ID: 961422242

View in Genome Browser
Species Human (GRCh38)
Location 3:126815648-126815670
Sequence CTGTGGACACAGATGGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961422242 Original CRISPR CTGTGGACACAGATGGGGGG GGG (reversed) Intronic
900092124 1:925130-925152 CTGTGGCCCAAGCTGGGGGGAGG - Intronic
900095019 1:936697-936719 TGGGGGACACAGATGGGGGTGGG - Intronic
900286166 1:1901644-1901666 CTGTGGCCTCAGCTGGTGGGTGG + Intergenic
900344766 1:2205350-2205372 CCGAGGACACAGCTGGGGCGGGG - Intronic
900540817 1:3201819-3201841 CAGTGGACACAGAAGTGGGCGGG - Intronic
900790011 1:4673654-4673676 CTGTGGACACAGACGCGGCCAGG + Intronic
901687144 1:10949299-10949321 CTATGCACACAAATGGAGGGAGG - Intronic
901879050 1:12183197-12183219 CTGTGGACCCAGATGGGAGGCGG + Intronic
902786752 1:18737418-18737440 TTGTGAACACAGCTGGGAGGTGG - Intronic
902865253 1:19273731-19273753 GTGTGGACAGGGATGGGGTGGGG + Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
903782597 1:25831067-25831089 CTGAGGACACAAGTGGGAGGAGG - Intronic
904587119 1:31586698-31586720 CTCTGCCCACAGATGGGGAGAGG + Exonic
906074965 1:43045403-43045425 GTGTGGAAACAGATGGGGTATGG + Intergenic
906501294 1:46343138-46343160 CAGTGGGCAGGGATGGGGGGTGG - Intronic
908801461 1:67884995-67885017 CTGTGGACACTGAAGGGTGAGGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
913191327 1:116415860-116415882 CTGTGGTCACACTTGGGGGAGGG - Intergenic
914750829 1:150533991-150534013 CTGTGGACAAGGATGGCGTGGGG + Intergenic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
916125319 1:161565265-161565287 CTGTGGACATAGCAGGGGAGTGG + Intergenic
916499378 1:165373804-165373826 CTGGGGCCAGAGATGGTGGGAGG - Intergenic
916763014 1:167833860-167833882 CTGTGGCAAGAGATGGGAGGAGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
918136740 1:181680672-181680694 CTGAGGACAGGGATGGGGTGTGG - Intronic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
921069892 1:211649971-211649993 CTGGGGCCACAGATCTGGGGAGG - Intergenic
921893986 1:220380016-220380038 CTGTGGGCACAGCCTGGGGGTGG + Intergenic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
922504816 1:226120438-226120460 CTCTGGACACAGAGGGATGGAGG - Intergenic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
924385844 1:243497324-243497346 CTGTAGGCACGGGTGGGGGGGGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1062842181 10:680022-680044 CTGGGGACACTGAGGTGGGGAGG + Intronic
1063975020 10:11408160-11408182 CTGTGCACACAGAGTGGGGCAGG + Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067302973 10:45031342-45031364 GTGGGGGCACAGCTGGGGGGTGG - Intergenic
1067342825 10:45418702-45418724 CTGTGGGCACAGGTGTGGCGAGG + Intronic
1067787691 10:49262617-49262639 CTGGCCACACAGATGGGGTGAGG + Intergenic
1068956258 10:62820541-62820563 CTGTGGACACTCATGAGGGTGGG + Intronic
1069729715 10:70602786-70602808 CTGTGACCACAGCTGGGGGCGGG - Intergenic
1070346156 10:75543990-75544012 CGATGGACACAGGTGGGGTGAGG - Intronic
1071030426 10:81173744-81173766 CTGAGGACACACATGGGTTGTGG + Intergenic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074296636 10:112195351-112195373 ACGTGGACGGAGATGGGGGGTGG - Intronic
1074902013 10:117825236-117825258 TTGTGGCCACATATGGGAGGGGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076561117 10:131364897-131364919 CTTTGGACACAGGTGGGGTCAGG + Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1077044539 11:538575-538597 CTGTTGACAGAGGTGGTGGGTGG - Intronic
