ID: 961431366

View in Genome Browser
Species Human (GRCh38)
Location 3:126886233-126886255
Sequence CTGATTCACAAGTTCTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961431362_961431366 23 Left 961431362 3:126886187-126886209 CCTTTAATAACAAACTTTTATAG 0: 1
1: 0
2: 2
3: 32
4: 417
Right 961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG 0: 1
1: 0
2: 3
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961431366 Original CRISPR CTGATTCACAAGTTCTCTTT TGG Intronic
903312824 1:22473215-22473237 CTGATTCAGAAGTTCTGGGTGGG - Intronic
904310324 1:29625151-29625173 CTGATTCATAAGCTCTTGTTTGG + Intergenic
909882390 1:80896317-80896339 TTGATTCCCAAGTACACTTTTGG - Intergenic
910343107 1:86210234-86210256 TGGATTCTCAAGTTCTCTCTGGG + Intergenic
911834602 1:102600730-102600752 TTGATTCACAATGTCTCCTTAGG + Intergenic
912373800 1:109193958-109193980 CTGTTTCTCAGGTTCTCTGTAGG - Intronic
913547904 1:119887636-119887658 TTTATAGACAAGTTCTCTTTGGG + Intergenic
914007477 1:143744994-143745016 CTGATTCATAAATTACCTTTGGG - Intergenic
914646291 1:149655476-149655498 CTGATTCATAAATTACCTTTGGG - Intergenic
916212544 1:162370608-162370630 AAGATTCACAAGTTCCCTGTAGG + Intronic
917373847 1:174326342-174326364 ATGATTCCCAATTTCTCTGTTGG - Intronic
919031403 1:192247907-192247929 CTGAATCTCAAGTTTTCTGTTGG - Intergenic
921246861 1:213252651-213252673 AGGATTCCAAAGTTCTCTTTGGG - Intronic
921689063 1:218126732-218126754 CAGATTCACCAGTTCTGCTTAGG + Intergenic
924820467 1:247485059-247485081 CACACTCAAAAGTTCTCTTTAGG - Intergenic
1063646759 10:7892768-7892790 ATGAATCACTAGTTCTGTTTCGG - Intronic
1063952533 10:11237354-11237376 CAGCTTCTCAAGTTCTCTGTGGG + Intronic
1064065671 10:12179119-12179141 CTGATTCCCAAGTTCTGTTCAGG + Exonic
1065648543 10:27863525-27863547 ATTATTCACAAATTCTCCTTGGG - Intronic
1067255711 10:44637609-44637631 CTGATACACTGGCTCTCTTTTGG + Intergenic
1068294128 10:55045481-55045503 CTGTTTCACAAGATCTTTGTGGG + Intronic
1074167643 10:110898715-110898737 CTGCTTCACATGTTTTATTTTGG - Exonic
1074265259 10:111895680-111895702 CTGATTTATTAGTTCTTTTTTGG - Intergenic
1074429980 10:113386227-113386249 CTGAGTCACCAGTTTTCATTGGG + Intergenic
1078544014 11:12233738-12233760 TTTATTCTCATGTTCTCTTTGGG + Intronic
1079619048 11:22530699-22530721 CTGACTCACAAGTTCATTCTGGG - Intergenic
1080526621 11:33128366-33128388 TTGATTTATAAATTCTCTTTTGG - Intronic
1080706230 11:34697142-34697164 AGGATTCACAACTTCACTTTGGG + Intergenic
1080901068 11:36491804-36491826 CTGAGTCCTAATTTCTCTTTGGG + Intronic
1086092142 11:83015491-83015513 CTGAATCAAGAGTCCTCTTTTGG + Intronic
1089068767 11:115682397-115682419 CTGAGTCTCAAGTTCTTTGTGGG + Intergenic
1090571347 11:128049998-128050020 CTGATTCACACTTTCACTTCTGG - Intergenic
1090658887 11:128866880-128866902 CTGATTCCAAAGTCTTCTTTTGG - Intronic
1092190548 12:6516681-6516703 CTGAGCAACAAGTCCTCTTTGGG + Intronic
1092283709 12:7116361-7116383 CTGATTGACAAGTTCTGTGGAGG - Intergenic
1093965253 12:25317383-25317405 CTTATTAACACCTTCTCTTTTGG + Intergenic
1096023236 12:48339400-48339422 CTGATTCAGTAGTTCTCCTGGGG + Exonic
1096453583 12:51766794-51766816 CTGATTCAGTAGTTCTGATTTGG - Intronic
1099570061 12:84305595-84305617 CTGTTTCACAAGTTTGCTATAGG - Intergenic
1099657795 12:85517185-85517207 CTGATTCAGAAGTACGCCTTGGG + Intergenic
1101178264 12:102180271-102180293 CTGTTTAACAAGTTTGCTTTTGG + Intronic
1104838137 12:131805446-131805468 CTGATTCACCAGTTCTCTTCTGG + Intergenic
1106061978 13:26302249-26302271 AGAATTCACAATTTCTCTTTTGG - Intronic
1106278340 13:28237430-28237452 CTGGTTCACAGGTTCTCTAGGGG - Intronic
1109516739 13:63452791-63452813 TTGAATCTCAAGATCTCTTTGGG - Intergenic
1110025537 13:70533956-70533978 TTGAGTCACAATTTCTGTTTTGG + Intergenic
1110697538 13:78509302-78509324 CTGATCCGCAATTCCTCTTTCGG + Intergenic
1110732282 13:78892914-78892936 CTGTTTCACATGTTTTATTTTGG + Intergenic
1112151519 13:96769671-96769693 CTGATAAACAATTACTCTTTTGG + Intronic
1115711076 14:36051334-36051356 CTGATTTAGAGTTTCTCTTTTGG + Intergenic
1116465580 14:45228820-45228842 ATGATACACAAGTACTTTTTAGG + Intronic
1116661382 14:47715356-47715378 CTTATCCACAATTTCACTTTAGG + Intergenic
1117098372 14:52320358-52320380 ATAATGCACAAATTCTCTTTTGG - Intronic
1118075437 14:62293399-62293421 CTGCTACACAAGTGTTCTTTAGG + Intergenic
1118568360 14:67167753-67167775 ATGATTCTCAAGATCTCTTCTGG - Intronic
1121944088 14:98102664-98102686 CAAATTCACAAGTTCTTTTTGGG + Intergenic
1122018135 14:98814352-98814374 CTGATTCACAGGTCCTCACTGGG + Intergenic
1125822818 15:42648140-42648162 GCTATTGACAAGTTCTCTTTTGG + Intronic
1125919335 15:43516298-43516320 CTGAGTCACTAGTACTCTTGGGG - Intronic
1126491299 15:49239637-49239659 CTCATTCACAAGTTAAATTTAGG + Intronic
1126954355 15:53915420-53915442 CTTCCTCACAGGTTCTCTTTAGG - Intergenic
1127592568 15:60440620-60440642 CTGATTCACTAGGTCTGTATTGG - Intronic
1127942263 15:63710818-63710840 CTGCAACACAAGTTCCCTTTAGG - Intronic
1128583785 15:68829335-68829357 CTTAGTCACAATTTCTCTCTTGG - Intronic
1130688934 15:86063551-86063573 CTGATTCACTAGTTCACTTTGGG - Intergenic
1133914185 16:10093952-10093974 GTGATGCATCAGTTCTCTTTGGG - Intronic
1134742347 16:16559242-16559264 CTGAAACTCAAGTTCTGTTTGGG + Intergenic
1134925218 16:18153217-18153239 CTGAAACTCAAGTTCTGTTTGGG - Intergenic
1135186273 16:20318535-20318557 CTGATTGACTAGTTCACTTAAGG - Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1136630992 16:31489171-31489193 CTGATTCCCGAGTTCTCCTTCGG + Exonic
1141314507 16:82949059-82949081 CTCATTCAAAATATCTCTTTGGG - Intronic
1142949539 17:3466472-3466494 CTGAATCACAAGCTGTCTCTAGG + Intronic
1144233479 17:13232875-13232897 CTGATTCACATTTTCTGCTTGGG + Intergenic
1146490567 17:33278529-33278551 CTGATTCAATAGTTCTGGTTTGG + Intronic
1149438681 17:56656319-56656341 CTGGGTCACAAGTGGTCTTTGGG + Intergenic
1153178363 18:2404862-2404884 CAGATTCACAAATTTCCTTTGGG + Intergenic
1153234188 18:2970161-2970183 CTGATTCAATATTTCTGTTTGGG + Intronic
1155143637 18:23065647-23065669 TTGATTTTCAAGTTGTCTTTTGG + Intergenic
1155310228 18:24516163-24516185 TTGGTTCACAACTTATCTTTTGG + Intergenic
1157819528 18:50755420-50755442 CTTATTCACAGTTTCACTTTTGG + Intergenic
1161789549 19:6350910-6350932 CTGACACACAAATTCTCTATTGG - Intergenic
1163603679 19:18262950-18262972 GAGATCCACAAGTTCTCCTTAGG - Intronic
1165168431 19:33872954-33872976 CTGAGTCACCAGCTCCCTTTAGG - Intergenic
1168186711 19:54704908-54704930 GTGACTAACAAGTTCTCTTAGGG - Intergenic
1168387918 19:55981241-55981263 CTGTTTCCCAATTTCTCATTAGG - Intronic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
925244550 2:2369420-2369442 CTGAGTCCCAAGTTCACTTTAGG + Intergenic
925454801 2:4007082-4007104 CTGACTCACACTGTCTCTTTTGG + Intergenic
926307540 2:11649445-11649467 CTGAGTTTCAAGTTCTCTGTAGG - Intergenic
926457132 2:13080682-13080704 CTTAGTTACAAGTTCTCCTTTGG - Intergenic
929155341 2:38783939-38783961 CTGATTCAGTAGTTCTAGTTGGG + Exonic
930051219 2:47217690-47217712 CTGGGTCACAACTTCTTTTTAGG - Intergenic
930723056 2:54656466-54656488 CTAATTCACAGGGTCACTTTGGG - Intronic
931247235 2:60501427-60501449 CTGGTTTGTAAGTTCTCTTTCGG + Intronic
931621356 2:64213011-64213033 CTGACTCACAAGTTGGCTTGTGG + Intergenic
931673425 2:64670332-64670354 TTGATTCATAAGACCTCTTTAGG - Intronic
932882470 2:75516699-75516721 CTGATTCACAGGTATCCTTTGGG + Intronic
933128765 2:78645968-78645990 CTCATTTACAAGTTCACTTTGGG + Intergenic
933899527 2:86839685-86839707 CTTGTTCACAAGTTCTCATGGGG - Intronic
934907937 2:98222042-98222064 CTGTTTCACACTTTCTCCTTTGG - Intronic
935033157 2:99342022-99342044 TTCATTCCCAAGGTCTCTTTAGG - Intronic
935752822 2:106252670-106252692 CTGATTCAGGACTTTTCTTTTGG + Intergenic
935781033 2:106509541-106509563 CTTGTTCACAAGTTCTCATGGGG + Intergenic
935913241 2:107920211-107920233 CTGATTCAGGACTTTTCTTTTGG + Intergenic
938110543 2:128561476-128561498 CTAATTCTAAAGTTCACTTTGGG + Intergenic
939148358 2:138443539-138443561 TGGAATCACAAGTTCTGTTTGGG + Intergenic
945820040 2:214652535-214652557 CTGACTCACAATTATTCTTTGGG + Intergenic
947393219 2:229661314-229661336 CTGAGTAACAAGTTTTTTTTGGG - Intronic
947813140 2:233017203-233017225 CTGGTTCACAAGTACTCAGTAGG - Intergenic
1170354386 20:15476432-15476454 CTGATAGTCAAGTTTTCTTTTGG + Intronic
1172449363 20:35010814-35010836 CTGATTCTGAAGATCACTTTTGG - Intronic
1172604164 20:36203336-36203358 CTGCTTCACAAGTTGCCATTTGG + Intronic
1173151282 20:40568389-40568411 CTGATTCACATGTGCTCTGCTGG - Intergenic
1173209478 20:41021042-41021064 CTGCTTCCCAAGTTGTCCTTAGG - Intergenic
1173209579 20:41021732-41021754 CTGCTTCACAACTTCTCTTTGGG + Intergenic
1174901186 20:54502323-54502345 CTGATTCACCAGTTATCTCCTGG - Intronic
1175596071 20:60234085-60234107 CTTATTTAGAAGATCTCTTTGGG + Intergenic
1177343865 21:19842999-19843021 GTGCTTTACAGGTTCTCTTTCGG - Intergenic
1177454126 21:21313303-21313325 CAAATTCACAATTACTCTTTGGG - Intronic
1177668480 21:24193110-24193132 CTGATTAATAAGTTTTCTTTGGG - Intergenic
1178397027 21:32251579-32251601 GATATGCACAAGTTCTCTTTGGG - Intergenic
1178721681 21:35016340-35016362 CTGACTCACCAGTGCTCTTTAGG - Intronic
1181273330 22:21673502-21673524 TTGCTTCACAGGTACTCTTTGGG + Intronic
1185131283 22:49040531-49040553 CTTATTCACAAATATTCTTTGGG + Intergenic
950155790 3:10720658-10720680 CTGAATAACAGGTTCTCTGTGGG + Intergenic
951922210 3:27868992-27869014 CTGATTCCTAAATTCTCCTTTGG + Intergenic
953157675 3:40389504-40389526 CTGACTCACAATCACTCTTTTGG - Intronic
954049380 3:47960778-47960800 CTGACTCAGAAGTTGTCATTTGG - Intronic
955736434 3:62043566-62043588 CTGTTGCAAAAGGTCTCTTTTGG + Intronic
956432125 3:69197836-69197858 CTGATTAAGAATTTCTCTTAAGG + Intronic
957132412 3:76239632-76239654 TTGATTCACAAGTACTTCTTGGG + Intronic
957186107 3:76943450-76943472 CTAATTCAAAAGTTCACTCTGGG - Intronic
958282524 3:91689398-91689420 CTGTTTCACAACTGCTCTATAGG - Intergenic
958289787 3:91808475-91808497 CTGTTTCACAACTGCTCTATAGG - Intergenic
958292572 3:91854070-91854092 CTGTTTCACAACTGCTCTATAGG - Intergenic
958333513 3:92524477-92524499 CTGTTTCACAACTGCTCTATAGG - Intergenic
958360957 3:92974971-92974993 CTGTTTCACAACTGCTCTATAGG - Intergenic
958362497 3:93000308-93000330 CTGTTTCACAACTGCTCTATAGG - Intergenic
958364588 3:93034325-93034347 CTGTTTCACAACTGCTCTATAGG - Intergenic
958385206 3:93371160-93371182 CTGTTTCACAACTGCTCTATAGG - Intergenic
958387100 3:93402282-93402304 CTGTTTCACAACTGCTCTATAGG - Intergenic
959660560 3:108863566-108863588 CTGACTCATAAGTTTTCTATTGG + Intergenic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
962136383 3:132738616-132738638 GTTATCCACAATTTCTCTTTAGG + Intergenic
962347488 3:134628947-134628969 CTGAGGCTCAAGTCCTCTTTAGG - Intronic
962725178 3:138218422-138218444 CTGAAAAACAAGTTCGCTTTAGG - Intronic
962769279 3:138597138-138597160 CTGATTCTCAAATTTTCTTCTGG + Intergenic
965221920 3:165936921-165936943 CTGATTCACAGATTCTCATAAGG - Intergenic
974461802 4:62198100-62198122 CTATTTCAAAAGTTTTCTTTGGG - Intergenic
975017247 4:69437503-69437525 ATGAATCACAAATTTTCTTTTGG - Intergenic
976607126 4:86994550-86994572 CTGCTTCAGAAATTATCTTTTGG + Intronic
977048135 4:92092143-92092165 CTGATTCAATAGGTCTCTTGTGG + Intergenic
979040914 4:115792962-115792984 TTTATTCACAAATTATCTTTTGG + Intergenic
979736545 4:124092707-124092729 CTCAAACACAATTTCTCTTTTGG + Intergenic
979846539 4:125520293-125520315 CTGCTTCTCCAGTTCTCTCTCGG + Intergenic
980184074 4:129439849-129439871 GTGGTTCACAAGTTCTATTTTGG - Intergenic
980911056 4:138994967-138994989 CTGATGCCCAAGTTCTCCTGTGG + Intergenic
981469839 4:145119961-145119983 CTGAATCTCAAGTTTTCTGTTGG - Exonic
981997933 4:150994777-150994799 CTGAATCACAAGTACTTTTCTGG - Intronic
985383394 4:189419532-189419554 GTGATTCTTCAGTTCTCTTTCGG - Intergenic
986058794 5:4167510-4167532 CTGTTACACAAGATCTCCTTCGG + Intergenic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
989106744 5:37869934-37869956 ATTATTCACATGTTCTTTTTAGG + Intergenic
994383515 5:99100012-99100034 CTCATTCACAAGTCCTGCTTTGG + Intergenic
994529494 5:100951140-100951162 ATGATTCAGAACTTCTCTGTAGG + Intergenic
995259121 5:110081458-110081480 CTGAGTTGCCAGTTCTCTTTAGG + Intergenic
996108624 5:119538125-119538147 ATAAATCACAAGTTCTATTTTGG - Intronic
996672737 5:126137316-126137338 CTGGGACACAAGTTCACTTTTGG + Intergenic
998638118 5:143979762-143979784 CAGAGTCACAAGTTCTTTCTAGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000796502 5:165671216-165671238 CATATTCCCAAGTTCTATTTTGG - Intergenic
1004937234 6:20519578-20519600 CTGATTAAGAAGTTCACTCTGGG + Intergenic
1005511335 6:26514393-26514415 CTGATTCAGGAGTTCTCAGTGGG - Intergenic
1008815917 6:55566260-55566282 CTGACAGACATGTTCTCTTTGGG + Intronic
1009443409 6:63710416-63710438 CTCATTCACATGTTTTCCTTAGG + Intronic
1010405193 6:75496796-75496818 CTTATTGAAAAGTTTTCTTTGGG - Intergenic
1013351756 6:109312232-109312254 CTGAGTCACAAGTCCACTTGGGG + Intergenic
1014530849 6:122557502-122557524 ATCTTACACAAGTTCTCTTTTGG - Intronic
1016923777 6:149319607-149319629 GTGATTCAGAACTTCTGTTTGGG + Intronic
1019364672 7:627290-627312 CTGATTAAAATGTTATCTTTTGG - Intronic
1020807437 7:12808075-12808097 CCCATTCATAAGTTCTCTTATGG + Intergenic
1023261776 7:38365334-38365356 TTATTTCATAAGTTCTCTTTTGG + Intergenic
1024288724 7:47784232-47784254 CTGCTTCAACATTTCTCTTTAGG + Intronic
1024901812 7:54326759-54326781 CTAATTCACAAGCTCTATATTGG + Intergenic
1028365121 7:90020278-90020300 CTGATTCAGTAGCTCTCTTGTGG + Intergenic
1030444696 7:109634672-109634694 CTGGACCTCAAGTTCTCTTTGGG - Intergenic
1032761330 7:134946103-134946125 CTCATTCACAAGTAACCTTTTGG + Intronic
1034487839 7:151377315-151377337 CTGAATTACAAGTCCTCTTTGGG + Exonic
1035677154 8:1463841-1463863 CTGATTCACAAGCTCTGCTGGGG + Intergenic
1039205374 8:35147173-35147195 CTGTATCACAAACTCTCTTTTGG + Intergenic
1039933776 8:42020790-42020812 CTGCTTCTCAAGTTTTCCTTTGG - Intronic
1041111890 8:54490840-54490862 CTAAGTCAACAGTTCTCTTTGGG + Intergenic
1042324056 8:67509554-67509576 CTCATTCACATGTTCTCTATTGG - Exonic
1042675752 8:71319843-71319865 CTGATCCAAAAGTTCTATTTTGG - Intronic
1044822327 8:96162608-96162630 CTGACACACAAGTTCTCTGTGGG - Intergenic
1046818409 8:118610337-118610359 CTGATTTGCTAGTTGTCTTTTGG - Intronic
1050637206 9:7624915-7624937 CAGAGCCACAAGTTGTCTTTTGG + Intergenic
1051337808 9:16082459-16082481 CTGAATTCCAAGTTATCTTTGGG + Intergenic
1052070329 9:24073955-24073977 CTGATTTAAAAGTCCTCCTTTGG + Intergenic
1054913461 9:70475050-70475072 CTGAGTCTCCAGTTCTCATTAGG + Intergenic
1055199317 9:73639786-73639808 ATGATTCATATGTACTCTTTTGG - Intergenic
1058360338 9:104138771-104138793 ATTATTCAGAAGTTCTGTTTGGG + Intronic
1058656551 9:107227320-107227342 CTGTTTAAGAAGTACTCTTTTGG - Intergenic
1058941173 9:109813954-109813976 CTGGTTCGCATGTGCTCTTTTGG + Intronic
1059070245 9:111128057-111128079 CTGAGTCCCAAGTTCCCTTCAGG + Intergenic
1060130317 9:121090973-121090995 TTCCTTCACAAGCTCTCTTTAGG - Intronic
1061560952 9:131402808-131402830 CTGACCCACAAGTTCTCTTCTGG - Intronic
1203421363 Un_KI270521v1:855-877 GTGTTTCAAAACTTCTCTTTCGG - Intergenic
1186397095 X:9220702-9220724 CTGATGCACACCTTCTCTATGGG + Intergenic
1186918727 X:14253058-14253080 CTGATTCAGAAGTTCTAAGTGGG + Intergenic
1189226464 X:39417383-39417405 CTGATGGAAATGTTCTCTTTTGG - Intergenic
1189403280 X:40692494-40692516 GTGTTTCACAAGTTCTCTCATGG + Intronic
1189716293 X:43870215-43870237 CTGTTTCATAATTTCTCTCTTGG + Intronic
1189735947 X:44069994-44070016 CTGATTCAGAAGTTCTGTGGTGG + Intergenic
1191595698 X:62941632-62941654 TTGATTTACAATTTCTTTTTTGG + Intergenic
1193733155 X:85125970-85125992 TTGATCCAGAAGATCTCTTTAGG + Intergenic
1193869185 X:86776130-86776152 CTGATTCAGACATGCTCTTTTGG - Intronic
1195526605 X:105898087-105898109 CTGATTCAAAAGGTCTATGTAGG + Intronic
1195839069 X:109152099-109152121 CAGCTTCCCATGTTCTCTTTTGG + Intergenic
1196322994 X:114365577-114365599 CTGTTTTACAAGTCCTCTTGGGG - Intergenic
1196355797 X:114790828-114790850 CTTATTCACAAGTTTTATTATGG + Intronic
1197249458 X:124199902-124199924 GTGATTCACAAATTCACTCTGGG + Intronic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic
1198139134 X:133785178-133785200 CTGATTCTCTCTTTCTCTTTTGG + Intronic
1200733036 Y:6763089-6763111 CATAGTCACAACTTCTCTTTGGG - Intergenic