ID: 961415665

View in Genome Browser
Species Human (GRCh38)
Location 3:126754833-126754855
Sequence TTGGTGCTTTGGCCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 508}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961415658_961415665 3 Left 961415658 3:126754807-126754829 CCCTGGAGATGAAATGGTAGGCA 0: 1
1: 0
2: 3
3: 20
4: 164
Right 961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG 0: 1
1: 0
2: 1
3: 56
4: 508
961415652_961415665 30 Left 961415652 3:126754780-126754802 CCTTTTCTAGCAGGACCTGTTTA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG 0: 1
1: 0
2: 1
3: 56
4: 508
961415655_961415665 15 Left 961415655 3:126754795-126754817 CCTGTTTAGGAGCCCTGGAGATG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG 0: 1
1: 0
2: 1
3: 56
4: 508
961415659_961415665 2 Left 961415659 3:126754808-126754830 CCTGGAGATGAAATGGTAGGCAC 0: 1
1: 0
2: 0
3: 12
4: 107
Right 961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG 0: 1
1: 0
2: 1
3: 56
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961415665 Original CRISPR TTGGTGCTTTGGCCTTTGGG AGG Intronic
900354264 1:2252472-2252494 ATGGTGTTTTGGCCTGTGGAAGG + Intronic
900850879 1:5142124-5142146 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
900945207 1:5827414-5827436 TTGGTGCTGGGGAGTTTGGGTGG - Intergenic
901317833 1:8320940-8320962 GTGGGGCTGTGACCTTTGGGCGG + Intronic
902080862 1:13819879-13819901 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
902115478 1:14117545-14117567 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
904611511 1:31728422-31728444 TTGGTGCTATGGGCTTGGGCAGG + Intronic
906308444 1:44736370-44736392 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
907368478 1:53981766-53981788 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
907867741 1:58415046-58415068 CTGGTGATGGGGCCTTTGGGAGG + Intronic
908065215 1:60396066-60396088 TGGGTGCCTAGGCCTTTGGCTGG - Intergenic
908280577 1:62530696-62530718 TTGGTGCTTTGCCCGTGAGGTGG + Intronic
908564702 1:65342312-65342334 TTGGAGGTAGGGCCTTTGGGAGG + Intronic
908804288 1:67914132-67914154 TTGGAGATGTGGCATTTGGGAGG + Intergenic
909066790 1:70944893-70944915 CTTATGATTTGGCCTTTGGGAGG - Intronic
909209844 1:72808989-72809011 TTGGGGCTATGGCCATTGGAGGG + Intergenic
909351130 1:74654665-74654687 TTGGAGATGAGGCCTTTGGGAGG - Intronic
909523666 1:76598208-76598230 TTGGAGCTGGGCCCTTTGGGAGG - Intronic
910140052 1:84017099-84017121 CTGGTCCTATGTCCTTTGGGGGG - Intergenic
910258045 1:85268996-85269018 TAGGAGCTGAGGCCTTTGGGAGG + Intronic
911332314 1:96539734-96539756 TAGGTTCTTTGACCTTTGGATGG - Intergenic
911517600 1:98886504-98886526 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
911765713 1:101672255-101672277 TTGGAGGTGTGGCCTTTGGGAGG + Intergenic
911812820 1:102305496-102305518 TTGGAGCTTGAGCTTTTGGGTGG - Intergenic
911979042 1:104542852-104542874 TTGTTTCTTTGGCTTGTGGGTGG - Intergenic
912131554 1:106608410-106608432 TTGGAGCTGGGGTCTTTGGGAGG - Intergenic
912151557 1:106864862-106864884 TTGGAGATTGGGCCTTTGGGAGG + Intergenic
913083203 1:115409316-115409338 TTGGTGTTCTGGCCCTGGGGAGG + Intergenic
913662751 1:121019346-121019368 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
913967682 1:143390814-143390836 TTGGAGGTGTGGTCTTTGGGAGG + Intergenic
914014134 1:143802608-143802630 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
914163687 1:145158588-145158610 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
914652754 1:149711166-149711188 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
915767703 1:158382287-158382309 TAGGAGCTGGGGCCTTTGGGAGG - Intergenic
916182221 1:162095222-162095244 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
917272340 1:173291339-173291361 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
917645042 1:177021653-177021675 TTGGTGCTTTAGGCTTGGAGGGG - Intronic
917989867 1:180363577-180363599 GTGGTGGTTTGGTCCTTGGGAGG + Intronic
918129370 1:181611988-181612010 TTGGTGCATTGGCCTTCAGATGG - Intronic
919792935 1:201304039-201304061 TGGGTGCTATGCCCTGTGGGAGG + Intronic
920586460 1:207167828-207167850 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
920659250 1:207901465-207901487 TTAGTGCTTAAGCCTGTGGGTGG + Intronic
920798257 1:209161411-209161433 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
920988432 1:210912729-210912751 TTAATGCTTTGACCTTTGGCAGG - Intronic
921655801 1:217735441-217735463 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
921809166 1:219492170-219492192 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
922814077 1:228436893-228436915 TTGGTGTTTGTGCCTGTGGGCGG + Intergenic
922885731 1:229019108-229019130 TTGGAGTTGGGGCCTTTGGGAGG - Intergenic
923336173 1:232972252-232972274 TTGTTGCTTTGGGGTTTGTGTGG + Intronic
924192401 1:241567466-241567488 TTGGAGATGGGGCCTTTGGGTGG - Intronic
924464354 1:244286495-244286517 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
924841952 1:247720821-247720843 CTGGTGCTTAGGCCTTTTGGTGG - Intergenic
1063398676 10:5719089-5719111 TTGGTGGTTTGGCCTTTGGTGGG + Intronic
1063813193 10:9738437-9738459 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1064524094 10:16235002-16235024 TTGAGGCTTTGCCCATTGGGAGG - Intergenic
1064874537 10:19977840-19977862 TTGGAGGTGTGGCCTTTGGGAGG - Intronic
1065494222 10:26312386-26312408 TTGGAGCTGGAGCCTTTGGGAGG + Intergenic
1065677390 10:28192508-28192530 TTGGTGCTATGGCTTTGGAGTGG - Intronic
