAGG + Intergenic
1140997375 16:80274299-80274321 AAGGGAACAAAGAATGTGGTGGG + Intergenic
1141090824 16:81129277-81129299 AAGGAAAGAAAGAGAGAGGAAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143366496 17:6412159-6412181 AAGGAAAGAAAGAGAGAGGAAGG + Intronic
1143520673 17:7442569-7442591 AAGGAGACAAAGACCCAGAAAGG - Intronic
1143701140 17:8661045-8661067 AAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1143964096 17:10743968-10743990 AAAAAGAGAAAGAAGGAGGAAGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144239219 17:13293643-13293665 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144752076 17:17655906-17655928 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1145042952 17:19590353-19590375 AAAAAGACAAAGATTGATGAGGG + Intergenic
1145074602 17:19841681-19841703 AAGGAGGGAAAGTATGAGGGAGG + Intronic
1145083186 17:19912827-19912849 AAGGAGAGAAAGGCAGAGGAAGG + Intronic
1145295686 17:21591006-21591028 AGGGACACAAACACTGAGGAAGG + Intergenic
1145764108 17:27446190-27446212 AAGGAAAGAAAGAAAGAGGCGGG + Intergenic
1145931779 17:28691172-28691194 AAGTACACAAAGAAGGAAGACGG + Intronic
1145982906 17:29024675-29024697 AAGGAGGCAAGGAAAGAGAAGGG + Intronic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146252607 17:31362532-31362554 AAGGAAATAAAGAAGGAGAAGGG - Intronic
1146289548 17:31597894-31597916 AGGTACTCAAAGAATGAGGATGG + Intergenic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1146633101 17:34484694-34484716 AAGGAGACAAGGGAAGAAGAAGG + Intergenic
1146756280 17:35434422-35434444 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1146795064 17:35774796-35774818 AGGGAGACAAAGAAGGCAGAGGG + Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1148269485 17:46252521-46252543 AGGGACACAAAGACTGCGGAAGG - Intergenic
1148339226 17:46863513-46863535 GAGAAGACAAAGAAAGAGGATGG + Intronic
1148351094 17:46942799-46942821 AAGGACACAGAAAATGGGGAAGG - Intronic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148517570 17:48235093-48235115 GAGGAGACAAAGACTGAGCTGGG + Intronic
1148580064 17:48737495-48737517 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1148680198 17:49469479-49469501 AGGGAGTCAAAGAAGGTGGAGGG - Intronic
1148741784 17:49897267-49897289 AGAGAGAGAAAGAATGGGGAAGG + Intergenic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149393981 17:56220657-56220679 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150056340 17:62020836-62020858 AGGGACACAAACACTGAGGAAGG - Intronic
1150333862 17:64316019-64316041 AAGCAGAGAAAGAATGAGAGAGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150939361 17:69673833-69673855 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
1151188031 17:72378397-72378419 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1151404500 17:73877875-73877897 ATGGAGACAAAGGATGACCAGGG - Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151439916 17:74121716-74121738 AGGGAGACAGAGAATGAGACAGG + Intergenic
1151487242 17:74408676-74408698 AAGTAGCCAGTGAATGAGGATGG - Intergenic
1152838735 17:82552531-82552553 CAGAAGACAAAGGCTGAGGATGG - Intronic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153753138 18:8253970-8253992 AAGGTGATCAAGAATGGGGAGGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154111700 18:11574659-11574681 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1154438606 18:14366265-14366287 AAGACGATAAAGTATGAGGAAGG + Intergenic
1155041427 18:22068472-22068494 AAGGAGACAAAGCTTGAGCAGGG + Intergenic
1155081385 18:22413453-22413475 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155548925 18:26944143-26944165 GAGGAGACAAAGAAAGCGCATGG + Intronic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155739956 18:29277102-29277124 AAGGAGAGAAGGAAAAAGGATGG - Intergenic
1155882092 18:31162438-31162460 AAAGAGACTAGGAGTGAGGATGG - Intronic
1155885489 18:31203375-31203397 AAGGACACCAAGGATGAGGTTGG + Intergenic
1155905190 18:31442329-31442351 AGGGAGACAGACAAGGAGGAGGG + Intergenic
1156048133 18:32900237-32900259 ATGGAGACAAGGAAGTAGGAGGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156111416 18:33731824-33731846 AAGGAGACAGAGAAAGGAGAAGG - Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1157049902 18:44151415-44151437 AAGGTGACAAAAATTGAAGATGG + Intergenic
1157498780 18:48175193-48175215 AAGGACAGAAAAAATCAGGAAGG + Intronic
1157750438 18:50173510-50173532 AAGGAGACAAGGGAAGATGAAGG + Intronic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158305790 18:56103833-56103855 AAGGAAACAAAGAAGGAAGGAGG + Intergenic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158611100 18:58941849-58941871 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1158778337 18:60615014-60615036 AATGAGCAAGAGAATGAGGAGGG + Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159268188 18:66111643-66111665 AAGGAGACAGAGAGAGAGGAAGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159464627 18:68765243-68765265 AAAGAGCTAAAGAAGGAGGAAGG + Intronic
1159484949 18:69043520-69043542 AGGGACACAAACACTGAGGAAGG - Intronic
1159737344 18:72115804-72115826 AAGGAAGGAAAGAATGAGGAAGG - Intergenic
1159773461 18:72575772-72575794 AATGAGACAAGGAAAGAGAACGG + Intronic
1160085849 18:75777100-75777122 AGGGAGGCAGAGAATGAGGGAGG - Intergenic
1161139768 19:2640233-2640255 AAGGAAAGAAAGAGAGAGGAAGG + Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1161910737 19:7191868-7191890 AAGGAGGGAAGGAAGGAGGAAGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162310108 19:9901114-9901136 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1162310116 19:9901185-9901207 AAGGAAAGAAGGAAAGAGGACGG + Intronic
1162416395 19:10540625-10540647 AAGGAGACCAAGGATGGAGATGG + Intergenic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162872719 19:13598583-13598605 AGGGAGGGAAAGAAAGAGGAAGG + Intronic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1163045182 19:14636176-14636198 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1163200925 19:15768514-15768536 AACGAGACAGAGAATGAGAGAGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163468640 19:17484284-17484306 AAGGAGATAATAAATAAGGATGG + Intronic
1163504250 19:17695481-17695503 AAAGAAACAAAGAAAAAGGAGGG + Intergenic
1163514516 19:17755016-17755038 AAGGAGAGAAAGGATGAAGGAGG - Intronic
1164397501 19:27878816-27878838 AAGGAGAAAAAGAAGAAGTAGGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164833230 19:31339243-31339265 AAAGAGAAAAGGAATGAGAAAGG + Intronic
1164906853 19:31974862-31974884 CAGTAGACAAAGAACAAGGAGGG + Intergenic
1164937075 19:32223361-32223383 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1164975640 19:32570989-32571011 GAGGAAACAAGGAAGGAGGAAGG - Intergenic
1165189349 19:34049446-34049468 AAAGAAAGAAAGAAAGAGGATGG + Intergenic
1165339875 19:35203909-35203931 TAGGAGACAGAGACTTAGGAGGG - Intergenic
1165527050 19:36364949-36364971 AAAGAAAGAAAGAAGGAGGAAGG - Intronic
1165570435 19:36771157-36771179 AGGGACACAAAGGATGAGGTCGG + Intronic
1165927028 19:39333146-39333168 GAAAAGACAAAGAATGAGGCAGG + Intronic
1166062625 19:40336171-40336193 AAGGAGATAATGAATGAGCTGGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1166558419 19:43716736-43716758 AAGGAGACAATGCAGGAGGCAGG + Intronic
1166763346 19:45238264-45238286 GAGGAGGCAAAGATTGAGGGTGG + Intronic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167064636 19:47175322-47175344 AAGGAGACCAAGGTTGAGCATGG + Intronic
1167133524 19:47602974-47602996 AAAGAGAGAAAGAAAAAGGAGGG + Intergenic
1167276977 19:48544898-48544920 AAGGTGACAGAGACTGGGGAGGG - Intergenic
1167429136 19:49444231-49444253 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1167429147 19:49444309-49444331 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1167476285 19:49703188-49703210 AAGGAGACAGAAAAAAAGGAAGG - Intronic
1167514484 19:49915118-49915140 AAGGAAAGGAAGAATTAGGAAGG + Intronic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1167913051 19:52719916-52719938 AGGGAGACAAACACTGCGGAAGG - Intronic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1168359981 19:55731389-55731411 AAAGAGAGAAAAAAAGAGGAAGG + Intronic
1168532026 19:57137793-57137815 AAGGAGATAAAGAAAGAGAGAGG + Intronic
1168543568 19:57231933-57231955 AAGGATACAATGAAAGAGGAAGG + Intronic
1168659395 19:58154627-58154649 AAGGAAAAAAAGGACGAGGAAGG - Intronic
1202642473 1_KI270706v1_random:107955-107977 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
925170980 2:1750482-1750504 AAGGAGGGAAAGAAGGAGGGAGG - Intergenic
925221973 2:2149084-2149106 AAGGAGGGAAAGAAAGAGAAGGG - Intronic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
