ID: 961424842

View in Genome Browser
Species Human (GRCh38)
Location 3:126836908-126836930
Sequence CTGCTCTTCCTGAGGAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961424838_961424842 2 Left 961424838 3:126836883-126836905 CCAGGAGCAAGTGCGGGGGACTG 0: 1
1: 0
2: 2
3: 10
4: 124
Right 961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG 0: 1
1: 0
2: 5
3: 23
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961424842 Original CRISPR CTGCTCTTCCTGAGGAGAAA TGG Intronic
900956406 1:5888780-5888802 CTGCACTTCCTGAAGACAGAGGG - Intronic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
902170849 1:14609883-14609905 CTGATCTTAGTGTGGAGAAAGGG - Intronic
902482913 1:16720915-16720937 CTTCTCTTCCTGAGGAGACAGGG + Intergenic
902760083 1:18575380-18575402 CTCCTTTTCATGAGCAGAAAGGG - Intergenic
903467294 1:23560456-23560478 CTGCCCTTCCATAGCAGAAAGGG - Intergenic
904570898 1:31464171-31464193 CTACTCTCCCTGAGGAGGATGGG - Intergenic
904860418 1:33533471-33533493 CAGCACTTCCTGAGGGGTAAAGG + Intronic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
906602748 1:47143972-47143994 CTTCTCTGCCTGAGGAGTCAGGG - Intronic
907792032 1:57676262-57676284 CTTCTCTTCCTGAATGGAAAGGG - Intronic
909336507 1:74480854-74480876 CTGCTCTCCCTAAGCAGAAATGG - Exonic
910082997 1:83364199-83364221 CAACTCTTGCTGAGAAGAAATGG - Intergenic
910263859 1:85317308-85317330 CTGCTCCTCCAGAGGAGAAAGGG - Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
911865453 1:103014538-103014560 CTGAGCTTCCTGAGCAGAGATGG + Exonic
912457428 1:109807277-109807299 CTTTTCTACCTGAGGAGAGAGGG - Intergenic
914213514 1:145603590-145603612 CTGCTCTGCCTGAGCACAGACGG + Intergenic
914746724 1:150506718-150506740 CTGCTCATCCTGAGGAGACAAGG - Intronic
915791002 1:158671349-158671371 CTTCTCTTCCTGGGCAGTAAAGG + Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918203305 1:182287482-182287504 CTGGATTTCCTGTGGAGAAATGG - Intergenic
918203472 1:182288744-182288766 CTGGATTTCCTGTGGAGAAATGG + Intergenic
920451194 1:206062420-206062442 CTGCCCCTCCTGAGGCAAAAGGG + Intronic
920974779 1:210775536-210775558 CTCCTTTTCCTAAGGAGAGAAGG + Exonic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923203906 1:231739569-231739591 CGTCTCTTCCTGTGCAGAAAAGG - Intronic
923254151 1:232205497-232205519 GTGCCCTTCCTGAGCAGAAGTGG + Intergenic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1067901722 10:50248607-50248629 CTGCTGTACCTGAGAAGAAATGG - Exonic
1068828108 10:61462449-61462471 GTGCTCTTACAAAGGAGAAAAGG - Intergenic
1069074329 10:64022071-64022093 CTCCTTTATCTGAGGAGAAATGG - Intergenic
1070025064 10:72624630-72624652 CTTGTGTGCCTGAGGAGAAAGGG - Intronic
1070658665 10:78289282-78289304 CTGCTCTTCTCCAGGTGAAATGG + Intergenic
1070658808 10:78290204-78290226 CTGCTCTTCCTGGGAATAAGAGG - Intergenic
1071188640 10:83075265-83075287 CTGTTCTTTCTAATGAGAAATGG + Intergenic
1072458354 10:95596956-95596978 CTGCCCTGCCTAAGAAGAAAAGG - Intergenic
1073483546 10:103802318-103802340 CTGGTCTTCTGGATGAGAAACGG + Intronic