1068448222 10:57151393-57151415 TTGGTTCTTTTGGCTTAGGGTGG - Intergenic
1069010864 10:63369975-63369997 GTGTAGCTTTGGCCTCTGGGAGG - Intronic
1069577034 10:69538125-69538147 TTGGTGATGGGGCCTTTGGAAGG - Intergenic
1070921003 10:80186404-80186426 TTGGTGCTTTCTCTATTGGGAGG - Intronic
1071158221 10:82715994-82716016 TTGGAGGTGTGGCCTTTGGAAGG - Intronic
1072412473 10:95216303-95216325 TTGGAGATGAGGCCTTTGGGAGG - Intronic
1073329005 10:102658775-102658797 TTGGGGCTTTGGCCTTGGGAGGG + Intergenic
1073682568 10:105719991-105720013 TTGGGGGTGGGGCCTTTGGGAGG - Intergenic
1073684250 10:105735246-105735268 TTGGAGCTGAGGCCTTTGAGAGG - Intergenic
1074972278 10:118548870-118548892 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1075063025 10:119269924-119269946 CTGGGGTGTTGGCCTTTGGGAGG + Intronic
1075488802 10:122848529-122848551 TCTGGGCTTTGGCCTTTGGCTGG + Intronic
1075569266 10:123527525-123527547 TTGGTTCTTTTGCCTTGGGTGGG - Intergenic
1076602753 10:131669635-131669657 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
1079358755 11:19752907-19752929 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1079776666 11:24540331-24540353 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1080940988 11:36917590-36917612 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1081610717 11:44561606-44561628 TTGGGGGTAGGGCCTTTGGGAGG + Intergenic
1081722657 11:45301711-45301733 TTAGTACTTTGGCCTATGGAGGG + Intergenic
1081743238 11:45455493-45455515 TTGCTGCTATGGGATTTGGGTGG - Intergenic
1084075176 11:66769632-66769654 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1084696901 11:70761183-70761205 CTGGTGATGGGGCCTTTGGGAGG + Intronic
1084721000 11:70905550-70905572 TAGGAGCTGGGGCCTTTGGGAGG + Intronic
1084744777 11:71162408-71162430 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1086018155 11:82192348-82192370 TTGGTGCTCAGGCTTATGGGGGG + Intergenic
1086380357 11:86245608-86245630 GGAGTGTTTTGGCCTTTGGGGGG + Intronic
1087462971 11:98468540-98468562 TTGGAGCTTGGGCCTTTGAGAGG + Intergenic
1088009612 11:104984179-104984201 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1089590727 11:119538936-119538958 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1090962749 11:131571858-131571880 TTGGTAATATGGGCTTTGGGAGG + Intronic
1091612977 12:2027176-2027198 CAAGTGCTTTGCCCTTTGGGTGG + Intronic
1092669074 12:10841987-10842009 TTGGAGGTTAGGCCTTTGGGAGG + Intronic
1093220649 12:16416631-16416653 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1093747784 12:22762709-22762731 TAGGAGCTGTGGCCTTTGTGAGG + Intergenic
1093763551 12:22937392-22937414 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1094031079 12:26011591-26011613 TAGGAGCTGTGACCTTTGGGTGG + Intronic
1094101770 12:26771819-26771841 TTTGTTTTTTGGGCTTTGGGGGG + Intronic
1094299881 12:28951338-28951360 TTGGTGCAGTGGCTTTTGGAGGG + Intergenic
1094836912 12:34326350-34326372 AAGGTGCTTTCGTCTTTGGGGGG + Intergenic
1095421855 12:42032236-42032258 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1096406151 12:51345865-51345887 TGGGTGCTGTGTCCTTTGTGGGG + Exonic
1097601350 12:61696286-61696308 TTGGTTTATTGGCCTCTGGGTGG - Intergenic
1097803875 12:63944465-63944487 TTGGAGGTTGGGCCTTTGGTAGG - Intronic
1098012579 12:66070771-66070793 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1098215499 12:68212345-68212367 GTATTGCTTTGGCTTTTGGGGGG + Intronic
1099476530 12:83114179-83114201 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1099741891 12:86648406-86648428 TTGGTGATGGGGCCTTTGGGAGG + Intronic
1100121699 12:91375934-91375956 TTGTAGCTGGGGCCTTTGGGAGG - Intergenic
1100767571 12:97884694-97884716 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1100802022 12:98241927-98241949 TAGGAGGTTGGGCCTTTGGGAGG + Intergenic
1101121489 12:101585028-101585050 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1101813239 12:108126003-108126025 TAGGAGCTGGGGCCTTTGGGGGG + Intergenic
1102108037 12:110342606-110342628 GTGGTGCTTTGGCCCTCGGGAGG + Intronic
1102761624 12:115390929-115390951 TTGGTGCTTGGGTCTATGTGTGG - Intergenic
1103731980 12:123033755-123033777 TTGGAGATGGGGCCTTTGGGTGG + Intronic
1104101478 12:125616779-125616801 TTGGAGATGTGGCCTTTGGGAGG + Intronic
1104195024 12:126528387-126528409 TAGGAGCTGTGGCTTTTGGGGGG + Intergenic
1106751043 13:32768394-32768416 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1106764629 13:32901665-32901687 TTGGAGATTGGGCCTTTGGGAGG - Intergenic
1107363697 13:39647235-39647257 TAGGAGGCTTGGCCTTTGGGAGG + Intergenic
1107681503 13:42856566-42856588 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1107748867 13:43542990-43543012 TAGGTGGTAGGGCCTTTGGGAGG - Intronic
1108254158 13:48594552-48594574 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1108350809 13:49589226-49589248 TTGCTTCTTTGTCCTTTGGCAGG + Intergenic
1108548428 13:51519583-51519605 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1108827965 13:54438975-54438997 TTGGAGGTTGGGCCTTTGAGAGG + Intergenic
1109271756 13:60263560-60263582 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1110260543 13:73479978-73480000 TTGCTGCTCTGGTCTTGGGGTGG + Intergenic
1110484659 13:76024150-76024172 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
1110983812 13:81938368-81938390 TTTGTACATTGCCCTTTGGGTGG + Intergenic
1111609343 13:90583293-90583315 TTGGCGATGGGGCCTTTGGGAGG + Intergenic