926537790 2:14134628-14134650 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
927060643 2:19416295-19416317 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
927060681 2:19416448-19416470 AAAGAGAGAAAGAAGAAGGAAGG - Intergenic
927823311 2:26288381-26288403 AAGCAGACAAAAAAAGAGCAGGG - Intronic
928057355 2:28071157-28071179 ATGAAGACAAAGAATGTCGAGGG - Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928099499 2:28427796-28427818 AAAGAGACAAAGAAAGAGCTTGG + Intergenic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
928794728 2:35004323-35004345 AAGGGGAGAAATAATGAGAAAGG - Intergenic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929423467 2:41819045-41819067 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929452010 2:42044195-42044217 AAAGAGACAGAGAGAGAGGAAGG + Intergenic
929648434 2:43653548-43653570 AAGTAAACCAAGAACGAGGAAGG + Intronic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
929743401 2:44629064-44629086 AAGTAGACATAAAATGAGTAAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930382837 2:50653863-50653885 AAGGAAACAAAGTAAGAGGCAGG - Intronic
930454311 2:51585492-51585514 AAACAGACAAAGCATGAAGATGG + Intergenic
930692814 2:54381685-54381707 CAGGAGTGAAAGGATGAGGAAGG - Intronic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932170215 2:69548545-69548567 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
932564820 2:72899617-72899639 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
932580940 2:72992370-72992392 AAGGAGACACTGGATGAGGCTGG + Intronic
932611662 2:73204115-73204137 AAAAAGACAAAAAATTAGGAGGG + Intronic
933309042 2:80637748-80637770 GAGAAGTGAAAGAATGAGGAAGG + Intronic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
933855698 2:86412150-86412172 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
934483109 2:94672303-94672325 AAGGAGAAAAAGAACCAGAACGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934751977 2:96799490-96799512 GAGGAAACAAAGGATGAGGCAGG - Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935028618 2:99301422-99301444 AAGGAGAGAGAGAGTGAGAAGGG + Intronic
935029369 2:99307083-99307105 AAGGAGAGAGAGAGTGAGAAGGG - Intronic
935173711 2:100629747-100629769 AAGGAAGCAAAGAAGGAAGAAGG - Intergenic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935420822 2:102867009-102867031 AAGGAGGCAAAGAGGGAAGAAGG + Intergenic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935830417 2:106996105-106996127 AAGGAGAGAAATGATGTGGAAGG - Intergenic
935901545 2:107798622-107798644 CAGAAGACAAAGGATGAGCATGG + Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936233626 2:110725152-110725174 AAGGAGGGAAGGAAAGAGGAAGG + Intergenic
936290528 2:111220377-111220399 AAGGAGACCAAGGAACAGGATGG - Intergenic
936536720 2:113317906-113317928 GAGGAGACAAACAATGAGTTTGG - Intergenic
936643707 2:114345318-114345340 AAGGAGACAGAGAAAGAGAGAGG + Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937460990 2:122085823-122085845 AAGGAAAGAAAGAAAGAGAAAGG - Intergenic
937524711 2:122754371-122754393 AAGCAGAAAAGGGATGAGGAAGG - Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
937623052 2:124011813-124011835 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
937737251 2:125307100-125307122 AAGGAGGGAAAGAAGGAGGGAGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
939097098 2:137845328-137845350 AAGTAGACAATAAATAAGGAGGG - Intergenic
939147522 2:138433982-138434004 AAGGAGACAAACAATCATGATGG + Intergenic
939284602 2:140112709-140112731 AGGGAGAGAAGGAAGGAGGATGG + Intergenic
939287209 2:140147545-140147567 AAGGGCACAAAAGATGAGGAGGG + Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939741570 2:145914663-145914685 AAAGGGACAAAGGATGAGAATGG + Intergenic
939893501 2:147765044-147765066 AAGGAGACAAAAAAGGGGAAAGG - Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940121121 2:150267372-150267394 AATGAGACAGAGAGGGAGGAAGG - Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940665007 2:156598322-156598344 AAATAAAGAAAGAATGAGGAAGG + Intronic
941239779 2:163022820-163022842 GAGGAGAGAAAGAATGGGAATGG - Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941471677 2:165896271-165896293 AAAGAGAAAAAGAAAGAGGTGGG - Intronic
941677132 2:168355855-168355877 AAGAAGAAAAAGAATTTGGAAGG - Intergenic
941687275 2:168460101-168460123 CAGGAATCAAAGAATCAGGAGGG - Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942280354 2:174356576-174356598 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
942307965 2:174627460-174627482 AAAGAGAGAAAGAAAGAGAAAGG - Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
942858214 2:180577532-180577554 AAGCAGACAAAGATTGAGAGGGG - Intergenic
942890729 2:180983689-180983711 AATGAGACAAAAAGGGAGGAGGG - Intronic
942995081 2:182250898-182250920 AAGGACCCAAAGAATGTTGAGGG + Intronic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
943344144 2:186717558-186717580 AAGGAGACAGAGAAGTGGGAGGG - Intronic
943395096 2:187324001-187324023 AAAAAGAAAAATAATGAGGATGG - Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
943793576 2:191964193-191964215 AAAGAGAGAAAGAAAGAGAAAGG - Intronic
943820112 2:192311592-192311614 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
943935703 2:193913469-193913491 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
944408232 2:199409916-199409938 AAATCAACAAAGAATGAGGAAGG + Intronic
944473270 2:200078349-200078371 AAGGACATAAAGAACAAGGAAGG + Intergenic
945658046 2:212649767-212649789 AAGGTGACAAAGATGGAAGAAGG + Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946126988 2:217571479-217571501 AAAGAATCAAAGAATGAGAAAGG + Intronic
946167308 2:217872385-217872407 AAGGAAACAGAGGATGTGGATGG + Intronic
946368367 2:219265105-219265127 AAGGAGATAAAGACCGAGGAGGG + Intronic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947219290 2:227777735-227777757 AAGGAAAGAAAGAAGGTGGAAGG - Intergenic
947292382 2:228590614-228590636 AAGAAGAGAGAGAATTAGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947538844 2:230960515-230960537 AAGGAGAAAAAGAATTAGTAGGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947909204 2:233790541-233790563 AAGGAGAAAAAGAAAGGGGGAGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948204381 2:236155341-236155363 AAAGAGACACATAATGAAGAGGG - Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948312405 2:236998426-236998448 AAATAAACAAAGAAGGAGGAAGG + Intergenic
948570868 2:238916426-238916448 AGGGAGGGAAAGAAGGAGGAGGG + Intergenic
948570879 2:238916472-238916494 AGGGAAAGAAAGAAGGAGGAGGG + Intergenic
1168746917 20:251374-251396 AAAGAGACAGAGAAAGAGAAGGG - Intergenic
1168759169 20:337226-337248 AAGGGGACAAAGTGTAAGGAAGG + Intergenic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169294045 20:4377356-4377378 AAAGAAACAAAAAATTAGGAAGG - Intergenic
1169327098 20:4685242-4685264 AAAGAGACAAAGAGTGAGACAGG + Intergenic
1169368990 20:5014135-5014157 AAGAAGATAAAGGATGAAGAAGG + Intergenic
1169502505 20:6174306-6174328 CAGGAGGCAAAGAATAACGAAGG + Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169507900 20:6233003-6233025 AAGGAAAGAAAGAGAGAGGAAGG - Intergenic
1169572992 20:6926858-6926880 AAGGAGACAGGGAATGTAGAGGG + Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169902201 20:10565034-10565056 AAGGAAAAAAAAAATTAGGAGGG - Intronic
1169933895 20:10862731-10862753 ACGGAGAGAAAGAAAGAGTAAGG - Intergenic
1170371127 20:15649136-15649158 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170709079 20:18774073-18774095 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
1170943593 20:20869686-20869708 AATGGGACAAAGACGGAGGAGGG + Intergenic
1170951410 20:20939663-20939685 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
1170966671 20:21078917-21078939 AAAGAGGAAAAGAAAGAGGATGG - Intergenic
1171335353 20:24380634-24380656 CAGAAAACAAAGAATGATGAAGG - Intergenic
1171384300 20:24757937-24757959 AATGACACAAAGGATGAGAAGGG + Intergenic
1171852137 20:30316403-30316425 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1171889577 20:30698137-30698159 AGAGAAACAAAGAATGAGGAGGG - Intergenic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172437924 20:34943067-34943089 CAGGAGTCAATGACTGAGGATGG - Intronic
1172650475 20:36498549-36498571 AATGAGACCAAGAATGGGGCTGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172740660 20:37164077-37164099 AAGGAGAGAAAGAAAAAGAAAGG - Intronic
1172800545 20:37573439-37573461 AATGAGACAGAGAAGGAGTAGGG + Intergenic
1172835001 20:37867854-37867876 ATAGAAACAAAGAATGAGCAAGG + Intronic
1172970788 20:38871635-38871657 AGGGAGGCAAAGAAAGGGGAAGG + Intronic
1173001843 20:39110532-39110554 AAAGAGACAAGAAAAGAGGAGGG - Intergenic