1074214972 10:111375282-111375304 TTGGCTTTCCTGAGGAGAAAAGG + Intergenic
1074397260 10:113108276-113108298 CTGCTCCGCCTGAGGTGAAGTGG + Intronic
1074606551 10:114975192-114975214 ATGCCCTTCCTGAAGACAAATGG + Exonic
1075778786 10:125003950-125003972 CTGCGCTGGGTGAGGAGAAATGG + Intronic
1075880323 10:125845605-125845627 CTGCTCTTATTGGGAAGAAAGGG - Intronic
1076224403 10:128762365-128762387 CTCCTCTTCCTGAGGGGACAAGG + Intergenic
1078521399 11:12066805-12066827 CACAGCTTCCTGAGGAGAAATGG - Intergenic
1078893323 11:15576990-15577012 CTGCTGTTCCTGAGATGCAATGG - Intergenic
1081245409 11:40760319-40760341 CTGCTCTTCGTGCCGAAAAAGGG + Intronic
1081589691 11:44412851-44412873 CTGGTCTTCAGTAGGAGAAAAGG + Intergenic
1082028125 11:47587296-47587318 CTGCTCCTCCTCAGCAGTAAGGG - Intronic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083109074 11:60387305-60387327 CTGCTTTGCCTGGGGAGTAAGGG - Intronic
1083222127 11:61259287-61259309 CTTTTCTTCCAGAGGAGACAGGG + Exonic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1083436958 11:62649219-62649241 CTGCCATTCCTGCGGAGAAACGG - Exonic
1084634449 11:70381533-70381555 CTGCTCCTCCCCAGGAGAAAAGG + Intronic
1085396098 11:76207928-76207950 CTGCTCCTCCCGAGGGGAGAGGG - Intronic
1085524818 11:77158024-77158046 CTGCTCTTCATGGGAAGAAGGGG + Intronic
1085806361 11:79640599-79640621 GTTCTCTTCCTCAGTAGAAAGGG - Intergenic
1086126865 11:83357576-83357598 CTTTTCTTACTGAGGAGGAAGGG + Intergenic
1086132066 11:83411196-83411218 TTGCACTTCATGAGGAGAAAGGG - Intergenic
1086222331 11:84463333-84463355 CTGATATTCCTGAGGAGGATGGG - Intronic
1088189477 11:107211930-107211952 CTGCTCTACCTGTGTAGACATGG + Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1091238594 11:134037498-134037520 CGTCTTTTCCTGAGGGGAAACGG - Intergenic
1091344558 11:134844112-134844134 CTGCTGCTTCTGGGGAGAAATGG - Intergenic
1091972306 12:4797610-4797632 TTTCCCTTCCTGAGGAGCAAAGG - Intronic
1096427308 12:51514961-51514983 CTGATCCTTCTGAAGAGAAAAGG + Exonic
1097059330 12:56270730-56270752 CTGAGATTCCTCAGGAGAAAAGG + Exonic
1097260421 12:57716676-57716698 CTGCTCCTGACGAGGAGAAAAGG - Exonic
1097325759 12:58275202-58275224 CTGCTCTGCCTGAAGATTAAAGG - Intergenic
1098068832 12:66649865-66649887 CTGCTCTTCCACAGAAGGAAAGG - Intronic
1100882066 12:99030211-99030233 CTGCACTTGCTGGGGAGCAAAGG - Intronic
1104890814 12:132139290-132139312 GCGCTCTTCCTGTGGAGGAAAGG + Exonic
1106243133 13:27925707-27925729 GTTCTCTTCCTCAGAAGAAAGGG - Exonic
1106652970 13:31711695-31711717 CTGCTACTCATGAGGAGCAATGG - Intergenic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111646687 13:91040371-91040393 CTGCTCATCTTGAAGAGAATGGG - Intergenic
1112737012 13:102431444-102431466 CTGATCTTGGTGAGGAGACACGG + Intergenic
1112895864 13:104298978-104299000 CTGCTCTTCCTGCTGGGAAAAGG + Intergenic
1113296433 13:108964071-108964093 CTGCTCTGCCTGAGACGCAATGG + Intronic
1113306746 13:109087698-109087720 CTCCTCTTACTGAAGAGAGAAGG - Intronic