1111798602 13:92955656-92955678 TTAGTGCTTTGGCCTTGTGTAGG + Intergenic
1112652029 13:101409927-101409949 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1113462882 13:110493951-110493973 TTGGAGCAGGGGCCTTTGGGAGG - Intronic
1117143490 14:52812991-52813013 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
1118442780 14:65827316-65827338 TAGGGGCTTGGGGCTTTGGGGGG - Intergenic
1118928064 14:70212209-70212231 TTGGAGGTATGGCCTTTAGGGGG + Intergenic
1119358952 14:74031746-74031768 TTGGAGGTGTGACCTTTGGGAGG - Intronic
1119724145 14:76911881-76911903 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1120425012 14:84336587-84336609 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1120674361 14:87403745-87403767 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1120994404 14:90405712-90405734 TTGGTGCTGGGGCCTTGGGAGGG - Exonic
1121300187 14:92863962-92863984 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1125739492 15:41952213-41952235 GAGGCGCTTCGGCCTTTGGGAGG + Intronic
1125773365 15:42188065-42188087 CTGGTGCTGTGGTCTTTGGCTGG - Intronic
1126309729 15:47301798-47301820 ATACTGATTTGGCCTTTGGGTGG + Intronic
1126343351 15:47667744-47667766 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1126403815 15:48302297-48302319 TTGGTGCTTTCATCTTGGGGTGG + Intronic
1126522635 15:49614082-49614104 TTGGTGCTTTGTACTTGGAGTGG - Intronic
1126796329 15:52262898-52262920 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1127399232 15:58569601-58569623 TTGGAGGTGGGGCCTTTGGGAGG + Exonic
1127733211 15:61818972-61818994 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1128220575 15:65965487-65965509 TAGGAGGTGTGGCCTTTGGGAGG + Intronic
1128877136 15:71211565-71211587 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1129903194 15:79167434-79167456 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1130317271 15:82807492-82807514 TTGGAAATGTGGCCTTTGGGAGG + Intergenic
1130363688 15:83213340-83213362 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1130690043 15:86074365-86074387 TAGGGGGTGTGGCCTTTGGGAGG - Intergenic
1131352001 15:91709444-91709466 TTGGAAATTGGGCCTTTGGGAGG + Intergenic
1131599448 15:93831602-93831624 TTGGAGTTGTGACCTTTGGGAGG - Intergenic
1131659982 15:94503936-94503958 TTGGTGTTAGGGCCTTTGGGAGG - Intergenic
1131806412 15:96126943-96126965 TTTGTGCTTTGGTCCTTGGATGG - Intergenic
1132113785 15:99121034-99121056 GTGGGGTTTGGGCCTTTGGGTGG + Intronic
1133048525 16:3102846-3102868 TTGTTGATTTGGGATTTGGGAGG + Intergenic
1133771325 16:8868642-8868664 CCGCTGCTTTTGCCTTTGGGCGG - Intronic
1134204183 16:12223712-12223734 CTGCTGCTTTGCCCTGTGGGTGG + Intronic
1135136905 16:19891637-19891659 TTTCTGCTTTACCCTTTGGGAGG + Intergenic
1135597549 16:23755429-23755451 TTGGTTCTTTGGTTTTCGGGAGG + Intronic
1136536819 16:30904444-30904466 TTGGGGCCTCGGCCTTTGAGAGG - Intergenic
1136660670 16:31758212-31758234 TTGGAGCTTGGACCATTGGGAGG - Intronic
1137421913 16:48342067-48342089 TTGGTCCTTTGTCCCTTTGGAGG - Intronic
1137503307 16:49028351-49028373 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
1137572131 16:49573644-49573666 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1137957935 16:52852279-52852301 TGGATTCTTGGGCCTTTGGGTGG + Intergenic
1141936049 16:87238533-87238555 TAGGAGCTGGGGCCTTTGGGAGG - Intronic
1143448581 17:7022727-7022749 TTGGTGTGTTGGCTTTTGGGAGG - Intergenic
1146625520 17:34432174-34432196 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1148669192 17:49397719-49397741 TGGGAGCTTTAGCCTCTGGGTGG - Intronic
1150294255 17:63999263-63999285 TCGGTGGTCTGGACTTTGGGGGG - Intronic
1151145515 17:72036792-72036814 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1151229671 17:72675192-72675214 TAGGAGCTGGGGCCTTTGGGAGG + Intronic
1152010709 17:77712128-77712150 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1153082097 18:1239053-1239075 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1155636074 18:27957027-27957049 ATGATGCTTTGGGGTTTGGGGGG - Intronic
1156525762 18:37765924-37765946 TTGGAGGTGAGGCCTTTGGGAGG - Intergenic
1157412277 18:47473157-47473179 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1157423309 18:47563900-47563922 TTGGAGCTGGGGCCTTTGGGAGG + Intergenic
1158079138 18:53567810-53567832 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1158221268 18:55153419-55153441 TTACTGCTTGGTCCTTTGGGTGG + Intergenic
1158551040 18:58436610-58436632 GAGGTGCTTTGGCCATTGAGAGG - Intergenic
1159195206 18:65104558-65104580 TGGGAGGTGTGGCCTTTGGGAGG - Intergenic
1159464923 18:68769387-68769409 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1159592605 18:70351480-70351502 TTGGGGCTGGGGCCTTTCGGGGG + Intronic
1160100160 18:75913109-75913131 TTGGTGCTTGGTTCTGTGGGAGG - Intergenic
1160828573 19:1091962-1091984 TGGGTGCTCTGGGCTCTGGGTGG - Intronic
1161218300 19:3105687-3105709 TTGGTGCGTTGCCCTTGGGGTGG + Intronic
1162667716 19:12229225-12229247 TTGGCTTATTGGCCTTTGGGTGG + Intronic
1163662276 19:18585682-18585704 TTGTTGTTTTGGCCTCTGGTGGG - Intronic
1165334869 19:35162652-35162674 TTGGAGCGAGGGCCTTTGGGAGG - Intronic
1167641469 19:50685014-50685036 TGGGTCCTTTGGCTTTTAGGGGG - Intronic
1167735091 19:51289508-51289530 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1167840867 19:52118471-52118493 TTGGAGGTGTGGTCTTTGGGAGG + Intronic
1168322513 19:55518510-55518532 TTGGGGCTCTGGCTTCTGGGTGG - Exonic
1168677948 19:58292485-58292507 TTGGAGATGAGGCCTTTGGGAGG - Intronic