1077102405 11:828020-828042 CTGTGGGCTCAGTTGTGGGGAGG + Intronic
1078098157 11:8313049-8313071 CCGTGGATGCAGATGGGGCGGGG - Intergenic
1078665182 11:13318720-13318742 CTGTGGCCACATCTGGAGGGTGG + Intronic
1079032262 11:16994502-16994524 CTGCGGACATAGGTGGGGGCTGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081813137 11:45924299-45924321 CGGTGGACACAGCTGAGGGGAGG - Intronic
1082899322 11:58228424-58228446 CTGTGCACGCAGATGCTGGGTGG - Exonic
1083668307 11:64286890-64286912 CTGTGGTCCCGGGTGGGGGGCGG + Intronic
1083687527 11:64385478-64385500 CACTGGACACAGAGGGGAGGTGG + Intergenic
1083751072 11:64760862-64760884 CTATGCACACAAATGGGGTGAGG - Intergenic
1083775100 11:64890729-64890751 CTGAGCTCACAGATGGGGAGAGG + Intergenic
1084209954 11:67616256-67616278 ATGGGGACCCAGACGGGGGGCGG + Intergenic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084263946 11:67995578-67995600 CTGTGGGCACTGGGGGGGGGGGG - Intronic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1085046440 11:73356387-73356409 GAGTGGACACAGATGTGGGTGGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1091171793 11:133526254-133526276 CTGTGGGCACACATGGCAGGAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091408296 12:222531-222553 CTGTGCACACAGCTGGTGTGAGG + Exonic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091801541 12:3327772-3327794 CTGTGTTGACAGCTGGGGGGAGG + Intergenic
1092160001 12:6310837-6310859 CTGTGGGCACAGGTGAGCGGCGG + Intronic
1092659283 12:10722173-10722195 CCGTGGGCACAGAGAGGGGGAGG + Intronic
1093671070 12:21876691-21876713 AAGTAGACACAGATGAGGGGAGG + Intronic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1096470407 12:51871967-51871989 CGGGGGACAGGGATGGGGGGAGG - Intergenic
1097818121 12:64098157-64098179 TTGTTGATTCAGATGGGGGGTGG - Intronic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1103122174 12:118389383-118389405 CTGTGGAGACTGTTGGCGGGTGG + Intronic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103715931 12:122945324-122945346 CACTGGACACACATGGGAGGTGG - Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105659150 13:22473900-22473922 CTGTGTTGACTGATGGGGGGTGG - Intergenic
1106527285 13:30552497-30552519 GTGTGGACAGAGAGGGGGTGTGG - Intronic
1106795754 13:33203185-33203207 CTGTGAACACAGGTGTGTGGTGG - Intronic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1108418762 13:50227801-50227823 CTGTGGAAACTGCTGGTGGGTGG + Intronic
1111965320 13:94856261-94856283 ATGTGGACAGAGAGGAGGGGTGG + Intergenic
1112525201 13:100139961-100139983 TTGTTGACACATATGTGGGGTGG - Intronic
1112769444 13:102779994-102780016 GTGTGGTCACATATGGAGGGTGG + Intergenic
1112769750 13:102782235-102782257 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1113554224 13:111218469-111218491 GGGTGGACAGAGGTGGGGGGTGG + Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1115314378 14:32010748-32010770 CTGTGAACACACAGGGGAGGAGG - Intronic
1118477186 14:66128508-66128530 CTGGGTCCACAGATGGGTGGGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1122693849 14:103543544-103543566 CCTTGGCCACACATGGGGGGTGG - Intergenic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1126325531 15:47473135-47473157 CTGGGGACATAGATGAGAGGAGG + Intronic
1126702871 15:51383517-51383539 CTGTTGGGACAGATGCGGGGAGG + Intronic
1126739064 15:51759793-51759815 CTATTTACAAAGATGGGGGGAGG + Intronic
1127688155 15:61368663-61368685 CAGTTCACACAGATGTGGGGAGG - Intergenic
1129256816 15:74338482-74338504 CTCTGGACAGAGATAGGAGGAGG + Intronic