1113443522 13:110347789-110347811 TTGAGCTGCCTGAGGAGAAATGG + Intronic
1114508662 14:23237985-23238007 CAGCTCTTCGTGAGGAGAACTGG + Intronic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1116666622 14:47784351-47784373 TTTCTCTACGTGAGGAGAAAAGG + Intergenic
1116910485 14:50458225-50458247 CTGCTCTTCCATTAGAGAAAGGG - Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1118163984 14:63317851-63317873 CTGCTCTTCCGGAGAGGGAAAGG + Intronic
1119017689 14:71076398-71076420 CTGCTCTTCCCGAAGAGCAAAGG + Exonic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1121433970 14:93906701-93906723 CTCCTTTTCCTGAGTAGAACTGG - Intergenic
1121537209 14:94699152-94699174 CTGCTCTTCCTCAGGTGGATGGG - Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123879684 15:24665699-24665721 CTGATCTTCTTTAGAAGAAATGG - Intergenic
1123904301 15:24906885-24906907 CTGCTGTCCCTTAGGAGAAGAGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1125593426 15:40869948-40869970 CTGGTTATCATGAGGAGAAATGG + Intergenic
1125966097 15:43876730-43876752 CTGCTCTTCTTGAGGGGGCATGG + Intronic
1126606795 15:50486175-50486197 CCCCTCTTTCTGTGGAGAAATGG - Intronic
1127709538 15:61582261-61582283 CTGCTTTTCCTGTGGTGAACAGG - Intergenic
1128231388 15:66037854-66037876 CTCCTCTTCCAGAGAAGAAGTGG - Intronic
1128816685 15:70615077-70615099 CTTCTCTTGCTCAGGGGAAACGG + Intergenic
1129273064 15:74429448-74429470 CTGCTCTTCCTCTGCAGAGATGG - Intronic
1129374683 15:75121612-75121634 CAGCCCTGACTGAGGAGAAAAGG + Intergenic
1131419241 15:92290318-92290340 TTGCTCTTCCTGAGAAAAAGAGG + Intergenic
1131505915 15:93019022-93019044 ATTCTTTTCCTTAGGAGAAAAGG + Intronic
1133315369 16:4880308-4880330 CTGCACCTCCTGAGCAGCAAGGG - Exonic
1133778635 16:8918969-8918991 CTGATATACCTGAGAAGAAAGGG + Intronic
1133959774 16:10483368-10483390 CACCTCTTCCTGAGAAGAGATGG + Exonic
1134015805 16:10887437-10887459 CTTCTCCTCCTGAGGAATAATGG - Intronic
1138294057 16:55871858-55871880 CTCCTCTGCCTGAGCAGAAGAGG + Intronic
1138985636 16:62324873-62324895 CTGCTCTTACTGAGTGGAACGGG + Intergenic
1139447313 16:67005881-67005903 CTGTTCTTCCTTAGGAACAAGGG + Intronic
1140277705 16:73525681-73525703 CTGCTGGTCCTGAGGGGAACAGG - Intergenic
1141461291 16:84180075-84180097 CTGTCCTTCCTCAGGAGAAGGGG - Exonic
1142233454 16:88910576-88910598 CAGCTCTTCCTGAGGTGGGAGGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143270757 17:5672884-5672906 CTCCTCTACCAGGGGAGAAATGG + Intergenic
1143745572 17:8991735-8991757 TTGCTCCTCCAGAGGAGAGAGGG + Intergenic
1145898363 17:28473948-28473970 CTGCTCCTCCTGAGGACTGAGGG + Intronic
1146289064 17:31595200-31595222 CTGCTCTTGCTCAGGAGGAGGGG - Intergenic
1146470399 17:33119897-33119919 CTACTTTTTCTGGGGAGAAAGGG + Intronic
1146706044 17:35001505-35001527 TTGCTCTGCCTCAGGAGAATGGG - Intronic
1147264808 17:39228087-39228109 CTGCTCTTTGGGAGGAGACAGGG - Intergenic
1147566412 17:41538999-41539021 CTGCTCTTCCTTGGGGCAAAGGG - Intergenic
1148795086 17:50193039-50193061 GGGCTCTCCCTGTGGAGAAAGGG + Exonic