926165554 2:10520756-10520778 TTGGAGATGGGGCCTTTGGGGGG - Intergenic
926224582 2:10957857-10957879 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
926342254 2:11913349-11913371 TTGGAGGTGAGGCCTTTGGGAGG - Intergenic
926628122 2:15111262-15111284 TTAGTTCTTTGTGCTTTGGGGGG - Intergenic
926922113 2:17949373-17949395 TTGGAGATGAGGCCTTTGGGAGG + Intronic
927072502 2:19545501-19545523 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
927082466 2:19644067-19644089 CTAGTGGTTTGGCCTCTGGGTGG - Intergenic
927139249 2:20118449-20118471 TGGGTGTTTTCGCCTGTGGGTGG + Intergenic
927189107 2:20504507-20504529 TTGGAGATGGGGCCTTTGGGGGG - Intergenic
927267713 2:21171714-21171736 TTGATGGTGGGGCCTTTGGGAGG - Intergenic
927909781 2:26889059-26889081 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
928441356 2:31294910-31294932 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
928983779 2:37160840-37160862 TAGGAGGTGTGGCCTTTGGGTGG + Intergenic
929996956 2:46833729-46833751 TTGGTGGTAGGGCCTTTGGAAGG - Intronic
930937365 2:56970249-56970271 TAGGGGCTTTAGGCTTTGGGTGG - Intergenic
931003654 2:57821393-57821415 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
931157982 2:59657118-59657140 TTGGAGATTGGGCCTTTGGGAGG - Intergenic
931401122 2:61932607-61932629 TTGGTGGTGGGGTCTTTGGGAGG + Intronic
932529220 2:72509038-72509060 TTGGAGATGGGGCCTTTGGGAGG + Intronic
933002444 2:76942420-76942442 TTGGTGCTTTGCCCCTTGAAGGG + Intronic
933690687 2:85177259-85177281 TTGGAGGTGGGGCCTTTGGGTGG - Intronic
934578394 2:95417857-95417879 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
934601043 2:95658844-95658866 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
934695325 2:96396001-96396023 TTCTTGCTTTGTCCTTTTGGTGG - Intergenic
935090848 2:99893435-99893457 TTGGAGATGGGGCCTTTGGGAGG + Intronic
935697211 2:105780676-105780698 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
935913914 2:107927976-107927998 TAGGAGGTTGGGCCTTTGGGAGG - Intergenic
936287490 2:111191955-111191977 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
936351591 2:111716820-111716842 TGGGAGCTTTTGCCTTAGGGAGG - Intergenic
936450933 2:112633602-112633624 TTGGAGGTGCGGCCTTTGGGAGG + Intergenic
936534419 2:113301012-113301034 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
936847139 2:116850651-116850673 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
936874579 2:117172898-117172920 TTGGAGGTTGGGCCTTTGGGAGG + Intergenic
936986073 2:118312106-118312128 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
937436671 2:121887242-121887264 TGGGTGATTTGGGCTTTGAGTGG - Intergenic
937467664 2:122148900-122148922 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
937473771 2:122195989-122196011 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
937487900 2:122334844-122334866 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
938059436 2:128240572-128240594 TCTGTGCTTTGGCCTCTGGTGGG - Intronic
938100067 2:128492530-128492552 TAGGAGGTGTGGCCTTTGGGAGG + Intergenic
938555817 2:132423387-132423409 TTGGAGATTGGGCCTTTGGGAGG - Intronic
940084646 2:149845249-149845271 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
940291499 2:152081688-152081710 TTGGAGGTGCGGCCTTTGGGAGG - Intronic
941527831 2:166628481-166628503 TTGGTTCTTTGCCCAGTGGGAGG + Intergenic
942996946 2:182274154-182274176 TAGGAGGTTGGGCCTTTGGGAGG - Intronic
943765231 2:191653957-191653979 TTGGAGGTGGGGCCTTTGGGTGG - Intergenic
944076133 2:195733193-195733215 TTGGTGATTTGGGTTTAGGGAGG - Intronic
944693068 2:202175469-202175491 TTGGAGGTTGGGCCTCTGGGAGG + Intronic
945958085 2:216105052-216105074 TTGGAGATGAGGCCTTTGGGAGG - Intergenic
947009727 2:225552462-225552484 TTGGAGATGAGGCCTTTGGGAGG + Intronic
947940968 2:234054663-234054685 TTGGAGGTTGGGCCTTTGGGAGG - Intronic
948180750 2:235978133-235978155 TTGGAGACTGGGCCTTTGGGAGG - Intronic
948723886 2:239920089-239920111 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1169582236 20:7036618-7036640 TTGGAGATCAGGCCTTTGGGAGG - Intergenic
1170349557 20:15424100-15424122 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1170918165 20:20648993-20649015 TTTGTGTTTTGCCCTCTGGGGGG - Intronic
1171399783 20:24865395-24865417 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1171413216 20:24960298-24960320 CTGGGGCTTTGGCCTTCGGGGGG - Intergenic
1171514960 20:25722678-25722700 TTCTTGATTTGGCCTTTGGCTGG + Intergenic
1171946128 20:31379192-31379214 TGGGTGCAGTGGACTTTGGGAGG - Intronic
1173955343 20:47027999-47028021 TTGGTGATGAGGCCTTTGGGAGG + Intronic
1173983036 20:47239618-47239640 TTACTGCTTTGGCCATTGGGAGG - Intronic
1174738442 20:52987553-52987575 TAAGTGCTTTGGCATTTTGGGGG - Intronic
1175596485 20:60238862-60238884 TTGGTGGTGGGGCCTCTGGGAGG + Intergenic
1177449949 21:21253404-21253426 TAGGTGGTGGGGCCTTTGGGAGG + Intronic
1177714179 21:24817757-24817779 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1178007844 21:28242819-28242841 TAGGAGCTGTGGCCTTTGGTAGG - Intergenic
1178352697 21:31884200-31884222 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1179267262 21:39814779-39814801 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1179403953 21:41110236-41110258 TTGATGCTATGGCCTGTGGGAGG - Intergenic
1179429891 21:41314069-41314091 TTGGAGATAGGGCCTTTGGGAGG + Intronic
1180054897 21:45352675-45352697 TCGGTGCCTGGGTCTTTGGGAGG - Intergenic