1129452835 15:75660239-75660261 TTGTGGCCACAGATGGGGGCTGG + Exonic
1129475394 15:75781596-75781618 GTGGGGACACAGATAGGAGGGGG - Intergenic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1131265298 15:90912020-90912042 CTGTGGGCACAGGAGGGGTGAGG - Intronic
1131883679 15:96886274-96886296 CTGTGAATACAAATGGGGAGTGG - Intergenic
1132089406 15:98935699-98935721 AGGTGGACACTGATGTGGGGAGG - Intronic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1134005933 16:10818769-10818791 CTGCGGACAGAGATAGTGGGAGG + Exonic
1135471860 16:22738180-22738202 CTGTGGATACAGAGAGGGGCTGG + Intergenic
1135810712 16:25584379-25584401 CTGTGGGGACTGTTGGGGGGTGG - Intergenic
1136164957 16:28447615-28447637 CTGGGGTCAGAGGTGGGGGGAGG - Intergenic
1136214355 16:28781542-28781564 CTGGGGTCAGAGGTGGGGGGAGG + Intergenic
1136259077 16:29061386-29061408 CTGGGGTCAGAGGTGGGGGGAGG + Intergenic
1138227544 16:55310389-55310411 CTGTGGCCACAGAATGGTGGGGG - Intergenic
1138270934 16:55695388-55695410 ATGTGGCCACAGAAGGTGGGTGG + Exonic
1138515070 16:57531403-57531425 CTGTGGACAAAGAAGGTGGATGG - Intronic
1139354116 16:66357161-66357183 CTGTGGAGGCTGATGGGGCGAGG - Intergenic
1139588193 16:67917739-67917761 CTGTGGGCACAGGCAGGGGGAGG + Intronic
1140598916 16:76451033-76451055 CTGGGGACACACAGGGGTGGTGG - Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141174689 16:81711028-81711050 CAGTGGTCACATGTGGGGGGTGG - Exonic
1141672627 16:85500681-85500703 CATGGGACACTGATGGGGGGAGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142385172 16:89759440-89759462 CTGTGGATACGGATGGGAAGGGG + Intronic
1142486846 17:253082-253104 CTGTGGACCCTGATCGGGGAAGG + Intronic
1143185095 17:5005128-5005150 ACGTGGACACAGATGTGGAGAGG + Intronic
1143617869 17:8064297-8064319 GTGTGGACACAGTGGGGAGGGGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG + Intergenic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1149413303 17:56431510-56431532 GTGTGGACATAGATATGGGGAGG - Intronic
1149561440 17:57610632-57610654 CTGTGGATGCTGATGGGAGGAGG + Intronic
1149781943 17:59404752-59404774 CTGGGGCCACAGATAGGGTGTGG - Intergenic
1150179575 17:63102627-63102649 CTGTGTCCAGAGGTGGGGGGAGG - Intronic
1150286549 17:63957624-63957646 CTGAGGACTCAGATGGTGTGGGG - Intronic
1150585663 17:66515649-66515671 CTTGGGAGACTGATGGGGGGAGG - Intronic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152168856 17:78729889-78729911 CTGTGGAAAGAGAGTGGGGGAGG + Intronic
1152332006 17:79678892-79678914 CTGTGGAGCCATATGGGGAGGGG - Intergenic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1159941421 18:74411850-74411872 CTGTGGACACAGACCTCGGGTGG - Intergenic
1160498306 18:79388056-79388078 CTGAGGACACAGGTGGGTGGGGG + Intergenic
1161314402 19:3611140-3611162 CTGTGCTCAGAGGTGGGGGGAGG + Exonic
1161332837 19:3696573-3696595 CAAAGGACACAGATGGGAGGAGG + Intronic
1161583952 19:5095106-5095128 CTGTGGACAGGGATGGGGACGGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1163242946 19:16075645-16075667 CTGGGGACAGGGATGGGCGGAGG + Intronic
1163453015 19:17390455-17390477 TGGAGGACACATATGGGGGGGGG - Intergenic
1163708827 19:18833105-18833127 CTGCGACCACAGATGGGAGGTGG - Intronic
1164776104 19:30854925-30854947 CTTTGTAGACAGATGCGGGGTGG - Intergenic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166361612 19:42254967-42254989 CGGCGGACACAGGTGGGGGCGGG - Exonic
1166381334 19:42356793-42356815 CGGTGGACACAGATGCTGGCGGG + Exonic