1173186309 20:40843215-40843237 AAGGTGAGAAGGAAGGAGGAAGG - Intergenic
1173754311 20:45501580-45501602 AAGGAGAGAAAGAAGGATGGTGG - Intergenic
1174018422 20:47508504-47508526 AAGAAGAGAAAGCATGGGGAGGG + Intronic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174338613 20:49882413-49882435 AAGGAGAGAAAGGAGGAGCATGG - Intronic
1174523699 20:51154910-51154932 AAGTGGACTAAGAGTGAGGAAGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174796391 20:53526070-53526092 AAGGAAAGAAGGAATGAGGATGG - Intergenic
1174877863 20:54247098-54247120 AAGGTGTCAAAGAATGAATACGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1174994878 20:55555172-55555194 AAGAAGACAGAGAAAGGGGATGG + Intergenic
1175035828 20:56000969-56000991 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175805161 20:61823560-61823582 GAGGAGACCAAGAATTAAGAAGG + Intronic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1176256484 20:64155749-64155771 AAGGAGACAAAGGATGGAGAGGG - Intronic
1176457076 21:6923214-6923236 AAGATGATAAAGTATGAGGAAGG - Intergenic
1176609405 21:8864655-8864677 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1176664494 21:9672501-9672523 AGGGAGGCAAAAAAAGAGGAAGG - Intergenic
1176835249 21:13788296-13788318 AAGATGATAAAGTATGAGGAAGG - Intergenic
1176892269 21:14332401-14332423 AAGGAAGCAAAGAAAAAGGAAGG + Intergenic
1177043170 21:16137871-16137893 AAGGAGATAAAGAATTTTGAAGG - Intergenic
1177642974 21:23867768-23867790 AAGGAAAGAAGGAAAGAGGAAGG - Intergenic
1177698067 21:24599143-24599165 AAGCAGGCACAGAATGTGGAAGG + Intergenic
1177905492 21:26967267-26967289 AGGGAGACGAAGTAGGAGGAAGG + Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178139081 21:29661511-29661533 CACAAGACAAGGAATGAGGACGG + Intronic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178290908 21:31367123-31367145 AAGGAGAGAAGGAAGGAGGGAGG + Intronic
1178323317 21:31622783-31622805 AAAGAAAAAAAGAAAGAGGAAGG - Intergenic
1178481124 21:32979851-32979873 AAAGAGAGAAGGAAAGAGGAAGG + Intergenic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179645458 21:42772573-42772595 AAGGACAGAAGGAAAGAGGAAGG + Intronic
1179944515 21:44662560-44662582 AAGTAGACAGAAAATCAGGAAGG + Intronic
1180178793 21:46108061-46108083 AAAGAGAGAAAGAAAGAGAAAGG - Intronic
1180359500 22:11874502-11874524 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1181136730 22:20772369-20772391 AACAAGACAGAGAATGAGGGAGG + Intronic
1181898217 22:26129856-26129878 AAGAAGACAAAGAAGGAAGGAGG - Intergenic
1181901493 22:26159944-26159966 AGTGAGACAGAGAAAGAGGAAGG + Intergenic
1182006018 22:26960297-26960319 AGGGAGAGAAAGGAGGAGGAAGG + Intergenic
1182013416 22:27019597-27019619 AAGGAAAGAAAGAGAGAGGAGGG - Intergenic
1182046533 22:27278599-27278621 AAGGAGACAATGACAGAGGGAGG - Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182126078 22:27816799-27816821 AAGGAGGGAAAGAGAGAGGAAGG - Intergenic
1182178233 22:28315859-28315881 AGGGACACAAAGGATGAGGTTGG + Intronic
1182399052 22:30060299-30060321 AGGGACACAAACACTGAGGAAGG + Intergenic
1182399935 22:30067355-30067377 AGGGACACAAACACTGAGGAAGG + Intergenic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182567396 22:31210578-31210600 AATGTGAGAGAGAATGAGGAGGG + Intergenic
1182773603 22:32814246-32814268 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
1182792994 22:32968546-32968568 AAGCTGACAAAGAAGGTGGAGGG - Intronic
1182850799 22:33472311-33472333 AAGGAGACAAAGAGAGAGACAGG + Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183229112 22:36569920-36569942 AAGGAAAGAAAGAAAGAGGTCGG + Intronic
1183576677 22:38695042-38695064 AAGGAAAGAAAGAATTAGGGCGG - Intronic
1183618339 22:38958468-38958490 AAGGAAAGAAAGAAAGAGAAAGG - Intronic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184047940 22:41983375-41983397 AAGGAGACAGAGAGCTAGGAGGG - Intronic
1184291801 22:43501374-43501396 AGGGAGAGAAAGAAGGAAGAGGG - Intronic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185301031 22:50081361-50081383 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
949100889 3:143464-143486 AAAGGGAGAATGAATGAGGAAGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949104927 3:192578-192600 AAGGAGAAAAAGAACTAGGCCGG + Intergenic
949134576 3:548282-548304 AAGGAATTAAAGAAAGAGGAAGG + Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949270595 3:2211967-2211989 AAGGAAAAAAAGAAAGAGAAAGG - Intronic
949335008 3:2965187-2965209 AATGAGACAAAGAATGTGGGAGG - Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949389821 3:3547264-3547286 AAAGAGAAAAATAATGATGAGGG - Intergenic
949401064 3:3665849-3665871 AAAGAGAGAAAGACAGAGGAAGG + Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949561548 3:5207351-5207373 AAGGAGACAGAGAATGCTCAGGG - Intronic
949834953 3:8257901-8257923 AAAGAGAGAAAGAAAGAGAAAGG + Intergenic
949989977 3:9570581-9570603 AGGGACACAAACACTGAGGAAGG + Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950344069 3:12276205-12276227 AAAGAGACAAAGAGGGAGGGAGG + Intergenic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950739815 3:15041296-15041318 AGAGATACAAAGAATGGGGAGGG - Intronic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
950795946 3:15510801-15510823 AAAGAGACCAAGAGAGAGGAAGG + Intronic
950907566 3:16552997-16553019 AAGGACAGAAGGAATGAGGGAGG + Intergenic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951285360 3:20805655-20805677 AAGCAGACAAAGCATTAGGAAGG + Intergenic
951355182 3:21657988-21658010 AAGGAGACAAAGATTCTGAAGGG + Intronic
951417663 3:22444937-22444959 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951840145 3:27025613-27025635 GAGAAGAGAAAGCATGAGGAGGG - Intergenic
952190150 3:31014544-31014566 AATGAAACAAAGAATGGGAATGG + Intergenic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
952981240 3:38737793-38737815 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
953076063 3:39571491-39571513 AAAGAGAGAAAGAAAAAGGAAGG - Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953305102 3:41821707-41821729 AAGGGGCCAAGGGATGAGGAGGG - Intronic
953363866 3:42325130-42325152 AAGGAAACAAAGATCTAGGAAGG - Intergenic
953530346 3:43735061-43735083 AAGGAGAGAAAGTATTAGGTTGG + Intergenic
953824728 3:46241197-46241219 CAAAAGACAAAGAAAGAGGAAGG - Intronic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954339022 3:49938611-49938633 AAGGAAAGAAAGAAAGAGGCCGG - Intergenic
954812906 3:53258870-53258892 AAGGAGACAAAGAAACAGTTAGG - Intergenic
954901360 3:54022695-54022717 AAGGAGACAGAGAGAGAGAAGGG + Intergenic
954940551 3:54368440-54368462 AGGGAGAGAAAGAAAGAGAAGGG + Intronic
955011654 3:55022623-55022645 AAGGAGGGAAGGAAGGAGGAAGG - Intronic
955117327 3:56018524-56018546 AATGAAAGAAAGAATGAGGGAGG + Intronic
955141850 3:56277526-56277548 AAGAACCTAAAGAATGAGGAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955532742 3:59891236-59891258 AAGGACACAAAATATGAGGAAGG + Intronic
955608271 3:60730422-60730444 AAGGAGACAAAGAATCCAGTGGG - Intronic
955774070 3:62415009-62415031 AAGGAGACAAAGCATCAGACGGG - Intronic
955868183 3:63408179-63408201 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
955868192 3:63408262-63408284 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956053836 3:65277645-65277667 AAGGACACCAAGAGTGAGGCTGG - Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956099654 3:65754085-65754107 AAGCAAACAGAAAATGAGGATGG - Intronic
956256323 3:67286785-67286807 AATGAGACAAAGAAATAGCATGG + Intergenic
956462779 3:69488116-69488138 AAAGAGAAAAAGAAAGAGAAAGG + Intronic
956932409 3:74059897-74059919 AAGGAAACAAAGAAGGAAGCAGG + Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957191882 3:77020545-77020567 AAGGAAACAAAGAATAATGCTGG + Intronic
957234865 3:77574059-77574081 GAATAGACAAAGAATGAGAATGG + Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957415478 3:79897272-79897294 AAACAGTCAAAGAATGAAGATGG - Intergenic
957516797 3:81265205-81265227 GAGGAGACAAAGGATATGGAGGG - Intergenic
957587956 3:82156988-82157010 AAGGAAACAAAGAATAAAGGAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958579657 3:96001514-96001536 ATGGACACAAAGAGTGAGGTTGG - Intergenic
959098220 3:101980528-101980550 AAGGACAGAAAGAATGAAGAAGG - Intergenic
959224786 3:103565835-103565857 AAGGAGACTAAGATGGAGAATGG + Intergenic
959241636 3:103803710-103803732 AAAGAGAGAAAGAAAAAGGAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959327484 3:104956138-104956160 AAAGAGAGAAAGAAAAAGGAAGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960034778 3:113091508-113091530 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
960062218 3:113335054-113335076 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