1180239600 21:46492585-46492607 TTGGAGTTTGGTCCTTTGGGAGG + Intronic
1181489167 22:23250957-23250979 CAGTTCCTTTGGCCTTTGGGTGG - Intronic
1182073477 22:27479049-27479071 TTGCTTCTTTAGACTTTGGGTGG + Intergenic
1182418510 22:30236825-30236847 TTGGTGGTGGGCCCTTTGGGAGG - Intergenic
1182920908 22:34077841-34077863 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1182963304 22:34497138-34497160 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1184948852 22:47825058-47825080 CTGTTGAATTGGCCTTTGGGTGG - Intergenic
950327893 3:12129853-12129875 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
950459283 3:13111625-13111647 TTGGGGGTGGGGCCTTTGGGAGG + Intergenic
950847910 3:16032669-16032691 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
951035419 3:17927126-17927148 TTGGTGCTCTGAGCTTTAGGAGG + Intronic
951656777 3:25017858-25017880 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
951678091 3:25264942-25264964 TTGGAGGTGAGGCCTTTGGGAGG + Intronic
951900244 3:27650503-27650525 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
953464789 3:43110076-43110098 TTGGAGATATGGCCTTTGAGAGG - Intergenic
954695547 3:52422985-52423007 TTGGTGCCTTTGACTTTGGAAGG + Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956192861 3:66623602-66623624 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
956495701 3:69823541-69823563 TCGGTGGTGGGGCCTTTGGGAGG - Intronic
956718417 3:72098305-72098327 TAGGTGCCTTGGTCTTGGGGAGG - Intergenic
957244115 3:77696581-77696603 TAGGTGGTGTGGCTTTTGGGAGG - Intergenic
957537963 3:81531105-81531127 TGGGTGCCATGGCCTTGGGGTGG - Intronic
957704215 3:83758159-83758181 TTGGAGATGTGGCCTTTGGAGGG - Intergenic
960093867 3:113669069-113669091 TTGTTGCTTTTGTTTTTGGGTGG - Intronic
960974075 3:123158584-123158606 TGGCTTCTTTGGCCTTTGAGTGG - Intronic
960984269 3:123263435-123263457 TAGGAGCTGGGGCCTTTGGGAGG - Intronic
961266838 3:125649871-125649893 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
961389942 3:126546445-126546467 TTGGCGATGGGGCCTTTGGGAGG + Intronic
961415665 3:126754833-126754855 TTGGTGCTTTGGCCTTTGGGAGG + Intronic
962185374 3:133253525-133253547 TTTCTTCTTTGGCCTTTGGTGGG - Intronic
962185769 3:133258078-133258100 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
963404739 3:144848386-144848408 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
963512724 3:146268984-146269006 TAGGAGCTGGGGCCTTTGGGAGG + Intergenic
964003517 3:151805783-151805805 TTGGGGCTTAGGTCTATGGGAGG - Intergenic
964623593 3:158738667-158738689 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
965001293 3:162957380-162957402 TTGGAGATTGGGCCTTTGGGAGG - Intergenic
966301240 3:178481734-178481756 TTAGAGCCTTGCCCTTTGGGAGG + Intronic
966672103 3:182538764-182538786 TTGGAGCCATGGCCTTTTGGGGG - Intergenic
967695532 3:192527068-192527090 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
967747407 3:193072656-193072678 TTGGAGATTGGGCCTTTGAGAGG + Intergenic
969118443 4:4889172-4889194 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
969356723 4:6632224-6632246 TTGGAGATGAGGCCTTTGGGTGG - Intergenic
969410169 4:7022852-7022874 TTAGTTCTTTGGGCTTGGGGGGG + Intronic
969416749 4:7065552-7065574 TAAGTGCTTTGTGCTTTGGGAGG + Intronic
969490075 4:7494613-7494635 TTGGAGATGGGGCCTTTGGGAGG - Intronic
969858037 4:10015565-10015587 TTGGAGATGAGGCCTTTGGGAGG + Intronic
969955253 4:10883032-10883054 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
970111723 4:12645181-12645203 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
970775058 4:19663768-19663790 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
970810874 4:20092833-20092855 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
971103674 4:23497827-23497849 TTGGAGGTTGGGCCTTTGGGAGG + Intergenic
971232736 4:24813057-24813079 TTGGAGGTGAGGCCTTTGGGAGG + Intronic
971254807 4:25004576-25004598 TTGGTGGTGGGGCCTTTGGGAGG + Intronic
971310115 4:25518455-25518477 TTGGAGCTGAGGCCTTTGGGAGG - Intergenic
972018221 4:34273137-34273159 TTGGAGGTGTGGCCTTTGGGAGG - Intergenic
972214668 4:36882542-36882564 ATGGTACATTGGCCTTTGGGAGG - Intergenic
972973552 4:44606336-44606358 TAGGAGCTGGGGCCTTTGGGAGG - Intergenic
973215652 4:47666589-47666611 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
973695210 4:53483942-53483964 TTGGAGGTAGGGCCTTTGGGAGG + Intronic
974031992 4:56784475-56784497 TTGGAGATTGGGCCTTTTGGGGG + Intergenic
974079458 4:57197157-57197179 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
974744642 4:66056679-66056701 TTGGAGGTTGGGCCTTTGGGAGG - Intergenic
976021850 4:80639093-80639115 TTGGAGATGAGGCCTTTGGGAGG - Intronic
976188596 4:82467812-82467834 TTGGAGATAAGGCCTTTGGGAGG + Intergenic
976397713 4:84574098-84574120 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
977019071 4:91736636-91736658 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
977756122 4:100674416-100674438 TTGGAGATACGGCCTTTGGGAGG - Intronic
978333445 4:107640960-107640982 TTTGTGCTTTGGCATTTGGAGGG - Intronic
979073248 4:116239204-116239226 CTGTTACTTTGACCTTTGGGAGG + Intergenic
981085135 4:140675893-140675915 TTGATGCTTTGGCATCTTGGGGG + Intronic
981836096 4:149055977-149055999 TTGATGCTTTGGAGTTGGGGAGG - Intergenic
981958946 4:150512434-150512456 GAGGTGATTTGGACTTTGGGAGG + Intronic
982618116 4:157667736-157667758 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
983162040 4:164428327-164428349 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