1166859010 19:45798886-45798908 GGGTGGACACAGATTGGGTGGGG + Intronic
1166983364 19:46645091-46645113 CTGTGGATTCAGGTGGGGGCTGG + Intergenic
1167331991 19:48861693-48861715 CTGGGGAGAGAGATGGGAGGAGG + Intronic
1167565046 19:50250742-50250764 CACTGGCTACAGATGGGGGGAGG + Intronic
1167643423 19:50694129-50694151 AGATGGACACAGTTGGGGGGTGG + Intronic
1167672329 19:50860363-50860385 CTGAGGACACAGATAGGATGGGG + Exonic
1167988023 19:53334728-53334750 TTTTTGACAGAGATGGGGGGGGG - Intronic
925413930 2:3656373-3656395 CTGTGGACCCATCTGTGGGGCGG - Intergenic
925851084 2:8082772-8082794 CTGTGGCCAGAGTTGGGGTGGGG + Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
928099330 2:28426444-28426466 CGGAGGAGACAGATGCGGGGCGG - Intergenic
928979994 2:37127635-37127657 CTGGGGTCACAGTTGTGGGGAGG - Intronic
929455372 2:42061289-42061311 CTGTTGTCATGGATGGGGGGTGG - Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
931866388 2:66416698-66416720 CTGTGGACTGAGATGAGGGTAGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932709430 2:74051065-74051087 TGGTGAACACAGATGGGGAGAGG + Intronic
932738877 2:74276498-74276520 CCATGGACAGAGATGGGGTGTGG + Intronic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934554749 2:95281394-95281416 CTGGGGAGAGAGGTGGGGGGCGG + Intronic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
936827460 2:116599753-116599775 CTGTGGACCCAAATGGAGTGAGG - Intergenic
937890275 2:126933373-126933395 CGGTGGGAACAGATGGGGAGAGG - Intergenic
938006474 2:127791005-127791027 CTGTTGAGAGAGATGGGGAGAGG - Intronic
938119637 2:128624458-128624480 CTGTGGCCTGAGGTGGGGGGGGG + Intergenic
941347670 2:164390061-164390083 TTTCGGACACAGATGGGAGGTGG + Intergenic
943688498 2:190844239-190844261 CTGTGAACAAACATGGGAGGGGG + Intergenic
945119790 2:206444912-206444934 CTGTGGACTCAGAGAAGGGGTGG + Intronic
946238471 2:218340006-218340028 CTGGGGACAGAGATGGGCTGTGG - Intronic
946456005 2:219826680-219826702 CTCTGGCCACTGATGGGTGGGGG - Intergenic
947746007 2:232507696-232507718 ATGTGCACACACATGGGGGAAGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
949003290 2:241630125-241630147 CAGTGCACACAGATTGGGCGAGG - Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1170174547 20:13454269-13454291 CTGTGGAGAATGATGGGGTGGGG + Intronic
1170724683 20:18915878-18915900 GTGTGGAGAGAGATGGGAGGAGG - Intergenic
1170740178 20:19049325-19049347 CTGCTGCCACACATGGGGGGCGG - Intergenic
1171157377 20:22888780-22888802 CAATGGAAACAGATTGGGGGTGG + Intergenic
1171975384 20:31591356-31591378 CTGAGGACACAGAGGTGTGGTGG - Intergenic
1172119551 20:32589720-32589742 CTGTGGTCAGAGCTGGGAGGGGG - Intronic
1172447916 20:35002761-35002783 CTTGGCTCACAGATGGGGGGTGG + Exonic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1173082904 20:39886808-39886830 ATGTGGAAACAGATTGGAGGAGG - Intergenic
1173093602 20:40001850-40001872 TTGGGGACATGGATGGGGGGAGG - Intergenic
1173635539 20:44553772-44553794 CTGTGCACACGGGTGAGGGGAGG + Intronic
1174038465 20:47682776-47682798 CTGTGGAAACAGGTGTGGTGGGG - Intronic
1175019136 20:55825902-55825924 TGGTGGTCACAGATTGGGGGCGG + Intergenic
1175199296 20:57266740-57266762 CACTGGGCACAGCTGGGGGGAGG - Intergenic
1175642920 20:60646403-60646425 CTGTGGACAGAGAGGGTGGCTGG + Intergenic
1175862882 20:62159562-62159584 CAGAGGATAGAGATGGGGGGAGG - Intronic
1175887432 20:62300457-62300479 CTGTGGCCACAGAGTGGGTGGGG - Intergenic
1176056245 20:63150737-63150759 ACGTGGGCACAGATGAGGGGTGG - Intergenic