960243839 3:115377674-115377696 AAGGAGACAGAGAATAAAGCAGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
960584865 3:119311328-119311350 CATGAGTCAAGGAATGAGGAAGG - Intronic
960782799 3:121338661-121338683 AAAGAAAAAAAGAAAGAGGAAGG + Intronic
961049741 3:123736389-123736411 AGAGGGACAAAGAAGGAGGAAGG + Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
961340137 3:126212328-126212350 AAGGAGGGAAGGAAGGAGGAAGG + Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961865930 3:129953499-129953521 AAGGAGGGAAAGAAAAAGGAAGG - Intergenic
962095714 3:132290394-132290416 AAGGAGACAAATATGGAGGCTGG - Intergenic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
962326943 3:134442255-134442277 AAGGAGACAGAGACTGCTGATGG - Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962450336 3:135508982-135509004 AAGGAGACAGAAAATTAGTAAGG + Intergenic
962490885 3:135893073-135893095 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
962499390 3:135974641-135974663 AGGGAGACAGAGAACGAGGGAGG - Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962572478 3:136724450-136724472 AGGGACACAAACACTGAGGAAGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
963108437 3:141665712-141665734 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963108517 3:141665962-141665984 AAGGAGACAATGAAGGAAGGAGG + Intergenic
963110190 3:141682260-141682282 GAAGAGAGAAAGAAAGAGGAAGG + Intergenic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963204015 3:142614376-142614398 AGGCAGTGAAAGAATGAGGATGG + Intronic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963513809 3:146282354-146282376 AAGAAGAGAGAGAATGAAGAAGG + Intergenic
963553435 3:146754569-146754591 AAAGAAAGAAAGAAAGAGGAGGG - Intergenic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963588372 3:147224563-147224585 AATGAGAAAAAGAAAGAGAAGGG + Intergenic
963768218 3:149361088-149361110 ACAGAGAAAAAGAATAAGGAGGG - Intergenic
963783549 3:149510624-149510646 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
963957403 3:151270009-151270031 AAGGAGATAAATGATGAAGAAGG + Intronic
963960497 3:151304198-151304220 AAGGAGACAGAGAAGGTGGGAGG + Intronic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964185311 3:153935253-153935275 AAGGAGACAGATAATAAGCAAGG + Intergenic
964531071 3:157668595-157668617 TAGAAGCCAAAGAATAAGGAAGG - Intronic
964642300 3:158921858-158921880 AAGGAGACAATGACTGGGGAGGG - Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964978997 3:162655562-162655584 TAGGAGACAAATAATGGGGGTGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965498933 3:169433543-169433565 AAGAAAAGAAAGAAAGAGGAAGG + Intronic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965655565 3:170980103-170980125 AAGTAGACAAAAAATCAGTAAGG - Intergenic
965701788 3:171465484-171465506 AAGGAAACAAGGAATAGGGAAGG + Intergenic
965726424 3:171721303-171721325 AAGGATAGAAAGAAAGAGCAAGG + Intronic
965785039 3:172326725-172326747 AACGAGAAAAAGACTGGGGAGGG - Intronic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966314598 3:178631630-178631652 AGGTAGACAAAGAATGAGAGAGG + Intronic
966510570 3:180757825-180757847 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
966510576 3:180757860-180757882 AAGGAAAGAAAGAAAGAGAAGGG + Intronic
966510590 3:180757956-180757978 AAGGAAAGAAAGAAAGAGAAGGG + Intronic
966569383 3:181424003-181424025 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
966616465 3:181918789-181918811 AAAGAGAGAAAGAGAGAGGAAGG + Intergenic
966630494 3:182069182-182069204 AAGGAAAAAAAGAAAAAGGAAGG - Intergenic
966647152 3:182259452-182259474 AAGGAGATAAAGTATGGGAAAGG + Intergenic
966683657 3:182670530-182670552 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
966735335 3:183182559-183182581 TAGGAGACAAAGCAGGAGGGGGG + Intronic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
966767747 3:183478308-183478330 TAGGAGACAAAGCAGGAGGAGGG - Intergenic
966941295 3:184749318-184749340 AGGGAGAGAAAGAAAGAAGAAGG + Intergenic
966978089 3:185104179-185104201 ATGGACACAAAGGATGAGGTTGG - Intronic
967395339 3:189002245-189002267 GAGGAGACAAAGCAGGAGGTTGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967647793 3:191947517-191947539 AAGAAGACAGGGAAAGAGGAGGG + Intergenic
967787273 3:193511261-193511283 AAGGATGCAAAGAAAGAGGCAGG + Intronic
967827167 3:193886315-193886337 AAGGAATCAAAGAAAGAGGTTGG - Intergenic
968002831 3:195219490-195219512 AAGGGAAGAAGGAATGAGGAAGG + Intronic
968914314 4:3490552-3490574 AAGGAAAAAACGAATGAGCAGGG - Intronic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969046896 4:4342893-4342915 AAGGAGGCAAACAATGAATACGG + Intergenic
969131783 4:4995534-4995556 AAGCAGGCAGAGAAGGAGGAAGG + Intergenic
969417773 4:7072222-7072244 AAGCAGACCAAGAATAAGGCAGG - Intergenic
969651156 4:8469130-8469152 AAGAGGACAAAGGATGAAGAAGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970282877 4:14478026-14478048 AATGAGACAAAGGATTAAGATGG + Intergenic
970297182 4:14642277-14642299 AAGGAGGCAAAGAGGGAGGAAGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970360139 4:15301034-15301056 TAGGACACACAGTATGAGGAAGG + Intergenic
970432848 4:16004926-16004948 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
970530827 4:16981344-16981366 AAATAGACAAAGAATTATGATGG + Intergenic
970546082 4:17131774-17131796 AAGGGAACAGAGAATGGGGAAGG - Intergenic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
971314190 4:25553490-25553512 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972035366 4:34513321-34513343 AAGGATTCAAAGAATAAGGACGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972266446 4:37464580-37464602 ATGGAAAGAAAGAATGAGGGAGG + Intronic
972288561 4:37669884-37669906 AGGGACACAAACAATGCGGAAGG + Intronic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
972687850 4:41368461-41368483 ATGAAGACAAAGAATGGGGCAGG + Intronic
972695341 4:41439741-41439763 AAAGATACAAAAAATGAGGCGGG + Intronic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973595952 4:52490359-52490381 AAGTAAAGAAAGAAAGAGGAAGG + Intergenic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
973835587 4:54806233-54806255 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973835612 4:54806375-54806397 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
974099576 4:57402021-57402043 AAGGAGAGAAAGAGTGAGGGAGG + Intergenic
974304968 4:60124402-60124424 AAGGAGGTAGAGAATGAGGTAGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974491963 4:62575926-62575948 AAGGAAAGAAGGAAGGAGGAAGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974669392 4:65009373-65009395 AAGGAGAGAAAAATTGACGAGGG + Intergenic
974669467 4:65010231-65010253 AAGGAGTCAAAGGAAGAAGAAGG + Intergenic
974757258 4:66225689-66225711 AAGGAGGCAAGGAACAAGGAAGG + Intergenic
974837452 4:67268115-67268137 ATGGAAACAAAGAAAGAGGGAGG - Intergenic
974845794 4:67350224-67350246 AAAAAGAGAAAGAAGGAGGATGG + Intergenic
975041868 4:69755018-69755040 CAGGAAACAAAAAATGAGGTCGG + Intronic
975251703 4:72187051-72187073 AGGGAGACATAGAAAGAGAACGG - Intergenic
975495405 4:75030852-75030874 AGGGACAGAAAAAATGAGGAAGG - Intronic
975564479 4:75739270-75739292 AAATTGACAAATAATGAGGATGG - Intronic
975623044 4:76313658-76313680 AAGGACACAAAGATAGATGAAGG + Intronic
975902004 4:79164417-79164439 GAGCAGACAAACATTGAGGACGG + Intergenic
975902635 4:79170725-79170747 AAGGAGAGAAAGCCTGAGGCTGG - Intergenic
975951933 4:79784280-79784302 AGGGAGGCAAAAAAGGAGGAAGG - Intergenic
975976157 4:80098760-80098782 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
976935091 4:90621277-90621299 AATAAGACAAAGAGTGAGGTAGG - Intronic
976961353 4:90980053-90980075 AAGGAGATAAATAATCAGGGTGG + Intronic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977034333 4:91930742-91930764 TTTGAGACAAAGATTGAGGATGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978108005 4:104928140-104928162 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
978578839 4:110212660-110212682 AAAGAAACAAAGAAAGAGAAAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978733805 4:112062514-112062536 AAGGAGAGAAAGACAGAGGGAGG + Intergenic
978750505 4:112241033-112241055 AAGGAAACTAATAATGAGAAGGG - Intronic
978863764 4:113482374-113482396 GAGGAGACAAAGAAAGACTAAGG + Intronic
979273822 4:118792737-118792759 AGGGACACAAAGACTGCGGAAGG + Intronic
979490471 4:121320958-121320980 AAGGTGACAAAAAATTAGAAAGG - Intergenic
979808496 4:125005180-125005202 AAAAATACAAAGAATGAGGCAGG - Intergenic
979876553 4:125898764-125898786 AAGGAGAAAAAGAGAAAGGAAGG - Intergenic