1150210134 17:63437345-63437367 CTGATCTTCCTGCAGGGAAATGG - Exonic
1150837575 17:68578484-68578506 CTGGTCATGCTGAGGAGGAAAGG - Intronic
1151382445 17:73735147-73735169 CTGCTCTACCTGAGGAGACATGG - Intergenic
1151591423 17:75047180-75047202 CGGCTCTCCCTGCCGAGAAATGG + Intronic
1152541755 17:80980120-80980142 CTGCTCCCCCTGGGGAGAAGGGG - Intergenic
1155277686 18:24204762-24204784 CTCCTCTGTCTTAGGAGAAAGGG - Intronic
1155947838 18:31876546-31876568 TTGATCTTTCTGAGGAGAACTGG - Intronic
1156454401 18:37284943-37284965 CTCCTCTGCCTGGGGGGAAAAGG - Intronic
1156638764 18:39064057-39064079 TTCCTCTTCATGATGAGAAATGG + Intergenic
1157300626 18:46476487-46476509 CTGATTTTCCTGTAGAGAAAAGG - Intergenic
1158306471 18:56111406-56111428 ATGCTCTTGCTGATGGGAAACGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160423878 18:78767462-78767484 CTGCTCTTCAGGTGGAGATATGG - Intergenic
1160973935 19:1783262-1783284 CTTCTCCTCCTGAAGAGCAAAGG + Exonic
1163494769 19:17639900-17639922 GCGCTCTTTCTGAGGAGGAAGGG + Exonic
1163593245 19:18205745-18205767 TTTCTCTTCCTGGGGAAAAAAGG - Intergenic
1163605792 19:18274599-18274621 CGGCTCATCCTGAGTACAAAGGG + Intergenic
1163923789 19:20319628-20319650 CAACTCTTCCTGAGGGTAAAGGG + Intergenic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164403594 19:27921376-27921398 TTCCTCAGCCTGAGGAGAAAGGG + Intergenic
1166545367 19:43631494-43631516 TTTCTTTTACTGAGGAGAAAGGG - Intronic
925493360 2:4420115-4420137 CATCCCTTCATGAGGAGAAAGGG + Intergenic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
925619240 2:5774675-5774697 CTGCTCTTCCTCAGGTGGGAGGG + Intergenic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
927392045 2:22606654-22606676 CTGCTCATCCTTTGGAGAGATGG + Intergenic
927717078 2:25359909-25359931 CTGATTTTCCTGAGCAGAACTGG + Intergenic
929627952 2:43429490-43429512 CTTGTCTACCTGAGCAGAAATGG - Intronic
933390726 2:81663409-81663431 CTCATTTACCTGAGGAGAAAAGG + Intergenic
933500439 2:83104138-83104160 CTGCCTTTCCTGAGGAGGAGGGG - Intergenic
934164314 2:89280527-89280549 CTGCCCTCACTGAGGAGAGAGGG + Intergenic
934202960 2:89901997-89902019 CTGCCCTCACTGAGGAGAGAGGG - Intergenic
935553079 2:104479018-104479040 CTGCTCATGTTGGGGAGAAATGG - Intergenic
935810593 2:106793459-106793481 CTACTCTGCTTGGGGAGAAAGGG + Intergenic
937812081 2:126210591-126210613 CTTCTATCCCTGAGGAGACAAGG - Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
944128333 2:196318850-196318872 TTCCTCCTCCTGAGAAGAAAAGG + Exonic
944160705 2:196656246-196656268 ATCCTCTCCCTGAGGAGAGAAGG - Intronic
945791630 2:214311719-214311741 ATCTTCTTTCTGAGGAGAAATGG + Intronic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
1170220517 20:13936888-13936910 CTGCTCTTCCTGAGAACTGAAGG - Intronic
1172008033 20:31830805-31830827 GTTCTCTGGCTGAGGAGAAAGGG - Exonic
1172447783 20:35002163-35002185 CTCCTTGTGCTGAGGAGAAAGGG - Exonic
1172972429 20:38883237-38883259 CTGCTCCTCCTCTGGGGAAACGG - Intronic
1173287377 20:41685434-41685456 AGTCTCTTCTTGAGGAGAAATGG - Intergenic
