ID: 961420319

View in Genome Browser
Species Human (GRCh38)
Location 3:126797899-126797921
Sequence GGAGCCAGACACTGGCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961420319_961420325 -2 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420325 3:126797920-126797942 CCAGTCCTCCTTGTCGAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 73
961420319_961420322 -6 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420322 3:126797916-126797938 GGCTCCAGTCCTCCTTGTCGAGG 0: 1
1: 0
2: 0
3: 9
4: 95
961420319_961420328 4 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420328 3:126797926-126797948 CTCCTTGTCGAGGGAGGGTTTGG 0: 1
1: 0
2: 0
3: 6
4: 109
961420319_961420323 -5 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420323 3:126797917-126797939 GCTCCAGTCCTCCTTGTCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 103
961420319_961420326 -1 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420326 3:126797921-126797943 CAGTCCTCCTTGTCGAGGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 101
961420319_961420329 5 Left 961420319 3:126797899-126797921 CCTCCGTGCCAGTGTCTGGCTCC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 961420329 3:126797927-126797949 TCCTTGTCGAGGGAGGGTTTGGG 0: 1
1: 0
2: 0
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961420319 Original CRISPR GGAGCCAGACACTGGCACGG AGG (reversed) Intronic
900916967 1:5645984-5646006 GGAGCCAGAGACTGGGGAGGAGG + Intergenic
901448609 1:9323018-9323040 ACAGCCAGACACTGTCACCGTGG - Intronic
901878072 1:12178465-12178487 TGAGCCAGACACAGACACGTGGG - Intronic
902875716 1:19339685-19339707 TCAGCCAGGCACTGGCATGGTGG - Intronic
904601984 1:31678317-31678339 GGAGCCAGACACACGGACAGTGG + Intronic
907333380 1:53685657-53685679 GGAGACAGTCACAGGCAAGGAGG - Intronic
908185403 1:61648067-61648089 GGTGGAAGACCCTGGCACGGAGG + Intergenic
909255131 1:73410552-73410574 ATAGCCAGACACTGGGACGTGGG + Intergenic
916171270 1:162003198-162003220 GGAGCCAGACCATGACCCGGAGG - Intronic
920349500 1:205328587-205328609 GGAGCCAGGCACGGGGAAGGGGG - Intergenic
923604685 1:235432490-235432512 GGGGCCAGACACTGGCACTGGGG + Intronic
1067348680 10:45456425-45456447 GGAATCAGACACTGGCTTGGAGG + Exonic
1071397701 10:85239409-85239431 AGAGCCAGACTCTGGCAGGAAGG + Intergenic
1073994259 10:109297010-109297032 TGAACAAGACACTGGCACTGTGG - Intergenic
1074737936 10:116455324-116455346 GGATACAGACACAGGCAAGGTGG + Intronic
1075512938 10:123086888-123086910 GGGGCCAGACAGGGTCACGGAGG + Intergenic
1075968328 10:126631914-126631936 GGCGTCAGACACTGACACAGGGG + Intronic
1076874214 10:133208026-133208048 GGCCCCAGTCACTGGCAGGGTGG - Intronic
1076888754 10:133274116-133274138 GGAGCCAGGCCCGGGCAGGGGGG + Intronic
1077279342 11:1735041-1735063 GGCCCCAGACACAGGCAGGGTGG + Exonic
1078189340 11:9078575-9078597 GGAGCCAGGCCCTGGCTCTGTGG - Intronic
1079159714 11:17980422-17980444 GGAGCCAGTCTCTTGCACTGAGG + Intronic