980094461 4:128474999-128475021 AAGGAAAAAAAGAACTAGGAGGG + Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980402241 4:132306299-132306321 AGGGAGAGAAAGAGTGAGAAAGG + Intergenic
980579171 4:134727461-134727483 ATGGAGTCAAAGGAAGAGGAAGG + Intergenic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
980811495 4:137887689-137887711 AAAGAGAGAAAGAAAGAGAATGG + Intergenic
980828881 4:138105567-138105589 AATGAAACAAAGACTGAGGAAGG + Intergenic
980860120 4:138489128-138489150 AAAGACACATATAATGAGGATGG + Intergenic
980883784 4:138739977-138739999 AGGGACACAAACACTGAGGAAGG + Intergenic
980901362 4:138908273-138908295 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
980962773 4:139492799-139492821 AAGGAAAGAAAGAAAAAGGAAGG - Intergenic
981011828 4:139933155-139933177 AAGGAGGGAAAGAGTGGGGAAGG + Intronic
981088464 4:140708248-140708270 AAGGAGACAAAGACTTGAGAAGG + Intronic
981330986 4:143510083-143510105 GAGGAACCAAAGAAGGAGGAGGG - Intergenic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
981851594 4:149237053-149237075 AAGCAGACAAAAAATCAGCAAGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982124485 4:152172980-152173002 ATGGAAACAAAACATGAGGATGG + Intergenic
982232410 4:153221725-153221747 AAGGAAGGAAAGAGTGAGGAAGG + Intronic
982232458 4:153221930-153221952 AAGGAACGAAAGAGTGAGGAAGG + Intronic
982373157 4:154656640-154656662 AAGGAGACAAAGTCGGAGAAAGG - Intronic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982580504 4:157173004-157173026 AATGAGAAAACGAATTAGGAGGG - Intergenic
982649763 4:158073143-158073165 AAGAAAAGAAAGAAAGAGGAGGG + Intergenic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983122137 4:163899447-163899469 TAGGACACAAAGAAGTAGGAGGG - Intronic
983274365 4:165599742-165599764 AAGGAGAAAAAGAACAAGCAGGG - Intergenic
983442501 4:167804516-167804538 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983595122 4:169457681-169457703 AAGGAGAGAAAGAAGGGGGGAGG + Intronic
983680113 4:170343671-170343693 AGGGAAAGAAAGAATGATGATGG - Intergenic
984222475 4:176994816-176994838 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
984612324 4:181855812-181855834 AAGGAGAGAAAGGGAGAGGATGG + Intergenic
984647003 4:182231185-182231207 AGGAAAACAAAGAAAGAGGATGG - Intronic
984813598 4:183818244-183818266 AGGGACACAAACACTGAGGAAGG - Intergenic
984908842 4:184653088-184653110 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985236861 4:187884635-187884657 AAGGAAAAAAAGTATGTGGATGG - Intergenic
985273412 4:188216198-188216220 AAGGAGACAGGGAAGGAGGGAGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985409964 4:189673158-189673180 AGGGAGGCAAAAAAAGAGGAAGG - Intergenic
985445784 4:190020763-190020785 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1202769838 4_GL000008v2_random:193852-193874 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
985645167 5:1081531-1081553 AGGGAGAGAAAGAAAGAGAAGGG + Intronic
985669363 5:1199311-1199333 AAAGAGACAAAGAAAGAGACAGG - Intergenic
985936026 5:3099272-3099294 AAAGAGACAGAGAAAGAGGGAGG - Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986468384 5:8050036-8050058 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
986516235 5:8566853-8566875 GAGCAGATAAAGAATGACGAGGG - Intergenic
986800703 5:11257213-11257235 AAGGAAAGAAAGAATGGGAAAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
987317421 5:16736740-16736762 AAGAAGAAAAAGAATGTGGTAGG + Intronic
987598668 5:20036421-20036443 AAGGAGTGAAAAAAAGAGGAGGG + Intronic
987628764 5:20439754-20439776 AAATAGACAAGGAATGAGGATGG - Intronic
987687393 5:21223047-21223069 AAGGAAAGAAAGAAAGAAGAAGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988216284 5:28277715-28277737 AAAGAGAGAAAGAAAGAGGGAGG - Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988956607 5:36326369-36326391 AAGGAGGCAAGGAAGGAGGAAGG + Intergenic
988994536 5:36702091-36702113 AAGGAGAAAAAGAGAAAGGAAGG + Intergenic
989134943 5:38144454-38144476 AAGGAAATAGAGAAAGAGGAAGG - Intergenic
989527263 5:42467961-42467983 AAAGAGGCAGAGAATAAGGAGGG - Intronic
989783115 5:45293934-45293956 AAGAGGATAACGAATGAGGAAGG + Intronic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990007441 5:50960510-50960532 AATGAAAGAAAGAAAGAGGAAGG - Intergenic
990011313 5:51002462-51002484 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
990014491 5:51043095-51043117 AGAGAAACAAAGAATGATGATGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990378988 5:55202915-55202937 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990507491 5:56458947-56458969 AAGGAGGGAAAGAAGAAGGAAGG - Intronic
990522245 5:56591496-56591518 AAGGAGACCAAGAAAGAAAAAGG + Intronic
990561945 5:56992131-56992153 AAGCAGCCAAAGAAGTAGGATGG - Intergenic
990628472 5:57641133-57641155 TGGGAGACAAAGGCTGAGGAAGG - Intergenic
990884892 5:60580099-60580121 AAGGAGACAGAGACAGAGTAAGG + Intergenic
991072641 5:62501775-62501797 AAAGAACCCAAGAATGAGGATGG + Intronic
991072849 5:62504268-62504290 AAGGAGACAAGGAAGGAAGGAGG - Intronic
991173445 5:63656302-63656324 TAGGAGACAAGCAAAGAGGAGGG - Intergenic
991626717 5:68610374-68610396 AAGTAGACAAAAAATAAGTAAGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992366365 5:76094313-76094335 AAGGAGGCAATGAATGAAAAGGG - Intronic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
992628876 5:78661450-78661472 AAAGAGAGAAAGAAAGAAGAAGG + Intronic
993055904 5:82979377-82979399 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
993311812 5:86342006-86342028 AAGGGGACCAAAAATGAGTAAGG + Intergenic
993316098 5:86408032-86408054 AAGAAGAAAAAGAATAAGGTGGG + Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993407651 5:87531534-87531556 AAAGAGAGAAGGAAGGAGGAAGG - Intergenic
993569177 5:89514999-89515021 AAAGAGAGAAAGAAAGAAGAAGG + Intergenic
993618204 5:90137690-90137712 AAAAAAACAAAGAATGGGGAAGG - Intergenic
993682737 5:90899639-90899661 TAGGATACAAAGAACGAGGGTGG - Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993881633 5:93369688-93369710 AAGGAGAAAAAGAGTGGGGCAGG - Intergenic
994040649 5:95256203-95256225 AATGAAAAAAAGAATAAGGAAGG + Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994285517 5:97960497-97960519 AAGGAAACAGAGAAGGGGGAAGG + Intergenic
995054369 5:107743071-107743093 GAGGACAGAAAGAATGAGAATGG + Intergenic
995062774 5:107829420-107829442 AAGGAAACTAAGACTCAGGAGGG - Intergenic
995160336 5:108972432-108972454 AAGGAGACTAATAATGAAGATGG - Intronic
995183498 5:109249895-109249917 AAGGAGAGCAAGAATGATCAAGG + Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995401960 5:111752514-111752536 AAAAAGACAAAGATTGGGGAGGG - Intronic
995788238 5:115854829-115854851 AAAGTGACAAATACTGAGGAAGG - Intronic
995844600 5:116480282-116480304 AATGAAACAAAGGGTGAGGAAGG + Intronic
995900439 5:117059530-117059552 TAAGGGACAAAGAGTGAGGAAGG + Intergenic
995942096 5:117599125-117599147 AAGGACACAAACACTGGGGAAGG - Intergenic
995996318 5:118304811-118304833 AAGGAGAGATGGAAGGAGGAAGG + Intergenic
996007461 5:118440088-118440110 AAGGAGACAGAGAGCAAGGAGGG + Intergenic
996045575 5:118869396-118869418 AATAATACAAAGATTGAGGAGGG + Intronic
996057758 5:118999542-118999564 AGGGACACAAACACTGAGGAAGG + Intergenic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996303353 5:122016258-122016280 AAGGATACAAATAATAAGAATGG - Intronic
996408585 5:123130364-123130386 AAAGAGAGAAAAAAGGAGGAGGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997203860 5:132029872-132029894 AAGAAGAGAAAGAAGAAGGAAGG + Intergenic
997491616 5:134281931-134281953 AAGGAAACAAAGAAAAAGTATGG - Intergenic
997552411 5:134764890-134764912 AAAGAGAGAAAGAGTGAGGGAGG - Intronic
997952780 5:138255080-138255102 AAGAAGAGAAAGAGAGAGGAAGG + Intronic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
998297217 5:140982991-140983013 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
998756625 5:145388077-145388099 CAAGAGATAAAGGATGAGGATGG + Intergenic
998801497 5:145873999-145874021 AAGGAGACAAGGATGGAAGAAGG + Intergenic
998859597 5:146429296-146429318 AGGGAGAGAAAGAAAGAGGTTGG - Intergenic
998987527 5:147777131-147777153 CAGCAGACAAAGAATGACCAAGG + Intronic
998988418 5:147788356-147788378 AAGGAAAGAAAGGATGAAGAAGG + Intergenic
999559402 5:152784308-152784330 AAGCAGACAAAAAATTAGTAAGG + Intergenic
999652214 5:153778584-153778606 AAGGAGGGAAATTATGAGGAAGG + Intronic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000406238 5:160891366-160891388 AAGGTCAGAGAGAATGAGGAAGG - Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1000671186 5:164065175-164065197 AAGGAAATAAGGAATGAAGATGG - Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001731826 5:173965936-173965958 TAGGAAACAAAGAAAAAGGAGGG + Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002178036 5:177413437-177413459 AAGGAGACAAAAAATTAGCCGGG - Intronic
