ID: 961415415

View in Genome Browser
Species Human (GRCh38)
Location 3:126753162-126753184
Sequence ACACGATTTTGGCAGCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961415415 Original CRISPR ACACGATTTTGGCAGCCAAG GGG Intronic
909085962 1:71170551-71170573 ACAAGGTTTTAGCATCCAAGTGG - Intergenic
910960459 1:92756787-92756809 ACACTAGTTTGGAAGCCAGGAGG - Intronic
912991853 1:114495201-114495223 ACTCTATTTTGGCAGGCATGGGG - Intronic
913253952 1:116937565-116937587 ATATGATTTTGGCAGCCCTGTGG + Intronic
915119614 1:153620936-153620958 CAAGGATTTTGGCATCCAAGGGG + Intronic
915279055 1:154810060-154810082 ACATGATTATGGCAGGGAAGTGG + Intronic
916422442 1:164649577-164649599 ACACAATCTAGGAAGCCAAGTGG - Intronic
921710339 1:218367245-218367267 ACACGATTCAGGCCACCAAGAGG - Intronic
1067844478 10:49709037-49709059 AGATGATTTTAGCAGCCATGTGG - Exonic
1071976171 10:90957522-90957544 ACATGATTCTGGGAACCAAGAGG - Intergenic
1077094530 11:793691-793713 ACAGGGTTTTGCCAGCCAGGAGG - Intronic
1077644473 11:3911183-3911205 AGAAGATTCTGGCAGCCAACTGG - Intronic
1078833688 11:15003730-15003752 AAACCATTTTGGCATCCCAGAGG - Intronic
1083316021 11:61815563-61815585 ACGCCATTCTGGCCGCCAAGGGG + Intronic
1083404497 11:62447231-62447253 ACAGGATTCTTCCAGCCAAGGGG - Intronic
1090267059 11:125359780-125359802 ACAAGGTTTTGGCAGCCTAAGGG + Intronic
1099076656 12:78118101-78118123 AGAAGATTTTGACAGCCATGGGG + Exonic
1101804913 12:108055299-108055321 ATAGGATTTTTGCAGCCAACAGG - Intergenic
1105300735 13:19132488-19132510 ACAAGAGTCTGGCAGCCATGAGG + Intergenic
1106507335 13:30382712-30382734 ACATGATTTTGGGAGGGAAGTGG + Intergenic
1111511926 13:89277876-89277898 ACAATATTTAGGAAGCCAAGTGG + Intergenic
1117067720 14:52027068-52027090 TCACTATTTTGGCAGCCACAAGG + Intronic
1117741962 14:58827958-58827980 ACATGATTGTGGTGGCCAAGTGG - Intergenic
1119654077 14:76404424-76404446 ACACCATTTTGGCAGGGAAAAGG - Intronic
1126022187 15:44412468-44412490 ACCCCATTTAGGAAGCCAAGAGG + Intronic
1128206846 15:65860273-65860295 CCACAATGTTGGCAGCCAGGAGG + Intronic
1135886891 16:26318335-26318357 TCAGGAATTTGGCAACCAAGAGG + Intergenic
1140936866 16:79679922-79679944 ACAGTATTTTGGCAACCAAGAGG - Intergenic
1144865893 17:18335488-18335510 ACACGATTTTGGAGGACAGGTGG + Intronic
1148965682 17:51433660-51433682 ACATGAATTTGGCATCCAGGAGG + Intergenic
1151075973 17:71272998-71273020 TCACTGTTTTGGAAGCCAAGTGG - Intergenic
1155813002 18:30261767-30261789 AAATGGTTTTGGAAGCCAAGGGG - Intergenic
1159489618 18:69114613-69114635 AGAAGTTTTTGGTAGCCAAGAGG + Intergenic
1163193748 19:15699013-15699035 ACACTATTTTGTCTTCCAAGTGG + Intergenic
1168565297 19:57417328-57417350 GCATGATTTTGGCAGCCTTGGGG + Intronic
928809407 2:35204280-35204302 ACAGAATTTTGAAAGCCAAGCGG + Intergenic
929534465 2:42771851-42771873 ATAGGATTTAGGCTGCCAAGTGG - Intronic
932445574 2:71779035-71779057 ACAGGATTTTGGCAGACACACGG - Intergenic
933711388 2:85328317-85328339 ACACGATGGTGGTGGCCAAGAGG - Intronic