1080055260 11:27900349-27900371 GGAGAAAGACCCTGGCATGGAGG - Intergenic
1083329274 11:61890073-61890095 GGCGCCAGACGCTGGCCCGAGGG - Intronic
1083776970 11:64898791-64898813 GGAGCCAGCCACAGGCCCTGCGG - Exonic
1084149629 11:67282093-67282115 GGACCCAGAGAGTGGCTCGGTGG - Intronic
1085016414 11:73177053-73177075 GGACACAGACACTGGGGCGGGGG - Intergenic
1086245499 11:84747021-84747043 AGAACCAAACACTGGCAAGGCGG + Intronic
1089216023 11:116835290-116835312 GGAGCCAGCCACTGGGATTGGGG - Intergenic
1090049796 11:123367966-123367988 GGAGCCAGGGCCGGGCACGGTGG + Intergenic
1091492958 12:949069-949091 AGAGCGAGACCCTGTCACGGGGG - Intronic
1091595058 12:1872703-1872725 AGAGCCAGACACTGCCTCGGCGG + Intronic
1091741228 12:2961386-2961408 GGAGCCAGAAACTGTCTCGGGGG + Intronic
1094817548 12:34203087-34203109 GGAGCCAGAGCCTGGAAAGGAGG - Intergenic
1095099563 12:38166224-38166246 GGAGCCAGAGCCTGGAAAGGAGG + Intergenic
1095396965 12:41772432-41772454 GTAGCCAGAGAGTGCCACGGTGG + Intergenic
1096095906 12:48935513-48935535 GGAGCCAGACACTGGTAGCAGGG + Intronic
1097196176 12:57243521-57243543 GGAGCCAGGGACTGGGGCGGGGG - Exonic
1098123768 12:67269404-67269426 GGAGCCAGACACTTCCACTCAGG - Exonic
1098372031 12:69769476-69769498 TCAGCCAGACACTATCACGGGGG + Intronic
1099178762 12:79454063-79454085 GGAGCCCGAGACTGGAAAGGAGG + Intergenic
1101779185 12:107820718-107820740 GGGGCCAGGTACTGGCAGGGGGG - Intergenic
1102956506 12:117062596-117062618 GGACCCAGGCAGTGGCATGGTGG + Intronic
1103599695 12:122046549-122046571 GGAGACAGACACTGGAACGAAGG + Intronic
1103706500 12:122876993-122877015 GGAGCTAGACACTGGCCAGCTGG - Intronic
1103741879 12:123096619-123096641 GGAGACAGCCACAGGCCCGGGGG + Intronic
1103758859 12:123233332-123233354 GGAGCCAGCCGCTGCCACGAGGG + Exonic
1104039517 12:125120627-125120649 GGAGGCAGGCACTGGGTCGGGGG + Intronic
1104464326 12:128978399-128978421 AGGGCCAGACACTCACACGGAGG - Intronic
1104982956 12:132582234-132582256 AGAGCCGGACAATGGCAAGGAGG + Exonic
1105472121 13:20703860-20703882 GGAGCCAGAGGCCGGCCCGGAGG - Intronic
1112370821 13:98791916-98791938 AGAGCCAGACCCTTGCACAGAGG - Intergenic
1113940532 13:114016403-114016425 GAACCCGGCCACTGGCACGGAGG + Intronic
1116718020 14:48453023-48453045 GGAGCCAGACAGTTCCACAGGGG + Intergenic
1116930788 14:50688642-50688664 GGAGCTAGAGCCTGGAACGGGGG + Intergenic
1121291697 14:92780905-92780927 AGAGCCAGGCAATGGCACAGGGG - Intergenic
1121544663 14:94754619-94754641 GGAGGCAGACAGTGGCATGATGG - Intergenic
1121604732 14:95232172-95232194 TCACCCAGACACTGGCACTGGGG - Intronic
1123490508 15:20776070-20776092 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1123547009 15:21345157-21345179 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1124006891 15:25801783-25801805 GGGTTCAGAGACTGGCACGGGGG - Intronic
1125874663 15:43133639-43133661 GGAGCCAGACACTGGGCCTAGGG - Exonic