1002214177 5:177618103-177618125 AAGGAGGGAAAGAAAAAGGAAGG - Intergenic
1002590494 5:180288295-180288317 AAGAAAACAAAGAAATAGGAGGG + Intronic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1003852225 6:10236970-10236992 CAGGAGACAAAGGCTGGGGAAGG - Intergenic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004221866 6:13754107-13754129 AATGAAACAATGAATGAGGCCGG - Intergenic
1004485173 6:16059807-16059829 AAGTAAACAAAAAATGAGAAGGG + Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1004819535 6:19352285-19352307 AAGGAAAAAAAGAGTGGGGAAGG - Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005078876 6:21936763-21936785 AAGGAGACAAAAAATTAAGACGG + Intergenic
1005285005 6:24315867-24315889 AAGGAGACCAAAAAGGAGGCTGG + Intronic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1005693388 6:28328946-28328968 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1005719604 6:28588009-28588031 AAGGAAACAGAGAATGGAGAAGG - Intronic
1005845452 6:29773419-29773441 AAGGAGAGAAAGAAGGAGAGAGG - Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006236604 6:32638777-32638799 AAAGACAGAAAGAAAGAGGAAGG + Intronic
1006237163 6:32643718-32643740 AAGGTGACAAGGGAAGAGGAAGG - Intronic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006506781 6:34494243-34494265 CATGAAACAAAGAATGGGGATGG - Intronic
1006755261 6:36409934-36409956 AAGGAAAGAAAGAAAGAGAAAGG + Intronic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1007039379 6:38707603-38707625 GAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1007053441 6:38857003-38857025 AGGGAGACAGAAAATGAGAAGGG - Intronic
1007130303 6:39466233-39466255 AAGGAGAGAAGGAAGGAGGAAGG - Intronic
1007335530 6:41152442-41152464 AAAGTGTCAAGGAATGAGGAGGG + Intronic
1007397425 6:41585706-41585728 AAGGAGAGAAAGAATGAATGGGG - Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1007626751 6:43251039-43251061 AAGGAGACAGGGAAAGAGGAAGG - Intronic
1007630276 6:43269617-43269639 AAAGAGACCAAGAAAGTGGAGGG - Intronic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008151719 6:47960883-47960905 AAGTAGACAAAAAATCAGCAGGG + Intronic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008299674 6:49820138-49820160 AGGGAGACAAAGGAGGATGAAGG + Intergenic
1008333516 6:50271950-50271972 AGGAAGGCAAAGAAGGAGGAAGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008528947 6:52436526-52436548 AAGGAGAGAAAGTATTAGAATGG - Intronic
1008612551 6:53197641-53197663 AAGGAGGGAAGGAATGAGGGAGG + Intergenic
1008863177 6:56176602-56176624 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1008894062 6:56531826-56531848 TAGGAAACAAAGAAGGTGGAAGG - Intronic
1008916795 6:56796777-56796799 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1009032642 6:58078784-58078806 AGGCACACAAAGAATAAGGAAGG + Intergenic
1009208251 6:60830550-60830572 AGGCACACAAAGAATAAGGAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009671258 6:66753889-66753911 AAAGAGAGAGAGAATGAGGGAGG + Intergenic
1009856735 6:69274551-69274573 AAGGACACAAGGAAGGAAGAGGG - Intronic
1010052359 6:71521909-71521931 AAGGAGATAGAGATTGGGGATGG - Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1010341479 6:74758606-74758628 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011414281 6:87101354-87101376 AAGGAGGCAGAGAAAGGGGAGGG - Intergenic
1011601435 6:89064058-89064080 AAGGAAAGAAGGAAAGAGGAAGG - Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1011765351 6:90613829-90613851 CAGGAGACAAAGAAAGCAGAAGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1011949339 6:92944830-92944852 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012280545 6:97322710-97322732 AATGAGAGAATGAGTGAGGAAGG - Intergenic
1012787486 6:103650126-103650148 AAAAAGACAAAACATGAGGAGGG - Intergenic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013633083 6:112003774-112003796 AAGGAGAGAGAGAAAGAGAAGGG + Intergenic
1014344844 6:120255160-120255182 AAGAAGACACACAAAGAGGAGGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014625993 6:123726168-123726190 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1014913160 6:127117888-127117910 AGAAAGACAAAGAAAGAGGAAGG + Intergenic
1015065295 6:129019113-129019135 AAGTAAACCAAGAAAGAGGAAGG - Intronic
1015079666 6:129208678-129208700 AAGGAAAGAAAGAAAAAGGAAGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015208423 6:130668030-130668052 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1015551252 6:134414524-134414546 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015567424 6:134587965-134587987 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015810908 6:137161385-137161407 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1016384476 6:143516997-143517019 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1016547353 6:145239100-145239122 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1016647068 6:146422995-146423017 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
1016669886 6:146691916-146691938 AAGGAGACAAGGAAGGAAGGAGG - Intronic
1016922808 6:149313100-149313122 TAGGTGGCAAAGATTGAGGATGG - Intronic
1017041052 6:150308986-150309008 AAGGAAGGAAAGAAAGAGGAAGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017652069 6:156593119-156593141 AAAGAGAGAAAGAAGGAAGAGGG + Intergenic
1017805716 6:157943763-157943785 GAGGAGCCAAAGAATAAGAAAGG - Exonic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018516305 6:164583427-164583449 TAGAAGAGAAAGAATGAAGATGG - Intergenic
1018995830 6:168709880-168709902 AAGGACACAATGAAGGAGGGAGG - Intergenic
1019021979 6:168927078-168927100 AAGGCGACATAGCATTAGGAAGG + Intergenic
1019898156 7:3999198-3999220 AAGGAGAGAAAGAAGGTCGATGG - Intronic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020087155 7:5316702-5316724 AAGGACACAAAGAATGGGAAAGG + Intronic
1020179262 7:5908724-5908746 AAGGAGACAGACAATGAGGCTGG - Intronic
1020256306 7:6504540-6504562 AAGGAGAGAGGGAATGAGGCTGG + Intronic
1020303672 7:6816131-6816153 AAGGAGACAGACAATGAGGCTGG + Intronic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020515822 7:9117691-9117713 GAGGAGACAAAGGATAAGAAAGG + Intergenic
1020531239 7:9338539-9338561 AGGAAGACAAAGAGTGAGGAAGG + Intergenic
1020597572 7:10227922-10227944 AAGGATACAAAGCACAAGGAAGG + Intergenic
1020669477 7:11088939-11088961 AAGGGAACAAAAAATGAGCATGG + Intronic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1020868351 7:13594362-13594384 AAGTAGACAAAAAATCAGTAAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022054493 7:26716182-26716204 AAGGAGGCAAAAAATAAGTAAGG - Intronic
1022187204 7:27981906-27981928 AAGAAGTCAAAGAATAGGGATGG - Intronic
1022203527 7:28140434-28140456 AAGGTGTCAAAATATGAGGAAGG + Intronic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022479219 7:30732299-30732321 AAGGAAAGAAGGAAAGAGGAAGG - Intronic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023338291 7:39192909-39192931 AAGGAGAAAAGGATGGAGGAAGG + Intronic
1023459256 7:40377123-40377145 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1023697446 7:42862653-42862675 AATGAGACAAAAAATTAGCAAGG - Intergenic
1023747574 7:43335878-43335900 AAAGAGAGAAAGAAAGATGAAGG - Intronic
1023795178 7:43786475-43786497 AAGGAGACAGAAAATCAGGAAGG + Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024236254 7:47401450-47401472 AGAGATACAAAGAAGGAGGAAGG + Intronic
1024471087 7:49769447-49769469 AAGGAGGGAAAGAAGAAGGATGG - Intergenic
1024481097 7:49864254-49864276 AAGAAGACAAAGAAGGAGGGAGG + Intronic
1024803457 7:53108179-53108201 AGGGAAGCAAAGAATGAGGTGGG + Intergenic
1024937250 7:54722831-54722853 AAAGAGAGAAAGAAAGGGGAGGG - Intergenic
1024962008 7:54986637-54986659 AAGGACACAAAGAAATGGGATGG + Intergenic
1026002962 7:66577054-66577076 AAGGAGGGAATGAATGAGGAAGG + Intergenic
1026110546 7:67455695-67455717 GAGAAGAGAAAGAAAGAGGAAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026223187 7:68418176-68418198 AGGGAGAGAAAGAAAGAGAAAGG - Intergenic
1026250546 7:68666224-68666246 AAGGAGACAGAGAGAGAGGCAGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026536266 7:71241202-71241224 GAGGAGAGAAAGAGTGAGAAAGG - Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026632402 7:72048781-72048803 AAGGAAAAAAGGAAGGAGGAAGG - Intronic
1026638887 7:72107031-72107053 AAAGAAAGAAAGAAGGAGGAAGG + Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026809344 7:73449313-73449335 AAGAAGACAGAGAATGTGGCTGG + Intronic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1026967453 7:74449263-74449285 AAGGAAAGAAAGAAAGAAGAGGG - Intergenic