1176062997 20:63180296-63180318 CTGGGGCCAGAGATGGGGGCTGG + Intergenic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1176199841 20:63855301-63855323 CTGTGGCCACAGCTGGGTGGTGG - Intergenic
1176521826 21:7830053-7830075 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1178655846 21:34460065-34460087 GTGTGGCCACAGCTGGGGTGCGG - Intergenic
1178940582 21:36901963-36901985 CTGTGGACAGCAGTGGGGGGCGG + Intronic
1179384081 21:40925529-40925551 CTGTGAACACAGGTGAGGGGTGG - Intergenic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179721626 21:43319442-43319464 CTGTACACACAGAGGGGGTGGGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180130954 21:45826876-45826898 CTGTGGCCACAGTTTTGGGGAGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180654975 22:17412753-17412775 GTGTGGAGACAGGTGGCGGGCGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1183367215 22:37413083-37413105 CTGTGGCCACAGACGGGGTGAGG + Intronic
1183548736 22:38468985-38469007 CGGTGGACAAAGATGGCTGGAGG - Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184112075 22:42401433-42401455 CTGCTGCCACAGATGCGGGGTGG + Intronic
1184233630 22:43171559-43171581 ATGTGGACACAGAGGGGGATGGG - Intronic
1184472458 22:44703317-44703339 CAGTGGACACTGTTCGGGGGAGG + Intronic
1184472464 22:44703340-44703362 CTGTGGACACTGTTCGGGGGAGG + Intronic
1184742640 22:46438000-46438022 CTTTGGACCCAGGTGGGGGCTGG + Intronic
1203293212 22_KI270736v1_random:15401-15423 CTCTGGACACTGCTGGTGGGAGG + Intergenic
949454206 3:4221292-4221314 ATGTGGACACTGATGGATGGAGG + Intronic
949871880 3:8596071-8596093 CTGTGATCGCAGATGTGGGGTGG + Intergenic
949977640 3:9475665-9475687 CTGTGGACACAGGGTGGGCGGGG - Exonic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950473318 3:13199722-13199744 CGGAGGACTCAGATGGGGGCAGG - Intergenic
951292072 3:20883473-20883495 CTGTGGTAAAAGTTGGGGGGTGG - Intergenic
952515797 3:34103902-34103924 CAGTGGACTCAGAAGTGGGGAGG + Intergenic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953117482 3:40007466-40007488 CTGTGCACACTGATGAGGAGAGG - Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953751327 3:45610630-45610652 CTGTTGGCAGAGCTGGGGGGTGG - Intronic
953927837 3:46991377-46991399 GTGTGGACAGAGATGGGCAGTGG - Intronic
954427710 3:50452118-50452140 CTGTGGTCACAGAGGTGGAGTGG + Intronic
955029594 3:55203514-55203536 CTGAGGAAGCAGATGGGGTGTGG - Intergenic
956163722 3:66380769-66380791 CTCTGGACACAGGCTGGGGGTGG + Exonic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
958935187 3:100249145-100249167 ATGAGGTCACAGATGGAGGGAGG + Intergenic
960478265 3:118158048-118158070 CTGTGGAGGCAGCTGGGAGGGGG - Intergenic
960539212 3:118845898-118845920 CTCTGGACACTGTTGTGGGGTGG + Intergenic
961193377 3:124981181-124981203 CTGTGGGGACAGATGAGGGGAGG - Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961674773 3:128558035-128558057 CGGTGGAGCCAGATGGGGTGGGG - Intergenic
961754096 3:129116930-129116952 CTGAGGACACTGAGGTGGGGAGG + Intronic
961790274 3:129371085-129371107 CGGTTGACTCAGATGGGGGCAGG + Intergenic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962739687 3:138354088-138354110 CTGTGCACAAAGATGTGGTGAGG + Intronic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
968657025 4:1783088-1783110 CAATGGAGACAGGTGGGGGGGGG + Intergenic
968793531 4:2686607-2686629 CTCTGAACACACATGGGTGGTGG + Intronic
969022465 4:4147488-4147510 CTGTGGGCACTGGGGGGGGGGGG - Intergenic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969868675 4:10091755-10091777 ATGTTGACACAGATAGGAGGTGG - Intronic