1173811905 20:45960874-45960896 CTCTTCTTCCTGTGGGGAAAAGG + Exonic
1174740190 20:53005424-53005446 TTCCTGTTCCAGAGGAGAAATGG + Intronic
1175349996 20:58310489-58310511 TAACTCTTCCTGTGGAGAAAAGG + Intronic
1175951424 20:62585606-62585628 CTGAGCTTCCTGAGGAGCAGTGG - Intergenic
1176265844 20:64208943-64208965 CTGCTCCCTCTGAGGAGCAAGGG - Intronic
1179889800 21:44329811-44329833 CTCCTCATTCTGTGGAGAAACGG + Intronic
1182000999 22:26919706-26919728 CTGTTCTTCCTCTGGAGAACAGG - Intergenic
1182161852 22:28130298-28130320 CTGCTTTTCCTTGGGAGCAAAGG - Intronic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1185049320 22:48545614-48545636 CTGCTATTCCTGGGCAGACAGGG + Intronic
949588705 3:5469794-5469816 CTTCTCCACCTGAGCAGAAATGG - Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950549264 3:13656310-13656332 TTTCTCTTCCTGGGAAGAAAAGG + Intergenic
950635171 3:14309017-14309039 CTGCTCTTCCTGGGGTGGAAGGG - Intergenic
950900788 3:16495651-16495673 CTGCCCTACCTGAAGGGAAAGGG + Intronic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
951013864 3:17707754-17707776 CTGGGCTTCCTCTGGAGAAAAGG - Intronic
951658305 3:25033903-25033925 CAACTATTCATGAGGAGAAAAGG - Intergenic
952387561 3:32853624-32853646 CCCTTTTTCCTGAGGAGAAATGG + Intronic
952569586 3:34698528-34698550 CTGCCCTGCCTGAGGAGATGTGG + Intergenic
953383801 3:42493342-42493364 CTACTCTCCCTGGGGAGACAAGG - Intronic
954293449 3:49661691-49661713 CTGCTATGCCAGAGGAGAAGAGG + Exonic
959942626 3:112095499-112095521 CTGCTCTTTGTGAGGTGAAGAGG - Intronic
960737496 3:120796779-120796801 CTACTCTCTCTGGGGAGAAATGG - Intergenic
961335764 3:126179081-126179103 CTGCTCTTTCTGGGGCCAAAGGG - Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
962590720 3:136887374-136887396 CTGCTATTTATCAGGAGAAAAGG - Intronic
962817603 3:139016521-139016543 CTGGTCATTCTGAAGAGAAACGG - Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965198827 3:165631200-165631222 CTGCTCTTGCTGTGGCTAAAAGG + Intergenic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
967813812 3:193782427-193782449 CTTATCTACCTCAGGAGAAAAGG - Intergenic
968278559 3:197458846-197458868 CTTTTCTTCCTGGGGAAAAAAGG - Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971967801 4:33583923-33583945 CTGCTCTTGCAGAGTACAAATGG + Intergenic
973983220 4:56324168-56324190 CTGCTCTGCCAGAAGAGAAGAGG + Exonic
976145950 4:82043269-82043291 CTGCTCTTACTGTAGAGATAAGG + Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977313615 4:95417016-95417038 ATTCTCTTACTGGGGAGAAAAGG + Intronic
978348813 4:107799930-107799952 CTGCCCCTCTTGAGGAGCAAAGG - Intergenic
978971867 4:114817786-114817808 GTGCTATTACTGAGGAGTAATGG - Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
981314314 4:143326716-143326738 CTGCTCTGGCTGGGGAGAAGAGG - Intergenic
981563958 4:146078283-146078305 TTGATTTTCCTGAGTAGAAAAGG + Intergenic
981594417 4:146402991-146403013 CTCATTTTCCTGAAGAGAAAAGG - Intronic