1027038977 7:74947433-74947455 AAAGAAAGAAAGAAAGAGGAGGG + Intergenic
1027046247 7:74993200-74993222 AAAGAGAAAAAGAAAAAGGAAGG + Intronic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027554380 7:79645104-79645126 AAAGAGACTAATAATGAGTATGG - Intergenic
1027646704 7:80810586-80810608 AAGTAGACAACGAAAGAGGGAGG - Intronic
1027769881 7:82393016-82393038 AAAGAGACAGAGAGAGAGGAAGG + Intronic
1027969901 7:85066239-85066261 AAGGAGAAAAAGAGAGAGAAAGG + Intronic
1028110796 7:86938833-86938855 AAGGAGCCAAAGAATGTATAAGG - Exonic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028262785 7:88685654-88685676 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1029181666 7:98706311-98706333 AAGGAGAAAAAGAAAAAGAAGGG - Intergenic
1029495062 7:100892146-100892168 AAGGAGACAGAGAAGGCAGAGGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030652605 7:112131783-112131805 AATGACACAAAAAAGGAGGAAGG + Intronic
1030671662 7:112344976-112344998 ATGGAGACAATGAATGATAATGG - Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031008033 7:116496934-116496956 AAGGAGCCAAAGAAAGGTGAGGG + Intronic
1031014250 7:116555637-116555659 GAGGAGAGAAAGAAAAAGGAAGG + Intronic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031051571 7:116950660-116950682 AAAGAGAGAAAGAGAGAGGAAGG - Intergenic
1031372469 7:120984836-120984858 TAGCAGACAATGAATGAGAAAGG - Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031787502 7:126052553-126052575 AAGGAGGCACAGAATGTGGTAGG + Intergenic
1031842517 7:126761414-126761436 AAGAAGTCAAAGATAGAGGAAGG - Intronic
1032016800 7:128385297-128385319 AAGAAGCCAAAGCAGGAGGATGG - Intergenic
1032478471 7:132228061-132228083 AGGGTGACAAAGAATGACAAAGG - Intronic
1032577733 7:133073294-133073316 AAGGGCACATAGAATGAGAAGGG - Intronic
1032675836 7:134129147-134129169 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1032819246 7:135509743-135509765 AAGAAGACCAAGGAGGAGGAGGG + Intronic
1033057730 7:138075085-138075107 AAGAAGACAAAGAATGTGTTGGG - Intronic
1033301319 7:140188696-140188718 AAGGAAAGAAAGAAAGGGGAAGG + Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1033619860 7:143052423-143052445 GAGAAGATAAAGCATGAGGAAGG - Exonic
1033997397 7:147368054-147368076 AGGGAGAGAAAGAGAGAGGAAGG - Intronic
1034059148 7:148069778-148069800 AAAGAAAGAAAGAATGGGGAGGG + Intronic
1034194066 7:149232536-149232558 AAAGAGAGAAAGAAAGAGAAAGG - Intergenic
1034312875 7:150105066-150105088 AAAGAAAAAAAGAATGAAGAAGG - Intergenic
1034549976 7:151814323-151814345 AAGGAGACAAAGCATCGTGAGGG + Intronic
1034951266 7:155298206-155298228 GAAGAGACAAAGAGCGAGGAAGG - Intronic
1035110779 7:156479854-156479876 AACAAGAAAAAGAAAGAGGAGGG + Intergenic
1035638615 8:1165159-1165181 AAGGAGACAGAGAGAGAGGGAGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1036297142 8:7546644-7546666 AAGGAACCAAAGAGTGTGGAAGG - Intergenic
1036612105 8:10359238-10359260 AAAGAGACAAATACTGAGGATGG - Intronic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1037047219 8:14322256-14322278 AGGGAGACAAACAATAATGAAGG + Intronic
1037094803 8:14972977-14972999 AGGCACACAAAGAAGGAGGAAGG - Intronic
1037222426 8:16540528-16540550 AAGGAGATAAAAAATGTAGAAGG + Intronic
1037377828 8:18250908-18250930 TTAGAAACAAAGAATGAGGATGG + Intergenic
1037418258 8:18674439-18674461 AAGGACCCAAAGAATGAGAGAGG - Intronic
1037460354 8:19102462-19102484 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1037659553 8:20915223-20915245 AAGGAGACACAGAGTAAGGCAGG + Intergenic
1037703362 8:21295417-21295439 AAGGAGAAAAATGATGAGTAGGG - Intergenic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1037918653 8:22788305-22788327 AGGGGGACAAAGAAGGAGCAGGG + Intronic
1038062313 8:23927043-23927065 AAAGAAACAAAGAAAGGGGAAGG - Intergenic
1038216549 8:25566981-25567003 AAGCAGAGAAAGAAAGACGAAGG - Intergenic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038420775 8:27432814-27432836 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1038701895 8:29856628-29856650 AAGGAGACAAAGAGTCTGCATGG + Intergenic
1038755416 8:30336100-30336122 AGAGAGACAAAGAAATAGGAAGG + Intergenic
1039260520 8:35766326-35766348 AGGGAGAGAAAGAGGGAGGAAGG - Intronic
1039625777 8:39050917-39050939 AAGGCTACAAAGAATGAAGGTGG - Intronic
1039673352 8:39629689-39629711 AAAGAGTGAAAGAAAGAGGAAGG - Intronic
1039727788 8:40238490-40238512 AGGGAGAGAAGGAATGAGGGAGG - Intergenic
1039791712 8:40881484-40881506 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040016233 8:42702462-42702484 AATGAGACAAAGATTAAGCAAGG + Intronic
1040126181 8:43740207-43740229 AGGGACACAAAGACTGCGGAAGG - Intergenic
1040413323 8:47176701-47176723 AAGGACACAAACACTGCGGAAGG - Intergenic
1040543787 8:48381412-48381434 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1040822429 8:51577984-51578006 AAAGAAAGAAAGAAAGAGGAAGG + Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041192800 8:55370284-55370306 AAGGTGACAAAGGCTGAGAATGG + Intronic
1041296853 8:56365647-56365669 AAGGAGAAAAACAATAATGAAGG + Intergenic
1041970764 8:63739658-63739680 AAAGAAAGAAAGAATGAGTAGGG + Intergenic
1042098056 8:65240717-65240739 AAGGAGACCACAAAAGAGGAAGG + Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1042548537 8:69972555-69972577 AAGGAGTCAATGAAAGAGGCAGG + Intergenic
1042786530 8:72552891-72552913 AAGGAGAGAAACAAAGAAGAGGG - Intronic
1042885905 8:73551254-73551276 AAGGAAACAAAGAATAAATAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1045155774 8:99468932-99468954 AAGAAAAGAAAGGATGAGGATGG - Intronic
1045230584 8:100302717-100302739 AAGGAGACAGAAAAGGTGGAAGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045487163 8:102640564-102640586 AGGGAGAGAAGGAAAGAGGAAGG + Intergenic
1045666202 8:104488051-104488073 AAGGAAACAAAAAAAGATGAAGG + Intergenic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045773227 8:105770011-105770033 AAGGAAACAAAAAATGAAGGTGG - Intronic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046200910 8:110926599-110926621 AAAGAGAGAAAGAAAGAGAAAGG + Intergenic
1046230151 8:111345387-111345409 AGGGAGACAAAGAGTGGGGAGGG + Intergenic
1046504090 8:115114901-115114923 AAGAAGAGAAAGAAGGAGAATGG - Intergenic
1046588398 8:116175968-116175990 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046588403 8:116176025-116176047 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1046588427 8:116176161-116176183 AAGGAAAGAAAGAAAAAGGAAGG + Intergenic
1046608494 8:116397018-116397040 AAAGACAGAAAGAATAAGGAAGG + Intergenic
1046784052 8:118246981-118247003 AAGGAGACAAAGTTTTAGGCAGG + Intronic
1046906586 8:119580375-119580397 AAGGAAACAGAGATTGAAGAAGG - Intronic
1046922068 8:119741433-119741455 AAGAATACAAAAAATCAGGAAGG + Intronic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047365327 8:124206030-124206052 AAGCAGACAAAGAACGTGGAAGG + Intergenic
1047366478 8:124216279-124216301 AAAGAGGCAAAGGAAGAGGAGGG - Intergenic
1047388873 8:124433548-124433570 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1047518689 8:125577790-125577812 AAGAAGAGAAAGGAGGAGGAAGG - Intergenic
1047776502 8:128075547-128075569 GAGGAGACAAGGATTGAAGATGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048115059 8:131511700-131511722 ATGAAGACAAAGAAAGAGAAAGG + Intergenic
1048146620 8:131851244-131851266 AAGGAGAGAAAGCATCAGGGGGG - Intergenic
1048161875 8:132028840-132028862 AAGGAAAGAAGGAAAGAGGAAGG + Intronic
1048161884 8:132028895-132028917 AAGGAAAGAAGGAAAGAGGAAGG + Intronic
1048250961 8:132866592-132866614 AAGGAAAGAAGGAAGGAGGAAGG + Intergenic
1048736992 8:137513050-137513072 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1048828364 8:138451954-138451976 AAGGTGAAAAAGAATGAAGGAGG - Intronic
1050708971 9:8438042-8438064 AAGCAGGAAAAGAATGAGGGAGG + Intronic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1051216444 9:14803155-14803177 AAAGAGAGAAAGAAAGATGAAGG - Intronic
1051231056 9:14956139-14956161 AATGAAACAAAGAAAGAGAATGG + Intergenic
1051258362 9:15236120-15236142 AAGAAGACATAAAATGAGAATGG + Intronic
1051783380 9:20714695-20714717 AAAGAGAGAAAGAGAGAGGAAGG - Intronic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1052066214 9:24023783-24023805 AAAGCTACAAAGAATGAAGAAGG - Intergenic
1052479924 9:29010491-29010513 AAGCAGACAAAGAATGATAGAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1052910890 9:33880629-33880651 AAGGAGACAAAAACTCAGTAAGG - Intronic
1052972430 9:34385226-34385248 AAGTTGACATAGAATCAGGATGG + Intronic
1053512221 9:38697435-38697457 AAGGAGAAAAAGAAGGAGTTAGG - Intergenic
1053789918 9:41679661-41679683 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1053817456 9:41927528-41927550 AAGGAGAGAAAGAGGGAGGGAGG + Intronic