984109606 4:175595987-175596009 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
984236826 4:177169239-177169261 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
984282445 4:177687776-177687798 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
984628684 4:182037595-182037617 TTGCTGCCTTGCCCTTGGGGTGG - Intergenic
985218868 4:187681677-187681699 TTGGAGCTAGGGCCCTTGGGGGG + Intergenic
985733146 5:1562837-1562859 TTGGGGGTGGGGCCTTTGGGAGG - Intergenic
985936108 5:3099868-3099890 TAGGAGCTGGGGCCTTTGGGAGG - Intergenic
986022181 5:3814671-3814693 TTGGAGATTGGGCCTTTGGGAGG - Intergenic
986396470 5:7335665-7335687 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
986480049 5:8177405-8177427 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
987175371 5:15302563-15302585 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
987606943 5:20148591-20148613 ATGGTGCTTTGGACTTTTGGTGG - Intronic
987623327 5:20365318-20365340 TTGGAGATGAGGCCTTTGGGAGG - Intronic
988735262 5:34014139-34014161 TTGGTGATGGGGCCTTTGGGAGG - Intronic
988972926 5:36487795-36487817 TTGGAGTTGGGGCCTTTGGGAGG + Intergenic
989154840 5:38334517-38334539 TTGTAGATGTGGCCTTTGGGAGG - Intronic
989314736 5:40064860-40064882 TTGGTGATGGGGCCTTTGAGAGG + Intergenic
989792496 5:45422487-45422509 TTGGAGGTTTGGCCCTTGAGGGG - Intronic
990051492 5:51506918-51506940 TGGGAGATTTGGCCTTTGAGAGG - Intergenic
990146105 5:52762021-52762043 CTGGAGATTGGGCCTTTGGGAGG + Intergenic
990657704 5:57975712-57975734 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
991021772 5:61986897-61986919 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
991403555 5:66278890-66278912 TAGGAGGTGTGGCCTTTGGGAGG - Intergenic
991640307 5:68745293-68745315 TTGGAGGTGAGGCCTTTGGGAGG - Intergenic
992018832 5:72602442-72602464 ATGTTGCATTGGCCTTTGAGTGG - Intergenic
992104378 5:73437502-73437524 TTTGTGCTTGGGGCTTTAGGAGG + Intergenic
992155772 5:73953750-73953772 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
992161767 5:74011335-74011357 TTGGAGCTGGGGCCTTTGGAAGG - Intergenic
992207924 5:74449022-74449044 TTGGAGATGTGGCCTTTGGGAGG - Intergenic
993390565 5:87315451-87315473 TTGGTGGTAGGGCCTTTGTGAGG - Intronic
993996765 5:94732619-94732641 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
994301070 5:98148246-98148268 TTACAGCTTTGGCCATTGGGAGG + Intergenic
994716443 5:103327532-103327554 TAGGTGGTGGGGCCTTTGGGAGG + Intergenic
995024672 5:107405795-107405817 TTGGTGCTATGGAGTATGGGGGG - Intronic
995699855 5:114923100-114923122 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
995933481 5:117480721-117480743 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
995980219 5:118093016-118093038 TTGGTGCTTTCTTATTTGGGAGG - Intergenic
995991363 5:118243798-118243820 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
996907115 5:128613406-128613428 TAGGTGGTGGGGCCTTTGGGAGG - Intronic
997621312 5:135298053-135298075 TTGGAGATGGGGCCTTTGGGAGG + Intronic
997855606 5:137369881-137369903 TTGGAGATGGGGCCTTTGGGAGG - Intronic
998633804 5:143930331-143930353 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1000166463 5:158653860-158653882 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1000635760 5:163641874-163641896 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
1000903121 5:166932548-166932570 TTTGAGCTTTGGCCATTGGGTGG - Intergenic
1001688098 5:173610800-173610822 TTGGAGGTAGGGCCTTTGGGAGG + Intronic
1001730285 5:173948894-173948916 TTGGAGCTGGGGCCTTTGGTAGG - Intronic
1002398593 5:178977250-178977272 TTGGAGCTGGGGCCTTTGGGAGG + Intergenic
1002667122 5:180833129-180833151 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1002788468 6:421564-421586 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1003521786 6:6864275-6864297 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1003716471 6:8652165-8652187 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1003862951 6:10338469-10338491 TTGGAGTTTTTTCCTTTGGGTGG - Intergenic
1004429492 6:15530966-15530988 TTGGAGCTGGGGCCTTTGGGAGG + Intronic
1004525573 6:16404373-16404395 AAGGTGCTTTGTCCTTTGGGAGG + Intronic
1004619279 6:17319237-17319259 TTGGGGCTTAGGTCTATGGGAGG + Intergenic
1005678737 6:28183479-28183501 TTGGGGATGGGGCCTTTGGGAGG - Intergenic
1005877158 6:30019790-30019812 TGGCTCCTTTGGCATTTGGGGGG + Intergenic
1005901948 6:30224289-30224311 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1007165118 6:39823759-39823781 CTGGTGCTTTGGCCCTTAGATGG + Intronic
1007275374 6:40669457-40669479 TGGGAGGTGTGGCCTTTGGGAGG + Intergenic
1008165398 6:48132153-48132175 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1009361550 6:62820642-62820664 TTGGAGATGAGGCCTTTGGGAGG - Intergenic
1009785231 6:68328608-68328630 TTGGTGATGAGGTCTTTGGGAGG - Intergenic
1009897023 6:69764205-69764227 TTGGAGATGAGGCCTTTGGGAGG + Intronic
1009929826 6:70164012-70164034 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1009947641 6:70358222-70358244 TTGGAGATATGGCCTTTGGGAGG + Intergenic
1010162984 6:72880438-72880460 TTGGAGGTTGGGCCTTTAGGAGG - Intronic
1010953697 6:82067023-82067045 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1011264284 6:85498831-85498853 TTGGAGTTTGGGCCTTTGGGAGG - Intergenic
1011310011 6:85971477-85971499 CTGGTGCTTAGGCCTTTGAGGGG - Intergenic
1011476777 6:87756163-87756185 TTGGTGCTAAAGCCTTTAGGTGG - Intergenic