972220564 4:36949943-36949965 CTGTGAACTCAGCTGGGAGGAGG - Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
974103258 4:57440475-57440497 CTGGGGACACACAGGAGGGGAGG - Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976098781 4:81538131-81538153 CTGTGGAGACTGTTGTGGGGTGG + Intronic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
979264073 4:118681443-118681465 CTGTAGACACATATGGCCGGTGG + Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
980174136 4:129324658-129324680 CTTTAGAGAGAGATGGGGGGTGG + Intergenic
981028730 4:140102468-140102490 GTGAGGACACAGATAGGAGGCGG - Intronic
983534010 4:168838344-168838366 CTGGGGGCACAGATGAGGGCTGG + Intronic
984124877 4:175795627-175795649 CTGTGGTCCCAGCTGGGAGGAGG + Intronic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985030819 4:185787651-185787673 GGGTGGAGACAGATGGGAGGAGG - Intronic
986485333 5:8230085-8230107 CTGGGGACCGAGATGAGGGGTGG + Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
990332227 5:54739512-54739534 CAGTGGAGAGAGATGGGTGGAGG - Intergenic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
992066623 5:73115630-73115652 CTGTGGCCACTGTTGAGGGGGGG + Intergenic
997197350 5:131988905-131988927 CTGTGGAGACACATGAGGCGGGG + Intronic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998370095 5:141655399-141655421 CGCTGGACACAGGTGGGGTGGGG + Exonic
999010596 5:148034425-148034447 CTGTGGACAAGGGTTGGGGGGGG - Intronic
999897034 5:156045840-156045862 CTGTGGCTACAGTTGGAGGGGGG - Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000581086 5:163035898-163035920 CTGTGGAAACAGCTGGGAAGGGG + Intergenic
1001777187 5:174337633-174337655 TTCTGGAAACAGAAGGGGGGAGG - Intergenic
1002078500 5:176723844-176723866 CTGTGTACACAGAGAGGGGCTGG - Intergenic
1002078741 5:176725510-176725532 ATGTGCACACAGCTGGGCGGGGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002335991 5:178478624-178478646 CTGTGGACACAGGAAGGGAGGGG - Intronic
1002847777 6:963285-963307 CTATGGACACAGAGAGGAGGAGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003013906 6:2452410-2452432 CAGCTGACACAGATGGTGGGAGG + Intergenic
1004074732 6:12334623-12334645 CTGTGGCCAGAGCTGAGGGGAGG - Intergenic
1004455531 6:15788315-15788337 CTGTGGACAGTGACGGGGGCTGG - Intergenic
1005790831 6:29298543-29298565 CTTTGGATACAGATGGTAGGTGG - Intergenic
1006443043 6:34063827-34063849 CTGTCTCCCCAGATGGGGGGAGG - Intronic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012399819 6:98834267-98834289 CCTGGGAGACAGATGGGGGGCGG + Intergenic
1013957861 6:115861395-115861417 CTGTGGACTCATATGGTGGAAGG + Intergenic
1015804104 6:137091404-137091426 CTGTGGACAGAGAGGAGGGTAGG + Intergenic
1015928719 6:138335197-138335219 CTGTGGCCACAGCAGGTGGGCGG + Intronic
1017751365 6:157492814-157492836 GTGGGGACCCAGATGGGAGGAGG + Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018133625 6:160756510-160756532 CTGGGGACACAAATGGGCTGGGG - Intergenic
1018681394 6:166268845-166268867 CTGTGGCCTCAGGTGGGGTGGGG - Intergenic
1018951753 6:168382861-168382883 CTGTGACCACAGCTGGGTGGGGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020406283 7:7839331-7839353 CTGTGGTCCCAGCTTGGGGGAGG - Intronic
1022010549 7:26304704-26304726 CTGTGAACACAAATGGGGATGGG + Intronic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025789576 7:64676685-64676707 CTGTGGACACATATGGGGGGAGG - Intronic
1026982056 7:74532680-74532702 CTGTGGATCCAGATGTGTGGGGG + Intronic