981803473 4:148685084-148685106 CCACTCTTTATGAGGAGAAATGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984241243 4:177222120-177222142 CTGCTCTTCATTAGGAGCAATGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985947665 5:3199646-3199668 CTGCTCATCCACAGGAGAACTGG + Intergenic
986498174 5:8368431-8368453 CTGAACTGCCAGAGGAGAAAAGG + Intergenic
986767036 5:10937636-10937658 CTGCCCTGCCTGGGGAGAAGGGG + Intergenic
990839307 5:60058564-60058586 CTTCTCTTCCCCAGGAGACAAGG - Intronic
991601947 5:68360264-68360286 CAGAGCTTGCTGAGGAGAAATGG + Intergenic
991949700 5:71935542-71935564 CCATTCTTCATGAGGAGAAAGGG - Intergenic
991950646 5:71944110-71944132 CTGCTCTTCAAGAGAAGGAAAGG + Intergenic
992077009 5:73201404-73201426 CTGCTATTCCTGAAAAGTAAAGG + Intergenic
993671413 5:90765181-90765203 ATCATCTTCCTGAGGAGAACTGG + Intronic
994551612 5:101241051-101241073 CAGCTCTGCCTGTGGAGAAGAGG + Intergenic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
997994834 5:138577093-138577115 CAGATCTTCCTGAAGAGATAGGG - Intergenic
998408078 5:141885816-141885838 ATGTTCTACCTCAGGAGAAAAGG - Intergenic
998637198 5:143968935-143968957 CTGTTTTTCCTGAGGAGAAGTGG + Intergenic
999868838 5:155729186-155729208 TTCCGCTTCCTAAGGAGAAAAGG + Intergenic
1000015629 5:157273217-157273239 CTGCACTTCCTGAGAAGACAAGG - Intronic
1001116084 5:168941277-168941299 CTGTTCTTCCTGCCGAGAGATGG - Intronic
1002108743 5:176893846-176893868 CTGCTCTTCCTGGGGTGTCAGGG - Intronic
1003365492 6:5471031-5471053 CTGCTCTTACTGATCAGAAAAGG + Intronic
1003998960 6:11575417-11575439 CTGCTGCACCTAAGGAGAAACGG - Exonic
1004471905 6:15937070-15937092 TTTCTCCTCCTGGGGAGAAATGG - Intergenic
1004861962 6:19813559-19813581 CTCTTCTTCCTGGAGAGAAAGGG - Intergenic
1005894309 6:30164491-30164513 CTGCTCTTCTTCTTGAGAAAGGG + Intronic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1010284945 6:74065917-74065939 CTGCTGTGCCTGAGGAGCAGAGG + Intergenic
1011755123 6:90490950-90490972 CTGAACTTCCTGAATAGAAAAGG - Intergenic
1012028096 6:94024113-94024135 CTGCTATCACTGAGAAGAAAAGG - Intergenic
1012369600 6:98487186-98487208 CTGCTATTCCTGAGCAGAATGGG - Intergenic
1013186577 6:107764557-107764579 CTGCTCTGCCTGAGGTGGGAAGG + Intronic
1014000960 6:116365820-116365842 GTGCTCTTCAGGAGGAGATAAGG - Intronic
1014459811 6:121682940-121682962 CTGATCTTGCTGTGGAGGAAAGG - Intergenic
1014902995 6:126990682-126990704 CTGCTCTTTGTAAGGAGAAAAGG + Intergenic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1016410224 6:143775131-143775153 TTACTCTTCCTCTGGAGAAATGG - Intronic
1016713209 6:147196638-147196660 CTGGGCTTTCTGAGGAGAGAGGG + Intergenic
1017446064 6:154509069-154509091 CTGCTCTTCCAGGTGAGGAATGG - Intronic
1017618134 6:156266732-156266754 CAGCTCCCCCTGAGGAGAACAGG - Intergenic
1018384083 6:163287327-163287349 CTGCTCTTACAGAAGGGAAAGGG + Intronic
1019111137 6:169715032-169715054 CTGCCATTCCTCAGGAGAATAGG - Intronic
1019706764 7:2500489-2500511 CCCCTCTCCCTGAGGAGAGAAGG + Intergenic
1021102935 7:16604753-16604775 TTGCACTACCTGTGGAGAAAAGG - Exonic