1130303885 15:82699961-82699983 GTAACCGGACACTGGCAGGGAGG + Intronic
1131123692 15:89840016-89840038 AGAGACAGAAACTGGAACGGGGG + Intronic
1131486060 15:92821407-92821429 AGAGCCAGACTCTGTCTCGGGGG + Intergenic
1131823683 15:96298224-96298246 GGAGCCATACACTGGGACTAGGG + Intergenic
1132077008 15:98830349-98830371 TCTGCCAGACACTGGCACTGGGG + Intronic
1202955341 15_KI270727v1_random:72373-72395 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1132981836 16:2742326-2742348 GGAGGCAGACACCGGCAGTGGGG + Intergenic
1133500038 16:6357225-6357247 GGACCCAGACTCTAGCACGAAGG - Intronic
1133758251 16:8778435-8778457 GGAGACAGACACAGGCACAGTGG - Intronic
1139088405 16:63616576-63616598 GGCTCCAGGCACTGGCACAGTGG + Intergenic
1140270455 16:73460821-73460843 GGAGCAAGAAAGTGGCAGGGAGG - Intergenic
1140405524 16:74708400-74708422 GGAGCTAGCCACTGGAACTGTGG - Intergenic
1140578128 16:76196904-76196926 TGAGCCACACACTGGCAAGCCGG + Intergenic
1142295244 16:89217522-89217544 GGAGGCAGAGACAGGCCCGGAGG - Intergenic
1143185651 17:5008505-5008527 TGAGCCAGACAGTGTCACTGGGG + Intronic
1143443200 17:6991704-6991726 GGAGCCTGGGACGGGCACGGTGG + Intronic
1143524188 17:7462867-7462889 GGAGGCAGAAGCTGGAACGGAGG - Exonic
1143697277 17:8630187-8630209 GGAGGCAGACACTGGCTCGCGGG + Intronic
1144370933 17:14590967-14590989 GGAGCTAGACATTGGCCCTGAGG - Intergenic
1145817366 17:27805202-27805224 GGCACCAGACACTGACATGGAGG - Intronic
1146063374 17:29618394-29618416 GGGGCCTGACACTGGCTCGAGGG - Intronic
1148856340 17:50581064-50581086 GGGGCGAGACAGAGGCACGGAGG + Intronic
1148872728 17:50668305-50668327 GGGCCCAGACACTAGCACTGGGG - Intronic
1151554848 17:74841625-74841647 GGAGCCTGACAGTGCCATGGTGG - Intergenic
1152472482 17:80498180-80498202 GGATCCAAACCCAGGCACGGTGG - Intergenic
1152681390 17:81670171-81670193 GGAGGCAGACAGTGGCAGGCAGG - Intronic
1155176041 18:23302191-23302213 GGAGCCAGACACAGACACAGAGG + Intronic
1155315907 18:24569800-24569822 CGAGCCAGACACTGCCAAAGAGG - Intergenic
1159080587 18:63731285-63731307 GGAGCCAGGTCCTGGAACGGGGG - Intergenic
1160744739 19:705546-705568 GGGGCCAGACCCAGGCAGGGCGG - Intergenic
1160944682 19:1636019-1636041 GGGGCCAGACCCAGGCAGGGCGG - Intronic
1161582055 19:5086478-5086500 AGAGCCACACTCTGGCATGGAGG + Intronic
1162728804 19:12705589-12705611 GATGACAGACACTGGCAGGGAGG + Exonic
1163614473 19:18318521-18318543 GGAGCCACAGACTGGCACACGGG + Intronic
1165052975 19:33154729-33154751 GCAGCCAGACACTGTCATTGAGG - Intronic
1165184083 19:34001876-34001898 GGAGACAGACACTGGTCCCGGGG - Intergenic
1165423639 19:35733896-35733918 TGAGCCAGGCACAGGCAAGGAGG - Intronic
1166569384 19:43784233-43784255 GGAGACAGAGACTGACACAGAGG + Intergenic
1167644027 19:50696072-50696094 GGAGCCAGCGAGAGGCACGGAGG + Intronic
1167793637 19:51695342-51695364 GGTGCCAGACCCTGGAACTGTGG + Intergenic
1168419371 19:56191219-56191241 GCAGGGAGACATTGGCACGGCGG - Intronic
927217488 2:20676181-20676203 AGAGCCAGACATGGGCATGGTGG - Intergenic
927551897 2:24008777-24008799 GGAGCAAGGGACAGGCACGGTGG - Intergenic
929891233 2:45919933-45919955 GAAGGCAGACACTGGGACAGTGG + Intronic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
931222036 2:60296779-60296801 GTCTCCAGACCCTGGCACGGGGG - Intergenic
931296154 2:60928024-60928046 GGAGCAGGGCACTGGCATGGTGG + Exonic
934689198 2:96345351-96345373 GGACCCAGACCCTGGAACGGGGG + Intronic
941854119 2:170212786-170212808 GGAGCCAGACACGAGCACTGGGG - Intronic
945057825 2:205883740-205883762 AGAGCCAGACTCTGTCTCGGGGG - Intergenic
947524994 2:230872287-230872309 GGAGGCAGAGACTGGCCCCGGGG + Intronic
1169318750 20:4613736-4613758 GGAGCCAGGCCCAGGCAAGGTGG + Intergenic
1170697030 20:18668493-18668515 GGAGCCAAGCAGTGGGACGGTGG + Intronic
1171779377 20:29405429-29405451 GGAGCCAGAGACTGGAAAGGAGG - Intergenic
1171972528 20:31573168-31573190 GGAGCCAGGCGCCGGCCCGGGGG - Intronic
1173079020 20:39848437-39848459 GGAGCCAGAAACAGGGATGGAGG + Intergenic
1173565145 20:44033181-44033203 GGGGCCAGAGGCAGGCACGGGGG + Intronic
1173681692 20:44886328-44886350 GGAGCCAAACACGGGGACTGGGG - Intronic
1175861470 20:62152360-62152382 GGAGCCAGAGGCTGGCATCGGGG - Intronic
1175995726 20:62811545-62811567 GGACCGAGGCACGGGCACGGTGG + Exonic
1176295011 21:5067163-5067185 TGAGCCAGACGCTGGCCCAGTGG + Intergenic
1178609584 21:34069263-34069285 GGAGCCAGACACAGGGACCAAGG + Intergenic
1179495986 21:41771676-41771698 GGGTCCAGGCACTGGCACAGGGG - Intergenic
1179787909 21:43740250-43740272 GGAGCCAGCGACTGGTACGCAGG + Intronic
1179862038 21:44194965-44194987 TGAGCCAGACACTGGCCCAGTGG - Intergenic
1180154247 21:45970544-45970566 GGAGCCGGAGCCTGGCCCGGAGG - Intergenic
1181631245 22:24152660-24152682 GGAGCCAGGGCCAGGCACGGTGG + Intronic
1183191694 22:36325686-36325708 GGAACCTGACCCCGGCACGGTGG - Intronic
1183193203 22:36335118-36335140 AGAGCCAGAGACTAGCACAGAGG - Intronic
1184152240 22:42645944-42645966 GGAGACAGACACCGGCAGAGAGG + Intronic
1184170937 22:42759386-42759408 GGGGGCAGACACTGCCATGGGGG - Intergenic
1184658332 22:45953183-45953205 GAAGCCAGGCACGGACACGGTGG - Intronic
1185259107 22:49851881-49851903 GGAGCTTGACACTGGCAGAGGGG + Intergenic
950522583 3:13505619-13505641 GGACCCAGACACTGGTGAGGCGG + Exonic
950548781 3:13654352-13654374 GGAGACAGACCCTGGCATGATGG + Intergenic
950932279 3:16802463-16802485 AGACCCAGACACTGGCATGCAGG - Intergenic
953232716 3:41078785-41078807 GGAGCTAGACACAGGAAGGGTGG + Intergenic
953527681 3:43707642-43707664 AGAGCAAGACACTGTCTCGGGGG - Intronic
955285485 3:57637083-57637105 TGGACCAGAGACTGGCACGGAGG - Intronic
955296016 3:57735687-57735709 GGAGACAGACAATAGCATGGTGG - Intergenic
957066204 3:75524559-75524581 TGAGCCAGTCACTGGTAAGGGGG - Intergenic
957085767 3:75675223-75675245 GGAGCCAGAGACTGGAAAGGAGG + Intergenic
957153487 3:76517364-76517386 GGAGCCAGGCACTGACCTGGTGG + Intronic
961286937 3:125813480-125813502 TGAGCCAGTCACTGGTAAGGGGG + Intergenic
961403505 3:126663473-126663495 GGATGCAGAGACTGGCAAGGTGG + Intergenic
961420319 3:126797899-126797921 GGAGCCAGACACTGGCACGGAGG - Intronic
961794144 3:129397447-129397469 GGGTTCAGACACTGGCAGGGTGG - Intergenic
961831008 3:129623068-129623090 GGAGCCAGCCATTCCCACGGTGG + Intergenic
962250546 3:133833500-133833522 GGAGCCTGACACAGGCCTGGAGG - Intronic
962430156 3:135311702-135311724 GGAGAGAGACACGGGCACGATGG - Intergenic
962974824 3:140436930-140436952 AGAGACAGACACTGGCACTGGGG - Intronic
963627821 3:147695227-147695249 GGAGACAGACAATGGGAAGGAGG + Intergenic
963912794 3:150829179-150829201 GGAGCTAGTCATTGGCATGGGGG + Intergenic
965741196 3:171876199-171876221 GCACCCAGACACTGGAACAGAGG - Intronic
967070998 3:185962136-185962158 GGAGCCAGACATGGGCAGGGTGG - Intergenic
967456128 3:189688682-189688704 GAAGCCAGATACTGTCACAGTGG - Intronic
967983277 3:195078085-195078107 GGAGCCAGAAACAGCCATGGCGG + Intronic
968087823 3:195881849-195881871 GCACCCAGACCCTGGCACGTGGG + Intronic
969010813 4:4060640-4060662 TGAGCCAGTCACTGGTAAGGGGG - Intergenic
969623580 4:8291285-8291307 GGAGTCAGATCCTGGCAGGGGGG - Intronic
969802631 4:9581346-9581368 TGAGCCAGTCACTGGTAAGGGGG + Intergenic
976555726 4:86449240-86449262 GGAGCAAGACATTTTCACGGAGG - Intronic
979362120 4:119776965-119776987 GGAGCAAGAGAGTGGCAGGGAGG + Intergenic
980284033 4:130758845-130758867 GGAGCCAGCCTCTGGCACTTAGG + Intergenic
985444246 4:190012302-190012324 GGAGCCAGAGACTGGAAAGGAGG - Intergenic
985879069 5:2624599-2624621 GGAGCCAGCCATGGGCAGGGAGG + Intergenic
987755052 5:22089341-22089363 GGATCCACACACTGGGATGGGGG + Intronic
988485973 5:31668364-31668386 CAAGCCAGACACTTGCCCGGTGG - Intronic
988554339 5:32223405-32223427 AGAGCCAGAACCAGGCACGGTGG + Intergenic
988711918 5:33787595-33787617 GGAGCCACATGCTGGCACAGAGG + Intronic
989125803 5:38051385-38051407 GGAGCCAGCCACAGGCAGGGAGG - Intergenic
993056370 5:82985176-82985198 TGAGGCAGACACTGTCACGGTGG - Intergenic
994472394 5:100224531-100224553 CGAGCCAGACACTGACACTGTGG - Intergenic
994525464 5:100901023-100901045 GGAGGCGGGCACTGGCGCGGCGG - Intronic
994572999 5:101537689-101537711 GGAGCAGGACACTGGCAGGCAGG - Intergenic
995388815 5:111616422-111616444 TAAGCCAGACACTGTCACAGGGG + Intergenic
998812128 5:145976937-145976959 TGAGCCAGACTCTGGGAAGGGGG - Intronic
1000020896 5:157318687-157318709 GGACCCAGACACTGGCAGTTGGG + Intronic
1002052318 5:176578039-176578061 GGACCCAGACACGGGCGCGTGGG + Exonic
1003385487 6:5663798-5663820 GGAGCCAGAGACAGACATGGAGG + Intronic
1003667324 6:8123559-8123581 GGAGACAAACACTGGCACCCTGG + Intergenic
1005311581 6:24564214-24564236 GGACACAGACACTGCCACTGTGG - Exonic
1007260845 6:40561968-40561990 TGAGCCAGACACTGGGGCCGTGG - Intronic
1010560354 6:77341325-77341347 TGAGCCAGACCCTGGAATGGGGG + Intergenic
1013065805 6:106683749-106683771 GGAGCCTGACAGTAGGACGGGGG + Intergenic
1016937092 6:149455537-149455559 GAGGGCAGACACTGGCAAGGTGG - Intronic
1018028345 6:159822720-159822742 GGGGCCCGGCACTGTCACGGCGG - Intergenic
1018363072 6:163092282-163092304 GGAGCTAGACATTGGGACAGTGG + Intronic
1018918146 6:168150749-168150771 GGAGCCAGGCAGGGGCAGGGAGG + Intergenic
1019605176 7:1906509-1906531 GGAGCCAGAGACTGGAGCGATGG - Intronic
1024511941 7:50211668-50211690 GGAGGCAGGCACTGGCACACTGG + Intergenic
1025976820 7:66376875-66376897 GGAGGCAGCCACTGGACCGGGGG + Intronic
1027361772 7:77416521-77416543 GGAGCCGGAGCCGGGCACGGCGG + Intergenic
1029440725 7:100585420-100585442 GGGGCCAGTCACTGGGAAGGGGG + Intronic
1031689059 7:124765780-124765802 GGAGCTAGTCACTGCCACAGCGG + Intergenic
1032075155 7:128832587-128832609 GGAGCCAGGCACCGCCACGGGGG - Intronic
1035069867 7:156135986-156136008 GGCGTCAGACAAAGGCACGGAGG - Intergenic
1036252350 8:7173300-7173322 TGAGCCAGTCACTGGTAAGGGGG - Intergenic
1036365144 8:8114160-8114182 TGAGCCAGTCACTGGTAAGGGGG + Intergenic
1039920728 8:41892464-41892486 GGAGCCAGGCACTCACAAGGAGG - Intronic
1044430340 8:92101506-92101528 GCAGCCAGACTAGGGCACGGTGG + Intronic
1045047673 8:98294411-98294433 GGATGCAGACACTGGCCCAGCGG - Intergenic
1046981032 8:120336594-120336616 GAAGCCAGACAGTGACACGAGGG - Intronic
1047762079 8:127961834-127961856 GGAGTCAGACTCGGGCAGGGGGG - Intergenic
1049233586 8:141496734-141496756 AGAACCTGACACTTGCACGGAGG - Intergenic
1049377457 8:142296020-142296042 AGAGGCAGTCACTGTCACGGGGG + Intronic
1049655705 8:143796044-143796066 CAAGCCAGAGACTGGCAGGGCGG + Intronic
1053314681 9:37041340-37041362 GAAGCCAGACTCTGGAAAGGGGG + Intergenic
1055554993 9:77464917-77464939 GAAGCCAGACACAGACACAGAGG + Intronic
1056207662 9:84335931-84335953 GGATGCAGACACTGGGACGGAGG - Intronic
1056435647 9:86573699-86573721 AGAGCAAGATACTGGCACAGAGG + Intergenic
1057857592 9:98613422-98613444 GGAGCAAGACACTGTCTCAGGGG + Intronic
1060482394 9:124024349-124024371 GGAGCCAGGCATTGGCAGGGTGG + Intronic
1061226391 9:129283338-129283360 GGTGCCCGTCACTGGCACTGGGG + Intergenic
1062149064 9:135008077-135008099 GGACCCAGACCCTGGCAGGGAGG - Intergenic
1062424466 9:136499644-136499666 AGAGCCGGACACTAGCTCGGCGG - Intronic
1062681523 9:137784666-137784688 GGAGCCAAGCCCTGGCAGGGGGG + Intronic
1186314802 X:8357469-8357491 GGAACCAGACAAGGGCACAGGGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1190873576 X:54444667-54444689 GGAGCCAGACAGAGGAACAGGGG - Exonic
1195696418 X:107670922-107670944 ATAGCCAGACACAGGCACAGTGG - Intergenic
1196528238 X:116751680-116751702 TCAGCCAGACACTGTCATGGGGG + Intergenic
1199569601 X:149254218-149254240 TGTGTCAGACACTGGCACAGAGG - Intergenic
1200128819 X:153830391-153830413 GGGGCCATACCCTGGCGCGGGGG + Exonic
1200167943 X:154050317-154050339 GGAGCCAGGCACTAGGAGGGCGG + Intronic
1201762373 Y:17554644-17554666 GGAGCCAGAGCCTGGAAAGGAGG - Intergenic
1201839179 Y:18351344-18351366 GGAGCCAGAGCCTGGAAAGGAGG + Intergenic