1012844328 6:104370343-104370365 TTGGAGGTTGGACCTTTGGGAGG + Intergenic
1013045274 6:106479366-106479388 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1014174295 6:118314824-118314846 TTTGTGCTGTGACCTTTGTGGGG + Exonic
1014302648 6:119701733-119701755 TAGGTGGTGGGGCCTTTGGGAGG + Intergenic
1014568849 6:122984677-122984699 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1016090787 6:139976268-139976290 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1016295482 6:142568763-142568785 TTTGTGCTTTGTTTTTTGGGAGG + Intergenic
1016734319 6:147460011-147460033 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1016876546 6:148871015-148871037 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1017033711 6:150248160-150248182 TTGGAGGTAGGGCCTTTGGGAGG - Intronic
1017048320 6:150367693-150367715 TTGGAGGTTGGGCCTTTGGGAGG + Intergenic
1017179821 6:151540750-151540772 TTGGAGGTTGGGCCTTTGGGAGG - Intronic
1017399894 6:154048046-154048068 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1017450971 6:154553956-154553978 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1018296106 6:162345898-162345920 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1019026812 6:168972706-168972728 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1019695209 7:2442058-2442080 TTGGTGCCAGGGGCTTTGGGGGG - Intergenic
1020380549 7:7540514-7540536 TTAATGATTTGACCTTTGGGTGG - Intergenic
1021028820 7:15703625-15703647 ATGGTGGTTTGGCCTTTTGAAGG + Intergenic
1021062449 7:16130839-16130861 TTGGAGGTAAGGCCTTTGGGGGG + Intronic
1021291301 7:18848389-18848411 TTGGAGCTGGGGCCTGTGGGTGG + Intronic
1022620314 7:31977162-31977184 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1024099148 7:46011293-46011315 CTGGGGCTTTGGCCACTGGGCGG - Intergenic
1025295570 7:57773213-57773235 GTGGGGCTTTTGTCTTTGGGTGG - Intergenic
1026353926 7:69540928-69540950 TTGGTGGTGGGGCCTTTGGGAGG + Intergenic
1028092951 7:86725966-86725988 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1028452283 7:90999112-90999134 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1028454041 7:91018965-91018987 TAGGAGATTTGGCCTTTGAGAGG - Intronic
1028597111 7:92557382-92557404 TAGGAGGTGTGGCCTTTGGGAGG + Intergenic
1029643864 7:101839138-101839160 TTGGAGGTGTGGCCTTTGGAAGG - Intronic
1030038646 7:105430459-105430481 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1030089908 7:105849431-105849453 CTGGTGTTTTGGTGTTTGGGTGG - Intronic
1030208581 7:106974500-106974522 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
1030318000 7:108136214-108136236 TTTGTGCTTAGGCCTATGGTAGG - Intergenic
1031062012 7:117062236-117062258 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1031194953 7:118601423-118601445 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1032066078 7:128772314-128772336 TTGTTGAAATGGCCTTTGGGTGG + Intergenic
1032132793 7:129244672-129244694 TTGGTGGTGAGGCCTTTGGGAGG - Intronic
1032702125 7:134391535-134391557 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1033896153 7:146073268-146073290 TTGGTGGTGAGGCCTTTGGCAGG - Intergenic
1034082110 7:148288473-148288495 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1034937937 7:155211788-155211810 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1034998815 7:155595151-155595173 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1035098058 7:156372651-156372673 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1036029857 8:4957282-4957304 TAGGGGCTTTGCCCTTTGTGTGG - Intronic
1036049272 8:5178099-5178121 TTGGAGCTGAGTCCTTTGGGAGG + Intergenic
1036461280 8:8955071-8955093 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1036678582 8:10854060-10854082 TAGGAGGTGTGGCCTTTGGGAGG + Intergenic
1036679353 8:10859626-10859648 CTGGTGCGTTTTCCTTTGGGAGG - Intergenic
1036792729 8:11732942-11732964 TTGGAGGTTGGGCATTTGGGAGG - Intronic
1036792926 8:11734852-11734874 TTGGAGGTTGGGCATTTGGGAGG - Intronic
1037315968 8:17599854-17599876 ATAGTGCTTTGGCCTTAGGAGGG - Intronic
1037607626 8:20450663-20450685 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1037631309 8:20659065-20659087 GTGGTGCTGTGGCCTTAGAGGGG - Intergenic
1037714073 8:21382135-21382157 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1037761097 8:21742217-21742239 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1038299854 8:26334258-26334280 TTTGTTCTTTGGCATTTTGGTGG + Intronic
1038315069 8:26477225-26477247 TTTGTGCTTTGGGGTTTTGGTGG - Intronic
1038864107 8:31420668-31420690 TTGGAGGTGAGGCCTTTGGGAGG + Intergenic
1039691166 8:39866302-39866324 TTGATGATTGGACCTTTGGGAGG - Intergenic
1040535704 8:48307723-48307745 TTGCTCATTTTGCCTTTGGGTGG + Intergenic
1040994670 8:53389624-53389646 TAGGTGCTGGGGTCTTTGGGAGG - Intergenic
1041122172 8:54597814-54597836 TGGTTGCTTTGGGCTGTGGGTGG + Intergenic
1041164792 8:55080648-55080670 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1041556348 8:59160692-59160714 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1041577364 8:59414392-59414414 TTTCAGCTTTGGCCATTGGGGGG - Intergenic
1042541859 8:69915456-69915478 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1042703947 8:71647065-71647087 TTGGAGGTATAGCCTTTGGGAGG - Intergenic
1042719919 8:71816379-71816401 TTTGAGCTAAGGCCTTTGGGAGG - Intergenic
1043057204 8:75453930-75453952 TTGGAGATGGGGCCTTTGGGAGG + Intronic