1022392059 7:29951633-29951655 TGCCTCTTCCTCAGGAGAAAGGG + Intronic
1022413744 7:30160377-30160399 ATGCTCTGCCTGTGGAGACATGG + Exonic
1024978936 7:55140646-55140668 CTGCTTTTCCTCAGGAGTATGGG - Intronic
1026370396 7:69692602-69692624 CAACTTTTCCTGAGGGGAAATGG + Intronic
1027299831 7:76820399-76820421 CAACTCTTGCTGAGAAGAAATGG - Intergenic
1027475943 7:78631436-78631458 CTGCTCTTCCTGATGAGCCCTGG + Intronic
1028259389 7:88642147-88642169 CTGCTCTTCATTAGAGGAAAAGG - Intergenic
1029064867 7:97839304-97839326 CTGCTCCCCCTGAGGTTAAAAGG - Intergenic
1029855544 7:103512654-103512676 CATCTCTTCCAGAAGAGAAAAGG - Intronic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033416059 7:141162129-141162151 CTGCAGTTCCTGTGGGGAAACGG - Intronic
1034086216 7:148324940-148324962 CTGCTCTGCCTGATTAGAATGGG - Intronic
1034962706 7:155372599-155372621 CTTCTCTCCCTGGGGAGAAGCGG - Intergenic
1035449126 7:158964065-158964087 CTGCTCTTCCTGCCTAGAACAGG + Intergenic
1035909975 8:3555412-3555434 CTGCTCTTCCTGATGAGGGCTGG + Intronic
1036649334 8:10632326-10632348 CTCCATTTCCAGAGGAGAAAAGG - Intronic
1042879816 8:73474587-73474609 CTCCTCTACCTGAGGAGTGATGG - Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044758918 8:95496160-95496182 CTGCAGTTCCAGTGGAGAAATGG - Intergenic
1045406820 8:101874850-101874872 CTCCTCTTCCTAAGTAGAACAGG + Intronic
1045551807 8:103179777-103179799 ATGGTCTTCCTGGGGAGATAAGG + Intronic
1047660966 8:127036080-127036102 CTACTCTTACTAAGCAGAAAAGG + Intergenic
1048049897 8:130806835-130806857 CTGCTCTTCCTGAGGGGTCACGG - Intronic
1048492965 8:134911805-134911827 CTGATTTTCCAGAGGAGAGAAGG + Intergenic
1054978930 9:71181149-71181171 GTGCTCTTCCTGAGAACAAAGGG + Intronic
1055611146 9:78026035-78026057 CAGCTCTACTTTAGGAGAAATGG - Intronic
1055647481 9:78374844-78374866 CTGCTCATATTGAGGAGGAAAGG - Intergenic
1056231621 9:84551440-84551462 GTTCTTTTCCTGAGGAGGAAGGG + Intergenic
1056868561 9:90254526-90254548 CTGCTCTGACAGATGAGAAATGG + Intergenic
1058898567 9:109421386-109421408 CTGACAGTCCTGAGGAGAAATGG - Intronic
1060010251 9:120037551-120037573 ATGCTCACACTGAGGAGAAAGGG - Intergenic
1060826774 9:126692221-126692243 CTGCTCTTCCTCAGGAGTCCAGG - Intronic
1061304906 9:129726615-129726637 CTCCCCTTCCTGGGGTGAAATGG + Intergenic
1203519777 Un_GL000213v1:34603-34625 CTGCGCTGCCTGGGAAGAAAGGG - Intergenic
1188662154 X:32774114-32774136 CTGAAATTCCTTAGGAGAAATGG + Intronic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1190356104 X:49606595-49606617 GTGTTATTCCTGATGAGAAATGG + Exonic
1190578892 X:51871153-51871175 AGTCTCTTCTTGAGGAGAAATGG - Intronic
1191645065 X:63471192-63471214 CTCCTCTTCCTGGGGGGAACCGG - Intergenic
1193224272 X:78963481-78963503 CTGCTATGTCTGTGGAGAAATGG + Intergenic
1195047294 X:101065650-101065672 CTGGTCTTCCTGGAGAGATAGGG - Intergenic
1196412162 X:115431703-115431725 ATGCTCCTCCTGAGAACAAAAGG - Intergenic
1196964712 X:121042900-121042922 TTGATCTTTCTGAGGAGAACTGG + Intergenic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic