ID: 961428865

View in Genome Browser
Species Human (GRCh38)
Location 3:126865703-126865725
Sequence CAGAGTAGACTCAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961428865_961428869 -9 Left 961428865 3:126865703-126865725 CCCTCTTCCCTGAGTCTACTCTG 0: 1
1: 0
2: 5
3: 42
4: 364
Right 961428869 3:126865717-126865739 TCTACTCTGCATACTGCTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961428865 Original CRISPR CAGAGTAGACTCAGGGAAGA GGG (reversed) Intronic
900271765 1:1793844-1793866 GAGAGTAGACTCAGAGAAGGAGG + Intronic
900738713 1:4317282-4317304 AAGAGAAGACACAGAGAAGAAGG + Intergenic
901021554 1:6258527-6258549 CAGAGTAGCCTCAGGAGTGAGGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901468479 1:9439136-9439158 CTGGGGAGACTCAGGGCAGAAGG + Intergenic
901741802 1:11346591-11346613 CAGTGTAGACTCTGTGCAGATGG + Intergenic
901783587 1:11610169-11610191 CAGAGCAGACTCGGGGAAAGGGG + Intergenic
901802869 1:11719365-11719387 CAGAGAAGACTCAGGGCGGTCGG - Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903049377 1:20589397-20589419 CAGCGGAGACTGGGGGAAGAAGG - Intronic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903498239 1:23786410-23786432 GAGAGTGGACTGAGGTAAGATGG + Exonic
905042666 1:34973182-34973204 CTGCGTTGACTCAGGGAAGGAGG - Intergenic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
906210057 1:44007778-44007800 CAGAGGAGACTCAGGGGAAAGGG - Intronic
906329517 1:44873274-44873296 AAGAGTTGCCTCTGGGAAGAGGG - Intronic
907412579 1:54292950-54292972 CAGAGGAGACTCTTGGAGGATGG + Intronic
907462755 1:54615040-54615062 CAGAGCTAACTCAGAGAAGAAGG + Intronic
908783561 1:67713513-67713535 CAGAGCACACTCTGGGAGGAAGG + Intronic
909201441 1:72694402-72694424 AAGAGAAGAATCAGGGAAGAAGG - Intergenic
913313388 1:117527589-117527611 CAGAATAGGGTAAGGGAAGATGG + Exonic
913397474 1:118388178-118388200 CAGAGTAGCGTAAAGGAAGAGGG - Intergenic
913668631 1:121073700-121073722 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914020375 1:143861143-143861165 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914658875 1:149769055-149769077 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914877111 1:151520331-151520353 AAGGGTAAAATCAGGGAAGATGG - Intronic
914930985 1:151932694-151932716 CATAGTAGATTCTGGGAAGATGG - Intergenic
915163240 1:153933880-153933902 CAGAAAAGAATGAGGGAAGATGG + Intronic
915647237 1:157281642-157281664 TAGAGTAGATTGAGGAAAGAGGG + Intergenic
915663418 1:157422921-157422943 TAGAGTAGATTGAGGAAAGAGGG - Intergenic
915667004 1:157454143-157454165 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
915790624 1:158666347-158666369 CAGAATCGACTCAGGAAACACGG - Exonic
916055596 1:161067227-161067249 AAGAGTAGGGTCAGGGAGGAAGG + Intronic
916818626 1:168376834-168376856 GAGAGAAGAGCCAGGGAAGAAGG + Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917083201 1:171278130-171278152 CAGAGTTGGCTCAGAGAAAAAGG - Intronic
917127135 1:171696957-171696979 GAGAACAGACTCTGGGAAGAGGG + Intergenic
917310333 1:173671525-173671547 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
919023348 1:192136568-192136590 AGCAGAAGACTCAGGGAAGAAGG - Intergenic
919316171 1:195972470-195972492 CACAGTAGACCCAGGAAATAAGG + Intergenic
919556815 1:199066304-199066326 TAGTGCAGCCTCAGGGAAGATGG + Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