1043202709 8:77390855-77390877 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1043680045 8:83011940-83011962 TTGTTGCTCTAGCCTTTGGATGG - Intergenic
1044243619 8:89915407-89915429 TTGGAGATGGGGCCTTTGGGAGG - Intronic
1044297444 8:90545271-90545293 TTGGACATATGGCCTTTGGGAGG - Intergenic
1044727300 8:95204014-95204036 TAGGAGGTGTGGCCTTTGGGAGG - Intergenic
1044745445 8:95366427-95366449 TTGGAGATAGGGCCTTTGGGTGG - Intergenic
1045035580 8:98174020-98174042 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1045525050 8:102934290-102934312 TTGGAGGTGGGGCCTTTGGGAGG + Intronic
1045602535 8:103733779-103733801 TTGCTGCTGTGGACTTGGGGAGG + Intronic
1046139698 8:110074794-110074816 TAGGTTCTGGGGCCTTTGGGAGG - Intergenic
1046484142 8:114863355-114863377 TTGGTGCTTTCTGTTTTGGGAGG - Intergenic
1046761553 8:118026691-118026713 TTGGTTCTTTTATCTTTGGGGGG + Intronic
1047872017 8:129094431-129094453 TTGGAGGTAGGGCCTTTGGGAGG + Intergenic
1048023212 8:130559798-130559820 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1048327755 8:133452144-133452166 TTGGAGATGGGGCCTTTGGGAGG - Intergenic
1048356258 8:133656391-133656413 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1048432521 8:134383447-134383469 TTGGGGCTTTGACTTTTGAGAGG - Intergenic
1049099453 8:140568709-140568731 TTGGTGCTGAGGTCTTTTGGGGG - Intronic
1049291183 8:141803121-141803143 TTGGGGCTATGGGTTTTGGGAGG + Intergenic
1049413822 8:142486010-142486032 TTGGTGGTGGGGCCTTTGGGAGG - Intronic
1049559850 8:143304530-143304552 TTGGAGGTGGGGCCTTTGGGAGG - Intronic
1049843576 8:144789091-144789113 TGGGTGCTTTTTCCTGTGGGTGG - Intergenic
1051882992 9:21859131-21859153 TTGGAGGTTGGGCATTTGGGAGG - Intronic
1052430263 9:28357322-28357344 TTGGTGCTTTCTTTTTTGGGGGG - Intronic
1053543367 9:38997662-38997684 TTAGAAATTTGGCCTTTGGGGGG + Intergenic
1053807798 9:41821170-41821192 TTAGAAATTTGGCCTTTGGGGGG + Intergenic
1054622794 9:67366258-67366280 TTAGAAATTTGGCCTTTGGGGGG - Intergenic
1055286756 9:74737001-74737023 TTTGTGCTTTGAGTTTTGGGTGG - Intronic
1056423281 9:86451223-86451245 TTGGAGCTAGGGCCTTTGGGAGG + Intergenic
1056438593 9:86597492-86597514 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1056746254 9:89306407-89306429 TTGGAGGTGGGGCCTTTGGGAGG + Intergenic
1057707051 9:97402377-97402399 TTGGAGGTTTGACCTTTGGGAGG - Intergenic
1057931714 9:99199442-99199464 TTGGTGCTCTTGGCTTTGGGAGG + Intergenic
1057951262 9:99370558-99370580 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1058827614 9:108788841-108788863 TAGGGGCTGGGGCCTTTGGGAGG - Intergenic
1059556688 9:115287976-115287998 TTGGAGGTGAGGCCTTTGGGAGG + Intronic
1062171346 9:135136520-135136542 TGGCTGCTCTTGCCTTTGGGAGG + Intergenic
1062325821 9:136012078-136012100 ATGGTTCTGTGGCCTTGGGGAGG - Intronic
1185431730 X:15105-15127 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1185441051 X:227824-227846 TTGGAGATATGGCCTTTGGGAGG - Intergenic
1185872240 X:3673805-3673827 TAGGTGTTGTGTCCTTTGGGAGG + Intronic
1186437946 X:9559369-9559391 ATGGTGCTGTGGCTTTTTGGAGG + Intronic
1186851719 X:13586605-13586627 TTGGTGGTGGGGTCTTTGGGAGG - Intronic
1186942535 X:14526612-14526634 ATGATGCCTTGGCCTTTGGTTGG + Intergenic
1187603962 X:20862892-20862914 TTGGAGGTTTGGCCTTCGGGAGG + Intergenic
1188845398 X:35065820-35065842 TTGGAGGTGAGGCCTTTGGGAGG - Intergenic
1189274005 X:39771649-39771671 TTACTGCTCGGGCCTTTGGGAGG + Intergenic
1190105845 X:47560892-47560914 TTAGGGCTTTGGCATCTGGGCGG - Intergenic
1190124894 X:47695557-47695579 TTGGAGATGGGGCCTTTGGGAGG + Intergenic
1190297796 X:49038779-49038801 TTAGTTCTTTGGCCATTAGGGGG - Intronic
1190528421 X:51351024-51351046 TGGGAGATGTGGCCTTTGGGTGG + Intergenic
1191189617 X:57652341-57652363 TTGGATTATTGGCCTTTGGGTGG - Intergenic
1191763100 X:64664971-64664993 TTAGTTCTTTGTCATTTGGGTGG - Intergenic
1192032441 X:67528595-67528617 TGGGAGCTGTGCCCTTTGGGAGG - Intergenic
1192302578 X:69921060-69921082 TTCTGGCTTTGGCCTTTGGGAGG + Intronic
1192734550 X:73836879-73836901 TTCCAGCTTTGGCCATTGGGAGG - Intergenic
1192964865 X:76166547-76166569 TGGGAGTTGTGGCCTTTGGGAGG - Intergenic
1194957580 X:100198652-100198674 TAGGAGGTTGGGCCTTTGGGAGG + Intergenic
1195618319 X:106930111-106930133 TTGGTGCTATGGTCTTTCAGAGG - Exonic
1196267633 X:113669653-113669675 TTGGTTCTTTGAACTTTGGTAGG + Intergenic
1197578397 X:128251674-128251696 TTGGAGATGAGGCCTTTGGGAGG + Intergenic
1197733710 X:129834036-129834058 TTGGAGGTGGGGCCTTTGGGGGG + Intronic
1198010311 X:132545809-132545831 TTGGAAGTGTGGCCTTTGGGAGG + Intergenic
1198299499 X:135321254-135321276 TGGGTGGTGTGGCCTTTGGGAGG - Intronic
1198410911 X:136366918-136366940 TTGGAGATGAGGCCTTTGGGAGG + Intronic
1198455705 X:136815683-136815705 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1198745330 X:139884170-139884192 TCAGTGCCTTGGACTTTGGGAGG - Intronic
1199274358 X:145924127-145924149 TTGGTGATTAGGCCTCTGGGTGG - Intergenic
1199340240 X:146669074-146669096 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1199756488 X:150869847-150869869 TTGTATCTTTGGCCTTTTGGAGG + Intronic
1199858482 X:151779271-151779293 TTGGAGGTGGGGCCTTTGGGAGG - Intergenic
1200320319 X:155181698-155181720 TAGGTGATGGGGCCTTTGGGAGG - Intergenic
1200791665 Y:7304876-7304898 TAGGTGGTGTGTCCTTTGGGAGG - Intergenic
1200920443 Y:8608378-8608400 GAGGTGATTTGGACTTTGGGGGG - Intergenic
1201148414 Y:11080079-11080101 TTGGAGGTAGGGCCTTTGGGAGG - Intergenic
1202031849 Y:20583689-20583711 TAGGAGGTTGGGCCTTTGGGAGG - Intronic