938517637 2:132031330-132031352 AGCCGATTTTGGCATGCAAGGGG + Intergenic
938982563 2:136540385-136540407 ACATGTTTATGGAAGCCAAGAGG + Intergenic
941814035 2:169782849-169782871 ACACAATTTTGGCAGCAAATTGG - Intergenic
944512483 2:200478090-200478112 ACACTCTTTTGGCAGCGAATTGG - Exonic
1173839255 20:46146461-46146483 ACAGGATTTTGCCTGCCCAGAGG + Intergenic
1174587068 20:51617695-51617717 ACAGGATCTTGGTAGTCAAGGGG - Intronic
1175253183 20:57622053-57622075 CCCAGCTTTTGGCAGCCAAGGGG + Intergenic
1179076041 21:38122568-38122590 ACAGGAATTTGGCTGCCAACAGG + Intronic
1184194539 22:42918028-42918050 CCACGATTCTGCCAGGCAAGTGG - Intronic
1184234385 22:43175174-43175196 ACCAGGTTTGGGCAGCCAAGGGG + Intronic
1184740894 22:46428566-46428588 ACCCGGTTTTGACAACCAAGAGG - Intronic
1184750088 22:46480610-46480632 ACAGGATGTTGGCAACGAAGAGG + Intronic
953242897 3:41165552-41165574 ACAGGATTCTGGAATCCAAGTGG + Intergenic
953447333 3:42979467-42979489 ACACGTTCTCTGCAGCCAAGTGG - Intronic
961415415 3:126753162-126753184 ACACGATTTTGGCAGCCAAGGGG + Intronic
963270109 3:143278023-143278045 ACTCCATTTTGGGAGCCAAGCGG - Intronic
974095819 4:57362611-57362633 ACACCATTTTGGCCCCCAAAAGG - Intergenic
975016832 4:69431937-69431959 ACAAGATTTGACCAGCCAAGAGG - Intergenic
975055166 4:69921312-69921334 AAAAGATTTTGGCAGCCATATGG - Intergenic
977784107 4:101013005-101013027 AAACCATTTTGGCAGTGAAGTGG - Intergenic
982247412 4:153367032-153367054 ACCCAACTCTGGCAGCCAAGGGG - Intronic
984016905 4:174437584-174437606 AAAAGATTTTGGCAGCAAATAGG + Intergenic
985879427 5:2627433-2627455 ACATGATTTTCACAGCCAGGAGG + Intergenic
987049747 5:14139480-14139502 CCACCATTTTGGCAGCAGAGAGG + Intergenic
987715384 5:21562333-21562355 ACTCGCTTTTAGCAGCAAAGCGG + Intergenic
992564981 5:77987523-77987545 ACAGAGCTTTGGCAGCCAAGAGG - Intergenic
997811771 5:136977623-136977645 ACAGGATTGCTGCAGCCAAGGGG + Exonic
1006798942 6:36747266-36747288 AGACTATATTGGCAGCGAAGAGG - Intronic
1008516392 6:52323334-52323356 ACACGGTTTTGAGAACCAAGCGG - Intergenic
1010823253 6:80441360-80441382 TCCAGAGTTTGGCAGCCAAGAGG - Intergenic
1010835289 6:80579578-80579600 ACTTAATTTTGGCAGCCATGTGG + Intergenic
1014887088 6:126795038-126795060 ACACCAATTAGACAGCCAAGTGG - Intergenic
1018504226 6:164446377-164446399 ATATGATTTTGGAGGCCAAGAGG - Intergenic
1025482443 7:60999197-60999219 AGACAATTTTGGCATGCAAGGGG - Intergenic
1029573720 7:101388974-101388996 ACAGGATTTTGGCCGCCATGGGG + Intronic
1030601118 7:111593918-111593940 ATACAATTTTGGCAGACAAATGG - Intergenic
1034179867 7:149128591-149128613 ACAAGATTTTGTCAGCACAGTGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1050109582 9:2200608-2200630 AGACCTTTGTGGCAGCCAAGAGG - Intergenic
1059886140 9:118746734-118746756 ACACAATTTAGGCAGTCATGGGG + Intergenic
1195719213 X:107849919-107849941 ACAGGAGGTTGGCAGCCAGGGGG - Intronic
1196140139 X:112252621-112252643 AGACGATTTGGGCAGCAATGGGG - Intergenic
1198176591 X:134162269-134162291 ACAAATTTTTGGCAACCAAGAGG + Intergenic