1054178257 9:61891350-61891372 AAGGAGCCACAGGATGAGGTGGG + Intergenic
1054475012 9:65566204-65566226 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054659272 9:67689474-67689496 AAGGAGCCACAGGATGAGGTGGG - Intergenic
1054706313 9:68466030-68466052 CAAGAGACAAAGAATGGGGAAGG - Intronic
1054829690 9:69609757-69609779 AAGGAGACCAAGAATCTGAAAGG - Intronic
1054913049 9:70471615-70471637 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1054925215 9:70581907-70581929 AAGGAGGGAAGGAATGAAGAAGG - Intronic
1054998435 9:71420668-71420690 AAAGAGAGAAAGAAAGAGAAAGG + Intronic
1055099246 9:72446284-72446306 AAGGAGAGAAAGAAGTAGGGAGG - Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055730271 9:79273801-79273823 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
1055800598 9:80032030-80032052 TAGGAGACAGAGAATGAGAGGGG + Intergenic
1055957894 9:81791506-81791528 AAAGAAAGAAAGAAAGAGGAAGG - Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1056598729 9:88029331-88029353 AAGAAGAAAAATAATGAGTAAGG + Intergenic
1056691310 9:88810921-88810943 AAGGAGAGAAAGCCTGAGGGTGG - Intergenic
1056948997 9:91026887-91026909 GAGGAGCCAAAGAAGGAGGTGGG - Intergenic
1057048001 9:91900507-91900529 CAGGAAACAAGAAATGAGGAAGG + Intronic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057077642 9:92147287-92147309 AGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057470686 9:95353598-95353620 AAGGAGAGAAAGAGGAAGGAAGG - Intergenic
1057501943 9:95603090-95603112 AAGGAGAGAAGGAAGGAGGGTGG - Intergenic
1058144973 9:101400433-101400455 ATTGAGACAAAGGATGGGGAAGG - Intronic
1058345008 9:103950821-103950843 AAGGAGGGAAAGAAGGAAGAAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058935808 9:109768140-109768162 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1059072416 9:111152796-111152818 AAGGAGGCAGAGGAGGAGGAAGG + Intergenic
1059352927 9:113678373-113678395 AAGGAGAGAAAGAGAAAGGAAGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1059747527 9:117217478-117217500 AAGGATACAAGGAAGGAAGAAGG - Intronic
1059884562 9:118731282-118731304 AAGGATACAAGGAAAGATGAAGG - Intergenic
1060046247 9:120343599-120343621 AAGGAGCCAAGGAATGCAGATGG - Intergenic
1060199160 9:121641818-121641840 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060493543 9:124101795-124101817 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061335572 9:129932271-129932293 AAAGAGAGAAAGAAAAAGGAAGG + Intronic
1061400132 9:130363971-130363993 AAGGAAAGAAAGAAAGAGAAAGG + Intronic
1061456638 9:130703026-130703048 AAGGAGACACAGAGAGGGGAAGG - Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062682684 9:137790522-137790544 AAGCAGACAAAGAAGGGGGAGGG - Intronic
1203694738 Un_GL000214v1:87531-87553 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203704812 Un_KI270742v1:29901-29923 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203559192 Un_KI270744v1:35910-35932 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203634297 Un_KI270750v1:96740-96762 AAGGACACAAACACTGCGGAAGG - Intergenic
1203641535 Un_KI270751v1:16532-16554 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203661607 Un_KI270753v1:49246-49268 AGGGAGGCAAAAAAAGAGGAAGG + Intergenic
1203672792 Un_KI270755v1:32322-32344 AGGGAGGCAAAAAAAGAGGAAGG + Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185534416 X:849484-849506 AAGGAAACAAAGAAAGAGGAAGG - Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185674070 X:1834542-1834564 AAAGAAAGAAAGAAAGAGGAAGG + Intergenic
1185688699 X:2134929-2134951 AAAGAAAGAAAGAAAGAGGAGGG + Intergenic
1185726562 X:2426530-2426552 AAGGAAAGAAGGAAGGAGGAAGG - Intronic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1186020138 X:5245529-5245551 AGAGAGACAAAGAAGAAGGAAGG - Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1186226605 X:7405625-7405647 ACAGAGACAAAGAAGGAGGGAGG + Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186327855 X:8499055-8499077 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic
1186644334 X:11490296-11490318 CAGGAGGCAAGGAATGAGGGTGG + Intronic
1186809168 X:13170258-13170280 AAGGAAAGAAAGAATGGGCATGG - Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187177926 X:16913544-16913566 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187695324 X:21913586-21913608 AAAGAAAGAAAGAAAGAGGAGGG + Intergenic
1187696143 X:21923037-21923059 AAGGAGAGAAAGAGAGAGAAAGG + Intergenic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1187829380 X:23365494-23365516 GGGGAGAGAAAGAAAGAGGAAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188416880 X:29945967-29945989 AGGATGACAAAGAATGAGTATGG - Intronic
1188430152 X:30097291-30097313 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1188450196 X:30301069-30301091 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1188542700 X:31267120-31267142 AAAGAAAGAAAGAAAGAGGATGG + Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188896277 X:35672278-35672300 AAGAAGATAAAGAAGAAGGAAGG - Intergenic
1188942771 X:36261474-36261496 AGGGACACAAACACTGAGGAAGG - Intronic
1189510999 X:41661331-41661353 AAGGAGACAGAGACAGAGTAGGG + Intronic
1189712798 X:43831568-43831590 AAGGAAACAAAAAACAAGGAAGG + Intronic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190123401 X:47682646-47682668 AAGGAAAGAAAGAAGGAGGAAGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190313503 X:49134158-49134180 AAAGAAACAAAGAGAGAGGAAGG - Intergenic
1190452908 X:50598553-50598575 GAGAAGACAAAGGATGAGAATGG + Intronic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1191794197 X:65002904-65002926 AAGGACACAAACACTGCGGAAGG + Intronic
1192130374 X:68544028-68544050 AAGGAAACTAATAATGAAGATGG - Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192317862 X:70066326-70066348 TAGGAGCCAAAGGATGAGAAAGG + Intergenic
1192482351 X:71496594-71496616 AAGGAGTCAAAGAGAGAGGCAGG - Intronic
1193132116 X:77931161-77931183 AGGGACACAAACACTGAGGAAGG - Intronic
1193221403 X:78930611-78930633 GAGGAGAGAGAAAATGAGGAGGG - Intergenic
1193428368 X:81368949-81368971 AAGGTGAGTAAGAGTGAGGAAGG - Intergenic
1193856518 X:86610358-86610380 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1193997078 X:88379410-88379432 AAGGAAAGAAAGAAAGAAGAAGG + Intergenic
1194721628 X:97346988-97347010 AAGGAAACAGAGAAGGAAGAAGG - Intronic
1194975168 X:100387727-100387749 AAGGACAAAAAGAATGAAAAAGG + Intronic
1195335525 X:103849500-103849522 AAAGAAAGAAAGAATGAGTATGG - Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195496743 X:105544758-105544780 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1195593601 X:106661544-106661566 AAGGAGAGAAGTAATGAAGAAGG + Intronic
1195658799 X:107358717-107358739 AAGGAGGGAAGGAGTGAGGAAGG + Intergenic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1195712711 X:107786982-107787004 AGGGAGAGAAGGAAGGAGGAAGG + Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196213598 X:113024187-113024209 AAAGAGACAAAGAATAAGAAAGG + Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197176441 X:123491155-123491177 GAGGAGACAAAGAATGGGAATGG - Intergenic
1197251426 X:124219843-124219865 AAAGAAAGAAAGAAAGAGGAAGG - Intronic
1197398868 X:125964043-125964065 AAAGAAACAAAGAAAGAGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198158860 X:133987314-133987336 AGGGAGACAAAGAGAGAGGAAGG + Intergenic
1198173950 X:134136082-134136104 CAGGAGAGAAAGAGTGAGGGGGG - Intergenic
1198459935 X:136853534-136853556 AGGAAGGCAAAGAATGAGGGTGG - Intronic
1198518777 X:137432011-137432033 AAAGAAAGAAAGAAAGAGGAGGG + Intergenic
1198529889 X:137541981-137542003 AAGGAGACTAAGAAACAGCATGG - Intergenic
1198626089 X:138576661-138576683 ATATAGACAAAGAATGATGAGGG - Intergenic
1198723367 X:139648991-139649013 AAGTAGACAAAGAATTTGCAAGG + Intronic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1198973377 X:142306231-142306253 AAGCACACAAAAATTGAGGAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199555057 X:149098138-149098160 AAGGAGAGAAGGAAGGAGGAAGG + Intergenic
1199595789 X:149504963-149504985 AAGGAAAGAAGGAAGGAGGAAGG + Intronic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1201058045 Y:10015478-10015500 AAAGAGAGAAAAAAAGAGGAAGG + Intergenic
1201292037 Y:12429902-12429924 AAGGAGGGAAGGAAGGAGGAAGG - Intergenic
1201295977 Y:12463544-12463566 AAGGACACAAACACTGCGGAAGG - Intergenic
1201348694 Y:13014839-13014861 GAGCAGACCAAAAATGAGGAAGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201483688 Y:14469295-14469317 AAGAAGACAAGGCATGATGAGGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201608303 Y:15811923-15811945 AAGGAAAGAAAGAAAGAGAAAGG + Intergenic