923079736 1:230642175-230642197 CAGAGCAGTCTCAGGGTAGAAGG + Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923990227 1:239427708-239427730 CAGAGGAGACTGAGACAAGATGG + Intronic
1062884313 10:1004815-1004837 CAGTTTAGCCTCAGGGATGAAGG + Intronic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064747951 10:18496421-18496443 CAGAGAAGACACAGGGGAGTTGG - Intronic
1066981717 10:42422744-42422766 CAGAGTGGAGGCAGTGAAGAGGG - Intergenic
1067682201 10:48448281-48448303 GAGAGGAGCCTCAGGGTAGAAGG - Intronic
1069460988 10:68594510-68594532 AAGAGTAGCCTCAGGGAAAGGGG + Intronic
1069766452 10:70864208-70864230 CAGAGAAGATTCAGGGAGAAAGG - Intronic
1069821109 10:71229336-71229358 CAGAGGAGACCCTGGGAGGATGG + Intronic
1070847314 10:79533934-79533956 CAGGGAAGAATCAGGGGAGAAGG - Intergenic
1070926482 10:80226358-80226380 CAGGGAAGAATCAGGGGAGAAGG + Intergenic
1070978333 10:80623669-80623691 GGGAGTAGATTCTGGGAAGATGG - Intronic
1071301723 10:84261236-84261258 CAGAGGAGAGGCAGGGAGGAAGG + Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1073148687 10:101297163-101297185 CAGAGAGGACTCAGGGAAATGGG + Intergenic
1073454390 10:103627918-103627940 CAAAGAAGTGTCAGGGAAGAAGG - Intronic
1073465460 10:103692481-103692503 CAGAGTTGGGGCAGGGAAGAAGG + Intronic
1073723612 10:106203845-106203867 CAGAGGAGAATTGGGGAAGATGG - Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075765949 10:124893014-124893036 CAAAGAAGACACAGGGAAGAAGG - Intergenic
1076171804 10:128326049-128326071 AAGAGCAGACTCAGGGTGGAGGG + Intergenic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1076638624 10:131899684-131899706 GAGAGAAAAATCAGGGAAGAAGG - Intergenic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078737460 11:14033499-14033521 AAGATTAGATTTAGGGAAGAAGG + Intronic
1079826969 11:25208484-25208506 AAGAGTAGAAGCAGGGGAGAAGG + Intergenic
1080300186 11:30775562-30775584 CAGAGCAGCCTCAAGGCAGAGGG - Intergenic
1080429460 11:32185017-32185039 CAGAGTGGTCACTGGGAAGACGG - Intergenic
1080575197 11:33592476-33592498 CATAGTAGTCTCAGGCAACAAGG - Intronic
1081253937 11:40869710-40869732 AAGAGAAGAATCAGGGGAGAAGG + Intronic
1081264847 11:41007871-41007893 CAGAGTAGGCTTTGGGAAGTAGG - Intronic
1081412680 11:42778180-42778202 TACAGCAGACTCAGGGAAGAGGG + Intergenic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1084374951 11:68770186-68770208 CAGACTGGACTCTGGGAAGAAGG - Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1085152990 11:74267142-74267164 CAGAGCAGCCTCCTGGAAGAAGG - Exonic
1085321345 11:75576027-75576049 CAGGGGAGACTCCTGGAAGAAGG + Intergenic
1086268326 11:85028669-85028691 CAGAGTGGACACCGGGAACAGGG + Intronic
1087008163 11:93489001-93489023 CAGAGCAGTTTCAGTGAAGAGGG + Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1089008024 11:115108777-115108799 CAGAGCAGACACAGGGTAGCGGG - Intergenic
1089389967 11:118094703-118094725 CAACGTAGACTCAGGGAGAAGGG + Intronic
1089891342 11:121884432-121884454 GAGAGAAGGCTCTGGGAAGAGGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090835786 11:130452515-130452537 CAGAGAAGTCTCAGGGAATGAGG - Intronic
1091914912 12:4264469-4264491 CAGAGTAGAAGCAAGAAAGAGGG + Intergenic
1092013104 12:5132613-5132635 CAGCATAGTCTCAGGGTAGAGGG + Intergenic
1092051451 12:5473636-5473658 GAGAGGAGACTCAGGCCAGAGGG + Intronic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1094197586 12:27765553-27765575 CAGAGGAGGTTCATGGAAGAAGG - Intronic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098211640 12:68172392-68172414 CAGAGAAGAAACATGGAAGATGG - Intergenic
1099110416 12:78553147-78553169 CAAGGTAGACTCTGAGAAGAGGG + Intergenic
1100673294 12:96839456-96839478 CTGAGTATACTCATGAAAGAGGG + Intronic
1102441958 12:112970298-112970320 CAGAGAGGAGTCAGGGAGGAGGG - Exonic
1104432456 12:128727688-128727710 CAGAGAAGAATCAGGGGAGAAGG - Intergenic
1105927890 13:25024183-25024205 CAGACGGGACTCAGGGAAGATGG + Intergenic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1109559749 13:64030917-64030939 CACAGAAGAAACAGGGAAGACGG + Intergenic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1109826569 13:67729063-67729085 CAGTGCAGATTCAGAGAAGAAGG - Intergenic
1110531495 13:76603520-76603542 CAGAGTTTACTCACGGGAGATGG - Intergenic
1111990300 13:95109798-95109820 TAGAGTAAACTCATAGAAGAAGG + Intronic
1112086770 13:96040380-96040402 CAGAGAAGACACAGGCAAAAAGG - Intronic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1113452624 13:110422396-110422418 GCGAGGAGACTCATGGAAGATGG - Intronic
1113955609 13:114098690-114098712 CAGCCCAGACCCAGGGAAGAAGG + Intronic
1116173298 14:41430413-41430435 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1117528016 14:56631255-56631277 CAGGGAAGAATCAGGGGAGAAGG - Intronic
1118375264 14:65171267-65171289 GAGAGGAGAGTCAGGGAAGTGGG - Intergenic
1119052676 14:71385347-71385369 CAGAGAAGACTCTGGGATGGAGG - Intronic
1119266794 14:73267488-73267510 CAGAGGAGTGTCAAGGAAGAGGG + Intronic
1119574030 14:75702223-75702245 CACAGGAGACTCAGGGTAAAAGG - Intronic
1119669194 14:76505933-76505955 CAGAGTAGAGTGAGGCCAGATGG - Intergenic
1119715895 14:76859120-76859142 CAGTGGAGACTCAGGGGTGAAGG - Intronic
1119852859 14:77878523-77878545 GAGATTAGACCCAGGCAAGACGG - Intronic
1120630268 14:86881843-86881865 CAGAGCAGAGGCAGGGGAGATGG + Intergenic
1120791540 14:88588247-88588269 CAGAGCCGACTCAGGGGAGGAGG - Intronic
1121034309 14:90687502-90687524 CAAAGTGGACTGGGGGAAGAGGG + Intronic
1121122104 14:91382584-91382606 CAGAGATGACCCAGAGAAGACGG + Intronic
1121902563 14:97707216-97707238 CACAAGAGAATCAGGGAAGAAGG + Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126374833 15:47987044-47987066 CAGAGTAAATGCAGGGAAGGAGG + Intergenic
1126753077 15:51897189-51897211 CAGTGTAGACTGAGAAAAGAAGG - Intronic
1127950019 15:63795869-63795891 CAGAGGAGAATCAAGGAAGCAGG + Intronic
1128596670 15:68957991-68958013 CAGAGAAGAATCAAGGAAGGAGG + Intronic
1129239443 15:74242816-74242838 CAGTGGGGACTCAGAGAAGACGG - Intronic
1129858002 15:78838714-78838736 CAGAGAAGACTCAGGCCAGCTGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130387624 15:83425502-83425524 CTCAGTAGACTCAGAGAAAATGG - Intergenic
1132328115 15:100988823-100988845 CAGGGTTGACTCAGGGTAGTGGG - Intronic
1134341252 16:13348716-13348738 CAGACTATGCTCAGGGAAGTGGG + Intergenic
1135508080 16:23056602-23056624 CAGATTAGACTTAGCTAAGATGG + Intergenic
1137919740 16:52475109-52475131 AAAAGTAGACTTGGGGAAGAGGG - Intronic
1138970573 16:62138156-62138178 CAGAGGAGGCTAAGGGAAGCTGG - Intergenic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139670603 16:68490515-68490537 CAGAGATGACTCAGGCAAGTTGG + Intergenic
1142272296 16:89096419-89096441 CAGAGCCTACTCAGGGCAGATGG - Intronic
1142494637 17:299854-299876 CTGACCAGACCCAGGGAAGACGG + Intronic
1143460259 17:7099228-7099250 AAGAGTTGACTCTGGGGAGACGG + Intergenic
1143651476 17:8266448-8266470 CAGGGAAGACTCAGGGAAAGGGG - Intronic
1143883933 17:10052222-10052244 CAGAGGAGTCTCAGGTATGATGG - Intronic
1144034190 17:11350591-11350613 GACAGTGGACTGAGGGAAGAGGG - Intronic
1144342241 17:14319407-14319429 AACAGTGGACACAGGGAAGAGGG + Intronic
1146891475 17:36509148-36509170 GAGAGTGGACTCTGGTAAGAGGG + Intronic
1147811034 17:43170041-43170063 CAGAGTAGATGCAGGCAAGCTGG + Intergenic
1148047299 17:44751951-44751973 CGGAGCTGACTCAGGGCAGACGG - Exonic
1148853209 17:50564805-50564827 CAGAGGAGATTCTGGGGAGAAGG + Intronic
1149965619 17:61161011-61161033 CAAAGTTGACACAGGGAAGGGGG - Intronic
1150221595 17:63498603-63498625 CAGAAGAGACTCAGGGCTGAGGG - Intronic
1150498214 17:65625520-65625542 CAGGTTTGAGTCAGGGAAGAAGG - Intronic
1150927354 17:69546932-69546954 CAGAGTAAAATCTAGGAAGAAGG + Intergenic
1150977110 17:70100391-70100413 CAGAGAAGTATCAGGTAAGATGG - Intronic
1152082612 17:78197735-78197757 CAGAGTGGTCTCAGTGCAGATGG + Intronic
1152153392 17:78616890-78616912 CAGAGTATACGCTGGGAAAAGGG + Intergenic
1153917156 18:9756307-9756329 CAGTGTAGAGTCAGGAAAGCAGG + Intronic
1154026670 18:10714282-10714304 AATAGTAAACTCAGAGAAGATGG + Intronic
1155671715 18:28379667-28379689 AAGAGAAGATTCTGGGAAGATGG + Intergenic
1156047077 18:32888991-32889013 CAGAGTAGACTGATAGAAAATGG + Intergenic
1156909072 18:42389361-42389383 CAGAGGTGACCCAGGGAGGATGG - Intergenic
1157813691 18:50716327-50716349 AGGAGGAGACCCAGGGAAGAGGG - Intronic
1159102452 18:63971074-63971096 GCGAGTGGACCCAGGGAAGAGGG - Intronic
1159117550 18:64132902-64132924 CAGAATAAAGTCAGGAAAGATGG + Intergenic
1159745726 18:72232503-72232525 AAGGGAAGAATCAGGGAAGAAGG - Intergenic
1159802858 18:72922546-72922568 CAGAGAAGACTCAGAAAAAATGG + Intergenic
1160392580 18:78546399-78546421 CACAGGAGACTCAGAGAAGAGGG - Intergenic
1161203213 19:3027721-3027743 CAGAGCAGACCTAGGGAACACGG - Intronic
1162090532 19:8276796-8276818 CAGAGCAGAGCCTGGGAAGATGG - Intronic
1162092765 19:8291624-8291646 CAGAGCAGAGCCTGGGAAGATGG - Intronic
1162567238 19:11451155-11451177 CAGATGAGACCCAGGGAAGGTGG - Intergenic
1163794308 19:19327761-19327783 CTGAGCAGACCCAGGGAACAAGG - Intronic
1164127913 19:22335314-22335336 GAGCATAGACTCAGGCAAGAGGG + Intergenic
1165064117 19:33219230-33219252 CAGCGAAGGCTCAGGGAAGAGGG - Intronic
1165293297 19:34906096-34906118 CAGAGAAGATGCAGGGAGGAAGG + Intergenic
1165705248 19:37971398-37971420 CAGGGCAGAATCAGGGAAGCGGG - Intronic
1165991152 19:39814973-39814995 CAGAATAGAGTCAAGGAGGAAGG + Intergenic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1168587279 19:57603688-57603710 AGGAGTAGACTCAGGTAGGAAGG + Intronic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
926526102 2:13982852-13982874 CAGAGCAGTCTCAGGAGAGATGG - Intergenic
926726755 2:16004611-16004633 CAGAGTAGAGGCAGGCAAGGTGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
929825977 2:45310071-45310093 CTGAGAAGACTCAGGGAGGATGG - Intergenic
930594708 2:53372739-53372761 CAGAGTAGTCTAAGGGCACATGG + Intergenic
931912949 2:66922090-66922112 CAGGGTAGACTTATGGGAGAGGG + Intergenic
932354673 2:71058971-71058993 CAGGGCTGACTCAGGAAAGAAGG + Intergenic
934158351 2:89224656-89224678 CACAGTGGACACAGGTAAGAAGG + Intergenic
934208917 2:89957769-89957791 CACAGTGGACACAGGTAAGAAGG - Intergenic
935523232 2:104135489-104135511 CAAAGTAAATTTAGGGAAGATGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935862668 2:107350026-107350048 CAGAGTAGACTCAGGAGGCAAGG + Intergenic
935959747 2:108413350-108413372 GAGAGTAGAGTCAGGGATCATGG + Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936153968 2:110036362-110036384 CTGGGAAGACTCAGGGCAGAAGG + Intergenic
936190717 2:110335053-110335075 CTGGGAAGACTCAGGGCAGAAGG - Intergenic
936567310 2:113591508-113591530 CAGGGCAGACTCCTGGAAGAGGG + Intergenic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
937031066 2:118741056-118741078 CAGAGTATAGCCAGGGAAGGAGG + Intergenic
937219364 2:120332963-120332985 CACAGTAGAGTGGGGGAAGAAGG - Intergenic
939683422 2:145167927-145167949 CAGAGGATACACTGGGAAGATGG + Intergenic
940346603 2:152635637-152635659 CAGAGTTGAGTCAGGCAAGGGGG + Intronic
941596289 2:167480839-167480861 CAGAGCAGGTTCAGGGAAGACGG + Intergenic
944201569 2:197113065-197113087 CAGATTATACTCATAGAAGATGG - Intronic
944461862 2:199957648-199957670 AAGAGTTGACTCAGAGAAGCAGG - Intronic
944769423 2:202898636-202898658 CAGACTGGACTCAGCAAAGAAGG - Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
946053156 2:216880603-216880625 CAGAGTGGGCTTTGGGAAGAAGG + Intergenic
946476129 2:220008204-220008226 TAGACTAGACTCAGGGAAAGTGG + Intergenic
946716309 2:222557605-222557627 AAGAGAAGACTAAGGAAAGAGGG + Intronic
947909562 2:233792179-233792201 CAGAGGAGCCCCAGGGAAGGAGG - Intronic
948098970 2:235358658-235358680 CTGAGGAGACACGGGGAAGAAGG - Intergenic
948303946 2:236932729-236932751 CAGAGTAGCCTCGGGGTAGAGGG + Intergenic
1169961060 20:11160663-11160685 CAGAGTAGCCTCATGAAAAAGGG - Intergenic
1170044451 20:12070903-12070925 CAGAATAGACACCAGGAAGAAGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1172207714 20:33176290-33176312 CAGGTTTGACTCAGGCAAGAGGG + Intronic
1172832379 20:37846782-37846804 GAGAGGAGGCTCAGGGCAGAAGG - Intronic
1173010150 20:39175010-39175032 GAGAGGAGAGTTAGGGAAGAGGG + Intergenic
1173282190 20:41638837-41638859 CAGAGGGGACTCTAGGAAGAGGG - Intergenic
1174193387 20:48756144-48756166 CAGAGTTGACTCAGAGAAGGAGG - Intronic
1175776621 20:61657997-61658019 CAGAGTGGATTAAGGGAACAGGG + Intronic
1175883568 20:62274613-62274635 CAGAGCTCACTCTGGGAAGAAGG + Intronic
1176117858 20:63440822-63440844 CACAGGAGACTCTGGGAAGGAGG + Intronic
1179054715 21:37920427-37920449 AAGAGAAGAATCAGGGTAGAAGG + Intergenic
1181421917 22:22806719-22806741 CAGAGTGGCATCATGGAAGATGG + Intronic
1181477162 22:23175885-23175907 CGGAGAAGACTCAGTGAAGAAGG - Intergenic
1181753391 22:25005771-25005793 CAGAGAAGACACAGGGCTGATGG - Intronic
1182102544 22:27668405-27668427 CAGAAGAGACTCACGGAAGAAGG + Intergenic
1182988225 22:34741535-34741557 TAGAGAAGACTCAGGGTAGCAGG - Intergenic
1183279339 22:36923751-36923773 CAGAGTAGACCAAGGAGAGATGG + Intronic
1184160738 22:42695759-42695781 CAGGGGACACTCAGGGAATAGGG + Intronic
1184992912 22:48182760-48182782 CAGAGAAGACGCAGGAACGACGG + Intergenic
951958900 3:28292406-28292428 AAGGGTAAAATCAGGGAAGAAGG - Intronic
954115642 3:48465660-48465682 CAGATCAGACTCAGGAAACAAGG - Exonic
954493692 3:50931911-50931933 CAGAATAGATGCAGTGAAGAGGG - Intronic
954590601 3:51778527-51778549 GAGATTAGACTCATGGAGGAGGG - Intergenic
955433165 3:58871220-58871242 CAGAGTAAAGGCATGGAAGAAGG + Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
956552491 3:70477212-70477234 AAGGGAAGAATCAGGGAAGAAGG + Intergenic
956680357 3:71773686-71773708 CAGAGGAAAATCAGAGAAGAAGG + Intronic
957216430 3:77325851-77325873 CAGATTATACTCCTGGAAGATGG + Intronic
957687595 3:83522416-83522438 CATAGGAGAATCAGAGAAGATGG - Intergenic
959112304 3:102136096-102136118 GAGACTGGCCTCAGGGAAGAGGG - Intronic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
960023169 3:112978294-112978316 CAGAGTAGATTGAGGGAATTAGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961123511 3:124395096-124395118 GAGATTCCACTCAGGGAAGATGG - Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
962059781 3:131913491-131913513 GAGGGAAGAATCAGGGAAGAAGG + Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962416130 3:135183668-135183690 AGGAGAGGACTCAGGGAAGAGGG + Intronic
963637721 3:147820270-147820292 CAGTAAAGACTCAGGGAAAAGGG - Intergenic
965680479 3:171246130-171246152 CAAATTAGGCTCAGGGAATAAGG - Intronic
966267261 3:178061468-178061490 AAGAGTTTACTTAGGGAAGATGG - Intergenic
967883103 3:194315423-194315445 CAGAGAACAGCCAGGGAAGATGG + Intergenic
967888049 3:194346409-194346431 CCCAGTAGACCCAGGCAAGAGGG - Intronic
969227620 4:5809254-5809276 CAGAGTACACTGAGGTCAGAGGG - Intronic
969547196 4:7838091-7838113 AAATGTAGTCTCAGGGAAGAAGG + Intronic
970191896 4:13525269-13525291 CAGAGTAGCCTCAGAGAGGGAGG + Intergenic
970977168 4:22055627-22055649 CAGAGTAGAGACAGGCAAGCAGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
973547675 4:51998235-51998257 CAAATTACACTCAGGAAAGAAGG - Intronic
973748510 4:53988027-53988049 GAGAGAAGACTCAGGGAGAAGGG - Intronic
975242041 4:72071414-72071436 CAGAGTGGATTCTTGGAAGATGG + Intronic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
977889535 4:102292431-102292453 CAGAATAGACTAAGAGAACAGGG - Intronic
979446220 4:120815295-120815317 CACAGCTGACTTAGGGAAGATGG - Intronic
979803272 4:124938220-124938242 CAGGGTAGAATCAGGAGAGAAGG + Intergenic
981058078 4:140386557-140386579 CAGAGTAGTTTTAGAGAAGATGG - Intergenic
981746234 4:148055058-148055080 CAGTGTGGAATCAGGTAAGAGGG - Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
982610973 4:157574513-157574535 CAGAGTGGACTCTGGGAGTAGGG - Intergenic
984006752 4:174320575-174320597 CAGAATATAGCCAGGGAAGATGG + Intronic
984089696 4:175357040-175357062 CAGAGTTGACTCTGCTAAGATGG - Intergenic
985286619 4:188342856-188342878 CATAGTAGTTACAGGGAAGATGG + Intergenic
985641393 5:1065001-1065023 CAGAGGAGACTGAGGGGACACGG + Intronic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
986862302 5:11941217-11941239 CAGAGTAGATTCATGGTAGTAGG + Intergenic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
989057162 5:37376770-37376792 GAGAGTATTCTCAGGGAAAATGG - Intergenic
989820835 5:45794450-45794472 AAGAGAACAATCAGGGAAGAAGG - Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
990781566 5:59370160-59370182 AAGAGTAGAAGCAGGGAAAATGG - Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992263329 5:74992407-74992429 AAGAGGAGACTCTGTGAAGATGG - Intergenic
992958993 5:81939975-81939997 CAGAGTAGACTCATAGAAAGTGG - Intergenic
993272516 5:85813309-85813331 GAGGGAAGAATCAGGGAAGAAGG + Intergenic
996404773 5:123094328-123094350 CAGAGGAGGCGCAGGGCAGAAGG - Intronic
997948895 5:138226243-138226265 CAGAGCAGACTCAGTGCACAAGG + Intergenic
998206089 5:140157677-140157699 CCCAGGAGACCCAGGGAAGACGG + Intergenic
998218240 5:140253768-140253790 CAGAGAAGATTAAGGGAAGAAGG + Intronic
999509742 5:152236901-152236923 CAGAGAAAATTCAGGAAAGAGGG - Intergenic
1000233321 5:159335393-159335415 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
1001030172 5:168256892-168256914 CACAGTAGTCCCAGGGCAGAAGG + Intronic
1001584703 5:172826004-172826026 CAGAGAGGAGTCAGGGATGATGG + Intergenic
1001822135 5:174718739-174718761 CAGACTACACGTAGGGAAGATGG - Intergenic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1005454541 6:26006509-26006531 GAGTGTAGACACAGGAAAGAGGG - Intergenic
1005955264 6:30659246-30659268 CACAGTAGATTCAGTGGAGAAGG - Intronic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1007640102 6:43331279-43331301 CAAAGGAGACTCAGTGAAGCGGG - Intronic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1008372975 6:50756852-50756874 CAGAGTAGCCTCAGCTCAGATGG + Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1010720778 6:79281222-79281244 CAGACTAGATTCAGGTGAGAAGG + Intergenic
1010913792 6:81590568-81590590 CAGGGAAGAATCAGGGAAGAAGG + Intronic
1013922045 6:115417245-115417267 AAGGGAAGAATCAGGGAAGAAGG - Intergenic
1014555153 6:122836681-122836703 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
1016145032 6:140660246-140660268 CAGAGGGGACTCAGAGAACAGGG + Intergenic
1016893391 6:149029216-149029238 CAGTGGAGACTAGGGGAAGAGGG + Intronic
1016942087 6:149490857-149490879 CAGAGGAGACGCAGGGAAGAAGG + Intergenic
1018762236 6:166902583-166902605 CAGAGTAGACTCAGAGACTCAGG - Intronic
1019726933 7:2608005-2608027 CAGGGTGGAGTCAGGGAAGGAGG + Intronic
1020267656 7:6572045-6572067 GGGAGGAGAGTCAGGGAAGAGGG - Intergenic
1020620428 7:10511228-10511250 AAGAGAAGACTCAGAAAAGAAGG - Intergenic
1021502682 7:21347713-21347735 AAGGGAAGAATCAGGGAAGAAGG - Intergenic
1022242231 7:28523655-28523677 CAGAGCAGTTTCAGGGAGGATGG - Intronic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1023100148 7:36709366-36709388 CAGAGCAGCCTCAGGCAAGGAGG + Intronic
1023150668 7:37198771-37198793 CACAATACACTCAGGGACGAAGG + Intronic
1023908541 7:44538560-44538582 CAGAGTGGACTCGGGGTTGAAGG + Intronic
1024352237 7:48378196-48378218 GGGAGTAGACTCATGGAGGAAGG + Intronic
1024374446 7:48621161-48621183 CAGAGAAGTCTCAAGGAAAAAGG - Intronic
1026462236 7:70624731-70624753 CAGAATAAACTTAGGAAAGAGGG + Intronic
1027730634 7:81867747-81867769 CAGAGGAGACTTAGAGAATAAGG - Intergenic
1028514402 7:91660415-91660437 CAGAGTAGAAGCAGTGAGGAAGG + Intergenic
1028736060 7:94213710-94213732 CAGATTAGAGTCAGGGTAAATGG - Intergenic
1028996617 7:97107361-97107383 CAGAGTATTGCCAGGGAAGAAGG + Intergenic
1029207469 7:98878342-98878364 GGGAGGAGACTCAGGGAAAAAGG + Intronic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1031562837 7:123258749-123258771 GAGAGGAGAATGAGGGAAGAAGG + Intergenic
1032331656 7:130986274-130986296 CAGAGAAGACTCACGGCAGTGGG + Intergenic
1032516899 7:132513084-132513106 TTGAGTAGTCTCAGGGGAGATGG + Intronic
1032773993 7:135090860-135090882 CAGCCTAGTCTCAGGGATGAAGG + Intronic
1033266077 7:139888372-139888394 CAGTGTAGACCCAGGGAACAAGG - Intronic
1033845088 7:145422000-145422022 GAGAGGAGACTAAGGGAAGGTGG - Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034309474 7:150074206-150074228 TAGAGTAGTCTCAGGGAACCTGG - Intergenic
1034797383 7:154026435-154026457 TAGAGTAGTCTCAGGGAACCTGG + Intronic
1034936910 7:155205763-155205785 CAGAGTCAGCTCACGGAAGATGG - Intergenic
1035859217 8:3010013-3010035 CAGGATAGGCCCAGGGAAGAAGG - Intronic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1036202129 8:6778670-6778692 CAAAATAGACTCAGGGAAGCAGG + Intergenic
1037627361 8:20619800-20619822 CAGAGGAGACATAGAGAAGAAGG + Intergenic
1038109921 8:24484697-24484719 CAGAGTAGACTAAAGTAAAATGG + Intronic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039864195 8:41487114-41487136 CAGAGAAGATACAGGGAAGAAGG + Intergenic
1041436984 8:57852816-57852838 CAGAATTGATTCAAGGAAGAAGG + Intergenic
1041523721 8:58782804-58782826 ACCAGTAGACTCAGGGAAGGCGG + Intergenic
1042430695 8:68703084-68703106 CAAAATAGACTTAAGGAAGATGG - Intronic
1042761860 8:72280065-72280087 AAGGGAAGAATCAGGGAAGAGGG + Intergenic
1043853434 8:85239705-85239727 CAAAGAAGAATCAGGGAAGAAGG + Intronic
1043875891 8:85485497-85485519 CTTCGTAGACTCAGGGAAAAGGG - Intergenic
1045394328 8:101745615-101745637 CAGAACAGACTTAGGGAAGCAGG - Intronic
1046333266 8:112749907-112749929 TAGAGTACACTCAGGGCAGAGGG + Intronic
1046386911 8:113517928-113517950 AAGGGAAGACTCAGGGGAGAAGG + Intergenic
1046387942 8:113527248-113527270 AAGGGAAGAATCAGGGAAGAAGG + Intergenic
1047042158 8:121008011-121008033 CAGACTGGTCCCAGGGAAGAAGG + Intergenic
1047450710 8:124962898-124962920 CAGGGAAGAATCAGGGGAGAAGG + Intergenic
1049702253 8:144020624-144020646 GAGAGTATACTCAGGGAGGAGGG - Intronic
1051326946 9:15982354-15982376 CAGATTCCTCTCAGGGAAGAGGG + Intronic
1052547438 9:29898139-29898161 AAGAGGAAACTCAGGGCAGAGGG + Intergenic
1055673321 9:78629253-78629275 GAGAGTAGACTCTAAGAAGAGGG - Intergenic
1055711030 9:79062366-79062388 CAGAATACACTCAGGGGTGAGGG - Intergenic
1055755190 9:79550668-79550690 CAGTGCAGATTCAAGGAAGAGGG - Intergenic
1056303527 9:85267415-85267437 AAGAGAAGACTCAGAGGAGAAGG - Intergenic
1056505057 9:87250596-87250618 CAGAGGGGATTCTGGGAAGATGG - Intergenic
1057439187 9:95070177-95070199 CAGAGTAGCCACAGGGCAAACGG - Intronic
1057694539 9:97313885-97313907 CAGAAAAGACTCAGGGAGAAGGG - Intronic
1057820495 9:98326623-98326645 CAGAGTTGCCTCATGGAAGATGG + Intronic
1058187676 9:101874580-101874602 CAGAGAAGACCCAGGGAAGAAGG - Intergenic
1058247837 9:102652992-102653014 AAGAGAAGAATCAGGGGAGAAGG + Intergenic
1058300993 9:103372967-103372989 AAGAGAAGAATCAGGGAAAAGGG - Intergenic
1059106945 9:111520285-111520307 CAGAATAGGTACAGGGAAGAGGG - Intergenic
1059389574 9:113990356-113990378 CAGAGTGGAAGCAGGGAACATGG - Intronic
1059984139 9:119805545-119805567 TAGAGCAGACATAGGGAAGAAGG + Intergenic
1060627492 9:125126966-125126988 GAGATTATACTGAGGGAAGAAGG + Intronic
1062445965 9:136594897-136594919 CAGAGTTCACTTTGGGAAGATGG + Intergenic
1187191190 X:17037024-17037046 TATAGTAGACTCAGTGAAGTAGG - Intronic
1190771877 X:53521674-53521696 CAGGGAAGAATCAGGGGAGAGGG - Intergenic
1195940167 X:110161342-110161364 CAGGGAAGCCTCATGGAAGAGGG - Intronic
1197617679 X:128713198-128713220 CAGAGTAGAATGAGGCAAGCAGG + Intergenic
1198020831 X:132656364-132656386 CAGAGAATACTCAGGGAGCAAGG - Intronic
1199082424 X:143591719-143591741 AAGAGAAGAATCAGGGGAGAAGG - Intergenic
1199677357 X:150199592-150199614 CACTGTGGACTCAGGGGAGAGGG - Intergenic
1200733462 Y:6768319-6768341 GAGAGGAGAATTAGGGAAGATGG + Intergenic
1201276059 Y:12299907-12299929 AAGAGAAGACTCAGCGGAGAAGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic
1202046858 Y:20744207-20744229 AAGAGAAGAATCATGGAAGAAGG + Intergenic
1202053092 Y:20801380-20801402 CAGAGTAGAATCAGAGAAGGTGG - Intergenic
1202275843 Y:23118879-23118901 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202290185 Y:23301812-23301834 CAGTTTAGCCTCAGGGATGAAGG + Intergenic
1202428837 Y:24752598-24752620 CAGTTTAGCCTCAGGGATGAAGG - Intergenic
1202441954 Y:24917491-24917513 CAGTTTAGCCTCAGGGATGAAGG + Intergenic