1027133297 7:75606601-75606623 CTCTGGACCTAGATGAGGGGAGG + Intronic
1029496425 7:100897358-100897380 CAGTGGGCACAGATGGCGAGGGG - Intergenic
1029926581 7:104325807-104325829 CTAAGGACAAAGTTGGGGGGTGG + Intergenic
1031799404 7:126223599-126223621 CTGTGGCCACTGCTGGGCGGGGG + Intergenic
1032200611 7:129820051-129820073 CTGGGTACACAGAAGTGGGGAGG + Intergenic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1034240888 7:149609877-149609899 CTGTGGACAGAGATGCTGGTGGG - Intergenic
1034707505 7:153158663-153158685 CTAGGGACAGAGATGGGGGTTGG + Intergenic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1035617033 8:1009741-1009763 CTGTGGAGACAAATGAGAGGTGG - Intergenic
1036425946 8:8645449-8645471 CGGTGGACACAGACGCAGGGAGG + Intergenic
1036463248 8:8972969-8972991 CTTTGAACATAGATTGGGGGAGG + Intergenic
1037084125 8:14826087-14826109 TTGGGGACATAGGTGGGGGGAGG - Intronic
1037949279 8:23008118-23008140 CTGAGGACACAAAGGGGGGAAGG + Intronic
1038425199 8:27460212-27460234 GTCTGGACAGAGTTGGGGGGAGG + Exonic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1040101526 8:43511171-43511193 CTGTGGGCACACATGCAGGGAGG + Intergenic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049092913 8:140530295-140530317 CTGAGCACAAAGGTGGGGGGGGG + Intergenic
1049174713 8:141184778-141184800 AGGTGGACACAGAGGGAGGGAGG - Intronic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049360835 8:142211905-142211927 CTGTGCTCACAGCTGGGGAGGGG - Intergenic
1050266663 9:3897859-3897881 CTCTGGAATCAGATGGGGGTGGG + Intronic
1051231211 9:14957507-14957529 CTGTGGGGTCAAATGGGGGGTGG - Intergenic
1051877282 9:21805912-21805934 CTGAGGAGAGAGATGGGGGTAGG + Intronic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1056451301 9:86719531-86719553 CACTGGACACACATGGGGTGTGG + Intergenic
1057019650 9:91686592-91686614 CTATGGTCACTGATGGGGGTAGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060819256 9:126651987-126652009 TAGTGGCCAGAGATGGGGGGGGG + Intronic
1060847598 9:126849609-126849631 CTGTGATCAGAGTTGGGGGGTGG + Intergenic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061776670 9:132970272-132970294 CTGTGGCTACTGATGGGGAGAGG - Intronic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062596030 9:137299999-137300021 TTGAGGACACAGGTGGGTGGAGG - Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1186410378 X:9341046-9341068 CCGTGGACACAGACGGGTGTAGG - Intergenic
1186442880 X:9601193-9601215 ATGTGGACAGAGATGGGAGCTGG - Intronic
1186704578 X:12128019-12128041 CTGTGGAAACAGCTGGGAGGTGG - Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1188316110 X:28675685-28675707 CTGTGGAGAAATATGGGGGTGGG + Intronic
1194769707 X:97886720-97886742 CTGGGGAAACAAATGGGGTGAGG - Intergenic
1195306138 X:103585743-103585765 GTGTGGACAGAGATGGCGGTGGG + Intronic
1195465717 X:105176680-105176702 CTGTGGGGAGAGAAGGGGGGTGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1197615523 X:128686301-128686323 CTCTGGAGACAGTTGTGGGGTGG - Intergenic
1199193342 X:144997618-144997640 CTGTGGAAGCAGCTGGGGTGAGG + Intergenic
1199617612 X:149670471-149670493 CTGTGGACCCAGCTGGGGAGAGG - Intergenic
1199625031 X:149732778-149732800 CTGTGGACCCAGCTGGGGAGAGG + Intergenic
1199649867 X:149940038-149940060 CTGTGGGAGCAGATGGGGCGGGG + Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic
1201767480 Y:17585844-17585866 ATGTGAACACAGATGGGCTGGGG - Intergenic
1201834073 Y:18320141-18320163 ATGTGAACACAGATGGGCTGGGG + Intergenic